Rhodotorula mucilaginosa and application thereof in cider fermentation

Abstract

The invention discloses rhodotorula mucilaginosa and application thereof in cider fermentation, and belongs to the technical field of microbial fermentation. The rhodotorula mucilaginosa CXY1113 is separated from naturally-fermented cider wine, can tolerate a low-pH acid environment, and can reduce the content of malic acid by using malic acid as a carbon source. Compared with independent fermentation of saccharomyces cerevisiae, the rhodotorula mucilaginosa CXY1113 is applied to apple wine production, so that the brightness of fruit wine can be improved, and the antioxidant activity can be enhanced; the contents of malic acid, acetic acid and succinic acid in the cider can be reduced; the content of flavor compounds such as phenethyl acetate and isoamyl alcohol can be increased, and the obtained apple wine is fragrant in aroma, high in quality and coordinated in fruit wine taste and is endowed with richer flower fragrance and fruit fragrance. The method has important significance in improving the taste and flavor of fruit wine and improving the quality of fruit wine.

Description

Technical Field

[0001] The invention relates to a red yeast strain and application of the strain in cider fermentation, belonging to the technical field of microbial fermentation. Background Art

[0002] Fruit wine is a low-alcohol beverage with fruit flavor and alcohol content usually between 7% and 18% made by squeezing fresh fruit juice and fermenting it with yeast. The natural fermentation of fruit wine is a complex process of microbial cooperation, and different yeasts play different roles. The interaction of yeasts will affect the flavor and quality of fruit wine. Saccharomyces cerevisiae is widely used in fruit wine fermentation. Although saccharomyces cerevisiae helps to improve the uniformity of fruit wine quality and prevent the corruption of fruit wine, the use of saccharomyces cerevisiae for fermentation alone will also lead to problems such as monotonous composition and single aroma of fruit wine. Although non-saccharomyces cerevisiae is not as good as saccharomyces cerevisiae in terms of alcohol yield and fermentation characteristics, it can release aromatic compounds by degrading glycosidic bonds through secreted enzymes, and can also directly synthesize or adjust flavor components through its own metabolism, making the fruit wine fragrant and the typicality of the wine body prominent. At present, the use of saccharomyces cerevisiae and non-saccharomyces cerevisiae to co-ferment to improve the flavor of fruit wine has become one of the research hotspots.

[0003] The content of organic acids in fruit wine is determined by many factors. A small amount of organic acid can make fruit wine mellow and refreshing, but too much organic acid will also reduce the taste and quality of fruit wine and make people's mouth sour. There are three acid reduction methods currently used in fruit wine: physical, chemical, and biological. Among them, the physical acid reduction method has a long natural cycle and low efficiency. The acid reducer used in the chemical acid reduction method may cause the wine body to be unbalanced and cannot meet the needs of consumers for natural, green, and chemical-free additions. The biological acid reduction method not only has no effect on the quality of fruit wine, but also uses the metabolic utilization of microorganisms. Its acid reduction effect is very superior and has gradually become a hot spot in acid reduction research at home and abroad. Therefore, finding more efficient acid reduction microorganisms and screening strains with excellent acid reduction characteristics have become an important trend in current acid reduction methods.

[0004] Chinese patent CN115786144B discloses an abnormal Wickham yeast and its application in reducing acid and fixing color in blueberry wine. During the fermentation process of blueberry wine, it can catalyze the decarboxylation of hydroxycinnamic acid in juice into corresponding vinylphenol, which further combines with anthocyanin to generate pyranoanthocyanin with better stability, achieving color fixation of blueberry wine while avoiding the production of unpleasant sour taste and atmosphere in the wine; Chinese patent CN117247850A uses a strain of Pichia kudriavzevii with acid resistance, which can tolerate a minimum pH of 2.0 and can increase the content of ester substances in high-acid fruit wine, making the fruit wine rich in aroma and harmonious in taste. However, these strains cannot degrade malic acid and cannot be used in the fermentation of apple wine.

[0005] Apples contain a large amount of organic acids, among which malic acid has the highest content, reaching more than 74%. High concentrations of malic acid will affect the flavor of fruit wine, causing it to have a sour and rough taste and produce a noticeable bitterness. Since the winemaking strains in the prior art cannot effectively degrade malic acid, the organic acid content, mainly malic acid, in the fermented apple wine is high, and the taste and flavor are greatly reduced. Therefore, it is of great significance to provide a strain that can degrade malic acid and tolerate an acidic environment and can be used in the winemaking process. Summary of the invention

[0006] In view of the above problems, the present invention provides an acid-resistant red yeast capable of reducing malic acid content, and application of the mixed fermentation of the red yeast and brewer's yeast in cider to improve the quality of cider.

[0007] The present invention is achieved through the following technical solutions:

[0008] The present invention provides a red yeast isolated from naturally fermented apple cider, with a preservation number of CDMCC No: 64464. The red yeast involved in the present invention has been deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 28, 2024, and the preservation address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0009] In one embodiment, the red yeast has the following properties:

[0010] (1) Isolation from naturally fermented cider;

[0011] (2) Can withstand an acidic environment of pH 3;

[0012] (3) It can use malic acid as a carbon source to reduce the content of malic acid.

[0013] When this red yeast strain is used to co-ferment cider with brewer's yeast, it can reduce the content of malic acid and acetic acid, increase the total phenolic content and antioxidant capacity of cider, and enhance the content of flavor compounds such as isoamyl acetate, hexyl acetate, phenylethyl acetate and isoamyl alcohol in cider, giving the cider floral and fruity aromas, making the typical aroma of cider more prominent.

[0014] The invention provides a bacterial agent containing the red yeast CXY1113.

[0015] In one embodiment, the bacterial agent comprises Rhodotorula CXY1113 or comprises Rhodotorula CXY1113 and its fermentation supernatant.

[0016] Preferably, the Rhodotorula CXY1113 is present in the starter in the form of live bacteria.

[0017] In one embodiment, in the bacterial agent, the amount of the red yeast CXY1113 is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

[0018] The present invention provides a method for preparing the starter, which comprises the steps of culturing Rhodotorula CXY1113 to obtain a bacterial solution:

[0019] (1) Pick a single colony of Rhodotorula CXY1113 and inoculate it into 10 mL of YPD medium, and culture it at 28-30°C and 200-250 rpm for 24 h to obtain bacterial solution A;

[0020] (2) Then, the bacterial solution A was inoculated into 50 mL YPD medium, and cultured under shaking conditions of 28-30° C. and 200-250 rpm for 24 h to obtain bacterial solution B;

[0021] (3) The bacterial solution B was centrifuged at 8000 rpm for 10 min, and the bacterial cells were collected and diluted with a 0.9% (w / v) sodium chloride aqueous solution to prepare a bacterial suspension.

[0022] Preferably, the culturing is carried out at 28°C.

[0023] The invention provides a product containing the Rhodotorula CXY1113 or the bacterial agent.

[0024] In one embodiment, the product includes but is not limited to fruit wine.

[0025] The invention provides a method for preparing apple wine, wherein the red yeast CXY1113 and brewer's yeast are added to a substrate containing apple juice for fermentation.

[0026] In one embodiment, the initial soluble solids (SSC) concentration of apple juice is 20 o Brix.

[0027] In one embodiment, brewer's yeast and the fermentation agent are added before the cider fermentation for fermentation.

[0028] Preferably, the concentration of the brewer's yeast in the initial fermentation system is 1×10 6 ~10 7 CFU / mL.

[0029] In one embodiment, the inoculation method of the red yeast CXY1113 and the cerevisiae yeast is to inoculate simultaneously or first inoculate the red yeast CXY1113 and then inoculate the cerevisiae yeast 72 hours later.

[0030] Preferably, the inoculation time of Saccharomyces cerevisiae and the Rhodotorula officinalis CXY1113 is simultaneous.

[0031] Preferably, the fermentation ratio of brewer's yeast to the red yeast CXY1113 is 1:1.

[0032] The present invention also provides application of the red yeast CXY1113 or the bacterial agent in preparing apple wine.

[0033] The present invention also provides the use of the red yeast CXY1113 or the bacterial agent in increasing the content of flavor substances in cider, wherein the flavor substances include one or more of isopentyl acetate, hexyl acetate, phenylethyl acetate or isopentyl alcohol.

[0034] The red yeast used in this application has been widely used in food, for example, a red yeast isolated from a local winemaking area in China. Under winemaking conditions, its β-glucosidase extract shows good tolerance, and the effect of mixing it with saccharomyces cerevisiae inoculated in Ecolly dry white wine fermentation is studied, and the results show that mixed fermentation improves citrus, sweet fruit, sour fruit, berry and floral properties (Wang XC, Li AH, Dizy M, et al. Evaluation of aroma enhancement for "Ecolly" dry white wines by mixed inoculation of selected Rhodotorula mucilaginosa and Saccharomyces cerevisiae [J]. Food Chemistry, 2017, 228: 550-559). At the same time, studies have shown that Rhodotorula is one of the common bacteria species in apple skin and is also the dominant bacteria species in apple skin in Liaoning (Wei J, Niu C, Liu B, et al. Identification and characterization of epiphytic yeasts on apples in China [J]. Rsc Advances, 2017, 7 (71): 44766-44772). There are also studies that screened out Rhodotorula strains from high-salt dilute mash, which has a certain effect on improving the flavor of soy sauce (Wang Jingwen, Zhao Mouming, Chen Tao, et al. Screening, identification and fermentation characteristics of functional yeasts in high-salt dilute mash [J] Food Science, 2021, 42 (22): 91-97). In addition, a strain of Rhodotorula glutinosus isolated and purified from the air of a Luzhou-flavor liquor brewing workshop produced ethanol and ethyl hexanoate as its dominant products, as well as a small amount of higher alcohols, esters, phenols and other aromatic components (Huang Zhiguo, Peng Sijie, Li Hao, et al., Isolation, Identification and Growth Characteristics of Yeast in the Air of a Luzhou-flavor Liquor Brewing Workshop [J] Food and Machinery, 2021, 37(03):7-11). The comprehensive results show that Rhodotorula glutinosus is a safe strain that can be used in food and wine production.

[0035] Beneficial effects:

[0036] The present invention separates and obtains a red yeast strain CXY1113 from naturally fermented cider. The red yeast strain CXY1113 can tolerate an acidic environment with a pH value of 3, can use malic acid as a carbon source, can reduce 62% of malic acid in a culture medium with malic acid as the sole carbon source, can reduce 28% of malic acid in a culture medium with malic acid and glucose as dual carbon sources, and can also reduce the content of malic acid during the fermentation process of cider, with a degradation rate of 8%.

[0037] The present invention uses the red yeast CXY1113 and saccharomyces cerevisiae as a fermentation agent to prepare apple wine. Compared with fermentation of saccharomyces cerevisiae alone, the combination of red yeast CXY1113 and saccharomyces cerevisiae can increase the brightness of fruit wine by more than 10%, enhance the antioxidant activity of fruit wine, increase the DPPH free radical scavenging ability by more than 4 times, and increase the total phenol content to more than 1.9 times that of apple juice. In addition, the contents of malic acid, acetic acid, and succinic acid in apple wine can be reduced, wherein the acetic acid content can be reduced by more than 2 times, and the succinic acid content can be reduced by up to 1.5 times.

[0038] The apple wine prepared by combining the red yeast CXY1113 and the brewer's yeast has a DPPH free radical scavenging capacity of 87.50% and an ABTS scavenging capacity of 94.73%, which is equivalent to that of unfermented apple juice; the flavonoid and total phenol contents are 0.119 and 0.086 mg / mL, respectively, which are significantly higher than those of apple juice. At the same time, compared with apple juice, the organic acid content in the obtained apple wine is significantly reduced, and the content of flavor compounds such as phenylethyl acetate and isopentanol is increased, so that the taste of the fruit wine is coordinated and has a richer floral and fruity aroma. On the basis of retaining the nutritional components and antioxidant activity of apple juice, the quality of the fermented fruit wine is greatly improved.

[0039] Therefore, the red yeast CXY1113 provided by the present invention is of great significance for enhancing the taste and flavor of fruit wine and improving the quality of fruit wine.

[0040] Biomaterial Deposit

[0041] The red yeast CXY1113 provided by the present invention is taxonomically named Rhodotorula mucilaginosa, and has been deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 28, 2024, with a deposit number of CDMCC No: 64464, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 It is the growth curve of each yeast strain in the medium of pH=3;

[0043] Figure 2 This is a statistical chart of weight loss of apple juice fermentation liquid during the fermentation process;

[0044] Figure 3 This is a statistical chart of the consumption of soluble solids (SSC) in apple juice fermentation broth during the fermentation process;

[0045] Figure 4 This is a statistical chart of organic acids in apple juice and cider. DETAILED DESCRIPTION

[0046] In order to make the purpose, technical solutions and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0047] The present invention is further described below in conjunction with the accompanying drawings and specific examples. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art; unless otherwise specified, the reagents and materials used in the following examples are commercially available. The cerevisiae CGMCC 2.3854 involved in the following comparative examples was purchased from the China General Microbial Culture Collection Administration Center.

[0048] The various culture media used in the present invention are prepared by conventional methods.

[0049] The preparation of the culture medium used in the present invention is as follows:

[0050] (1) Malic acid medium: 1 g / L yeast extract, 2 g / L peptone, 1 g / L malic acid. Autoclave for 20 min and then pour onto plates.

[0051] (2) YPD-malic acid medium: 1 g / L yeast extract, 2 g / L peptone, 1 g / L malic acid, 2 g / L glucose. Autoclave for 20 min and then pour onto plates.

[0052] (3) Acid resistance screening medium: YPD liquid medium, adjust the pH to 3 with phosphoric acid, sterilize by high pressure for 20 min, and then pour into plates.

[0053] Example 1 Screening and identification of strains

[0054] 1. Isolation and purification of strain CXY1113

[0055] (1) Samples were taken from the apple juice fermentation broth at regular intervals (0d, 2d, 4d, 6d, 8d), diluted in sequence, and 100 μL of the fermentation broth with different dilutions was spread on YPD agar medium (purchased from Qingdao Hi-Tech Park Haibo Biotechnology Co., Ltd.) supplemented with ampicillin sodium, and cultured in a constant temperature incubator at 28°C for 24-72h. Single colonies with typical yeast characteristics were picked for microscopic examination, and single colonies were streaked on YPD agar medium, and streaked twice for strain purification. A total of 14 non-brewery yeasts were screened from naturally fermented apple cider, and the strains were frozen and stored for subsequent screening.

[0056] One of the strains was Rhodotorula mucilaginosa, named Rhodotorula mucilaginosa CXY1113. The 26S rDNA sequence of strain CXY1113 was amplified and sequenced, and the sequencing result is shown in SEQ ID NO: 1. It was identified as Rhodotorula mucilaginosa.

[0057] The sequence is as follows:

[0058] CGCGCTTCACAGCATCCTTCGTGTGAAGAAGGTCGAAACCCCCGCCAAAGGCACA

[0059] CTTCGCGTTTCCTTCAGTCCCCCAAGATGTATCCAGCAGAGAGCTATAACACAGCCGAA

[0060] ACTGCTACCTTCTCTCTACCATTATCCATCCCGGAAAACTGATGCTGGCCTGCAAACCGA

[0061] TTGCTCGGCAAGCAAGTCTGACTTCAAGCGTTTCCCTTCCAACAATTTCACGTACTGTTA

[0062] ACTCCTTTCCAAAGTGCTTTTCATCTTTCCCTCACGGTACTTGTTCGCTATCGGTCTCTC

[0063] GCCAATATTTAGCTTTAGATGGAATTTACCACCCAATTTGAGCTGCATTCCCAAACAACT

[0064] CGACTCTTCGAAAATGTATCACAAAGCGCTGGGCGTCCGCACCATATACGGGGGTCTCA

[0065] CCACTATGCCGCTGTATTCCAACAGACTTGTGTGCGGTCCAACGCGGAAAACATTTCTAG

[0066] AGATTACAACTCGGACACCGAAGGTGCCAGATTATAAATTTGAGCTCTTCCCGCTTCGCT

[0067] CGCCGCTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTATTGGGATTATGCAA;

[0068] The red yeast Rhodotorula mucilaginosa CXY1113 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 28, 2024, with a deposit number of CDMCC No: 64464, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0069] Example 2 Characteristics of Rhodotorula CXY1113

[0070] 1. Screen step by step in the order of primary screening for acid-reducing performance → secondary screening for acid-reducing performance → screening for acid-resistance performance to obtain a yeast strain that has both malic acid-reducing properties and acid-resistance properties.

[0071] 2. Initial screening of acid-reducing strains: 1.0×10 7 CFU / mL inoculation amount, inoculate 14 non-brewer's yeast strains in malic acid medium, and culture at 28℃ for 6 days. Determine the total acid content after the fermentation is completed. Refer to the titration method of GB / T 12456-2021, take 1mL of sample and dilute to volume in a 100mL volumetric flask. Take 20mL of the sample after dilution and add a few drops of 1% phenolphthalein-ethanol solution. Titrate the solution with the calibrated standard NaOH solution until it turns slightly red. If the red does not fade within 30s, it is counted as the titration end point. Record the volume of the consumed NaOH standard solution to calculate the total acid content. Calculate the total acid degradation rate as the initial screening indicator.

[0072]

[0073] Where: C0 is the concentration of malic acid before degradation; C1 is the concentration of malic acid after degradation. In malic acid culture medium, 14 strains of non-brewer's yeast all grew well, and 11 strains of non-brewer's yeast had good acid degradation ability, with a total acid degradation rate of more than 60%, and subsequent re-screening experiments were carried out.

[0074] 3. Rescreening of acid-reducing strains: according to 1.0×10 7 The 11 strains of non-brewer's yeast selected in the initial screening were inoculated with an inoculum of CFU / mL in malic acid-YPD medium and cultured at 28°C for 6 days. The total acid content after the fermentation was determined, and the total acid degradation rate was calculated as a measure of acid reduction in the rescreening. The main difference between the rescreening medium and the primary screening medium is that the rescreening medium contains glucose, and yeast will preferentially use glucose as a carbon source compared to malic acid. The rescreening experiment can reflect the ability of the screened strains to degrade malic acid in the presence of glucose and malic acid. During the rescreening, a total of 4 strains of non-brewer's yeast had good acid reduction ability, and the total acid degradation rate reached more than 20%. The acid reduction ability was ranked as Zygosaccharomyces CXY1117>Rhodotorula CXY1113=Candida CXY1104>Pichia pastoris CP09.

[0075] The degradation rate of malic acid by the red yeast CXY1113 in malic acid medium is 62%, and the degradation rate of malic acid in YPD-malic acid medium is 28%.

[0076] 4. Acid resistance screening: The non-brewer's yeast screened out by rescreening was concentrated to 1.0×10 7 The inoculum of CFU / mL was inoculated into the acid-resistant screening medium and cultured at 28°C for 3 days. The OD was measured every 12 hours. 600nm The four non-brew yeast strains all grew well in a low pH environment and had strong acid resistance. The acid resistance was ranked as follows: Rhodotorula CXY1113>Candida CXY1104>Pichia guilliermondii CP09>Zygosaccharomyces CXY1117.

[0077] Example 3 Evaluation of mixed fermentation of red yeast CXY1113 and Saccharomyces cerevisiae to improve the quality of apple wine

[0078] In the following examples, the Rhodotorula CXY1113 is abbreviated as Rh, and the comparative example Saccharomyces cerevisiae CGMCC 2.3854 is abbreviated as Sc.

[0079] In the following examples, in order to evaluate the effect of Rhodotorula CXY1113 in cider, fresh Shandong Fuji apples were selected, filtered and sterilized for use. Cider fermentation was divided into the following groups: Rh-Sc (inoculated 10 6 CFU / mL Rhodotorula CXY1113 was inoculated at the same time 6 CFU / mL of Saccharomyces cerevisiae in 200mL of apple juice), Rh-Sc-72 (inoculated with 10 6 CFU / mL Rhodotorula CXY1113 was added to 200 mL apple juice and inoculated with 10 6 CFU / mL cerevisiae) and Sc (inoculated with 10 6 CFU / mL of Saccharomyces cerevisiae in 200mL of apple juice). The fermentation temperature was 28℃ and the fermentation time was 11 days.

[0080] During the fruit wine fermentation process, yeast will use the sugar substances in the system to grow and reproduce and produce alcohol fermentation. The faster the sugar is consumed, the more CO2 is produced. Therefore, the yeast fermentation rate was studied by detecting the changes in soluble solids and CO2 during the fermentation process.

[0081] 1. Changes in cider fermentation rate

[0082] During the fermentation process, samples were taken every day to measure the soluble solid content and CO2 weight loss. Figure 2As shown in the figure, the CO2 cumulative weight loss of Rh-Sc is the highest, which is 20.88±0.07g, higher than that of the comparative example Sc (18.47±0.76g). In the whole fermentation process, the CO2 weight loss rate of Rh-Sc is higher than that of the comparative example Sc, and the CO2 weight loss of Rh-Sc-72 is the lowest. The results of SSC are consistent with the CO2 weight loss results, such as Figure 3 As shown, the cider fermentation can be completed in 11 days. During the fermentation process, the consumption rate of SSC is Rh-Sc>Comparative Example Sc. The soluble solids content of Rh-Sc-72 changes slowly in the first 3 days, but on the 4th day, after Sc inoculation, the soluble solids content of Rh-Sc-72 decreases rapidly.

[0083] 2. Physical and chemical indicators of apple wine

[0084] After the fermentation, the cider was centrifuged at 8000 rpm for 10 min, and the supernatant was taken for pH, titratable acid, glucose and color determination. pH was determined using a pH meter. The total acidity of the sample (calculated as malic acid) was determined according to the GB / T 15038-2006 method. Glucose content was determined using a biochemical sensor. Chroma values ​​(L, a, b) were determined using a colorimeter.

[0085] As shown in Table 1, the chromaticity of the three groups of cider differed significantly, with L* values ​​(brightness) ranging from 0 (black) to 100 (white). The L* values ​​of the mixed fermentation groups Rh-Sc and Rh-Sc-72 were significantly higher than those of the comparative example Sc, increasing by more than 10%, indicating that the wine was brighter and lighter in color, and the visual sense of the wine was improved. The glucose content of Rh-Sc was significantly lower than that of the other groups, indicating that its fermentation was more thorough.

[0086] Table 1 Test results of physical and chemical indicators of apple juice and cider

[0087] Apple Juice Sc Rh-Sc Rh-Sc-72 pH 4.01±0.06 3.91±0.17 4.05±0.03 3.97±0.04 Titratable acid (g / L) <![CDATA[2.02±0.01 b ]]> <![CDATA[3.12±0.02 a ]]> <![CDATA[2.72±0.02 a ]]> <![CDATA[2.84±0.04 a ]]> Glucose (mg / L) NA <![CDATA[4.2±0.17 a ]]> <![CDATA[2.4±0.26 c ]]> <![CDATA[2.9±0.06 b ]]> L* NA <![CDATA[78.45±3.23 b ]]> <![CDATA[87.42±2.37 a ]]> <![CDATA[87.01±0.41 a ]]> a* NA <![CDATA[1.86±0.75 a ]]> <![CDATA[-0.5±0.17 b ]]> <![CDATA[-0.06±0.15 b ]]> b* NA <![CDATA[25.46±3.63 a ]]> <![CDATA[12.88±0.62 b ]]> <![CDATA[15.42±1.10 b ]]>

[0088] 3. Organic acids in apple juice and cider

[0089] Organic acids were determined by high performance liquid chromatography (Agilent 1220 Infinity II system, Agilent Technologies Inc., Palo Alto, CA, USA). A ZORBAX-SB C18 column (5 μm, 4.6 × 250 mm) and a UV detector (210 nm) were used. The sample injection volume was 20 μL. The flow rate was 1.0 mL / min. Mobile phase A was diammonium hydrogen phosphate buffer (0.01 mol / L, pH = 2.8), and mobile phase B was methanol solution. The elution gradient was 98:2 (v / v). Organic acid standard curve and sample organic acid content determination: Prepare 6 concentrations of organic acid mixed standards (malic acid, acetic acid, tartaric acid, succinic acid, citric acid) at 50ppm, 62.5ppm, 83.3ppm, 125ppm, 250ppm and 500ppm, filter through 0.22μm filter membrane and inject, draw standard curve according to concentration and peak area, and set three parallels for each sample. Cider samples are first filtered through 0.22μm filter membrane, then diluted to a certain multiple with Wahaha pure water and shaken to mix, and 20μL sample is injected for determination.

[0090] Changes in organic acid content Figure 4 As shown, malic acid is the organic acid with the highest content in apple juice (2169.10 mg / L), with a strong and sharp taste sensation. The malic acid content of mixed fermentation cider is significantly lower than that of apple juice and Sc (2043.18 mg / L). The malic acid contents of Rh-Sc and Rh-Sc-72 are 1990.47 mg / L and 1958.00 mg / L, respectively, which is a decrease of more than 8%. It shows that the addition of Rhodotorula CXY1113 can effectively reduce the content of malic acid. This result may be due to the interaction between Rhodotorula CXY1113 and Saccharomyces cerevisiae during the fermentation process, resulting in a decrease in the content of malic acid. The acetic acid content of apple juice is 214.07 mg / L, and the mixed fermentation group can reduce the acetic acid content to below 151 mg / L. After fermentation, the lactic acid content was significantly improved, reaching more than 3999 mg / L.

[0091] 4. Antioxidant activity of juice and cider

[0092] The total phenol detection method refers to GB / T 8313-2008. The total flavonoid detection method refers to GB / T 5009.124-2003. The DPPH and ABTS free radical scavenging abilities are determined according to patent CN109125164A.

[0093] As shown in Table 2, the total phenol and total flavonoid contents of apple wine are significantly higher than those of apple juice. Among them, Rh-Sc-72 has the highest total phenol content (0.092 mg / mL). The DPPH scavenging ability of apple juice is 87.84%, and the DPPH scavenging ability of Rh-Sc is 87.50%, which is more than 4 times that of the comparative example Sc (20.99%). Patent CN109125164A discloses a strain of Rhodotorula glutinosus. After being added to black wolfberry fermentation pulp for fermentation, the total flavonoid content is 0.034 mg / mL, and the DPPH clearance rate is increased to 60%. In the present invention, the group to which Rhodotorula glutinosus is added can have a total flavonoid content of more than 0.119 mg / mL, and a DPPH clearance rate of up to 87.50%.

[0094] Table 2 Antioxidant activity test results of apple juice and apple wine

[0095]

[0096] 5. Volatile flavor compounds in juice and cider

[0097] The flavor substances were determined by 7890B-5977A gas chromatograph-mass spectrometer. Chromatographic column: HP-5MS (30m×0.25mm×0.25μm); injection temperature 250℃; mode: non-split; carrier gas is high-purity helium; flow rate: 1mL / min; injection port temperature is 250℃; column temperature program: 35℃ for 1min, increase to 80℃ at 10℃ / min, maintain for 2min, increase to 170℃ at 8℃ / min, maintain for 2min, then increase to 220℃ at 10℃ / min, maintain for 1min, and finally increase to 240℃ at 8℃ / min, maintain for 1min. MS parameters: EI mode, electron energy 70eV; ion source temperature 230℃; quadrupole temperature 150℃; full scan mode; mass scan range m / z 30~350u. Add 2 mL of sample and 20 μL of 400 mg / L internal standard (sec-octanol) to the headspace extraction bottle, place in a 60°C water bath for 20 min, extract for 20 min, and desorb at the injection port for 10 min. According to the detection results of volatile flavor compounds, the spectrum results are compared with the data of the standard mass spectrum library (NIST 17) for qualitative analysis, and the content of volatile flavor compounds is calculated using the internal standard method.

[0098] The aroma of fruit wine depends on the multiple interactions between volatile flavor compounds and all chemical components. In addition to the classification description and statistics of volatile flavor compounds, the relative odor activity value (rOAV) analysis should be carried out to explore the key aroma compounds in depth. Substances with rOAV>1.0 are the key aroma compounds of fruit wine. As shown in Table 3, there are 13 key aroma compounds. Rh-Sc cider increased the content of isoamyl acetate, hexyl acetate, phenylethyl acetate and isoamyl alcohol, giving the cider floral and fruity aromas. These results show that the simultaneous inoculation and fermentation of Rhodotorula CXY1113 and Saccharomyces cerevisiae can improve the aroma concentration and aroma complexity of cider.

[0099] Table 3 GC-MS test results of apple juice and cider

[0100]

[0101] In summary, the present invention provides a strain of Rhodotorula mucilaginosa CXY1113, which has been deposited in the Guangdong Provincial Microbial Culture Collection Center on March 28, 2024, with a deposit number of CDMCC NO: 64464. The Rhodotorula mucilaginosa CXY1113 has good acid resistance and can use malic acid as a carbon source to reduce the content of malic acid. When the strain is mixed with brewer's yeast for fermentation, the content of malic acid, acetic acid and succinic acid can be reduced, the brightness and antioxidant activity of fruit wine can be improved, and the content of volatile flavor compounds can be increased, and the flavor substances include one or more of isoamyl acetate, hexyl acetate, phenylethyl acetate and isoamyl alcohol. When the Rhodotorula mucilaginosa CXY1113 is used to ferment apple wine, the flavor of the fermented apple wine is improved, and the obtained apple wine is clear and transparent, fragrant, and has a harmonious taste.

[0102] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Rhodotorula mucilaginosa CXY1113, characterized in that: The red yeast was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 28, 2024, with the deposit number being CDMCC No: 64464.

2. A bacterial agent, characterized in that The bacterial agent includes the red yeast CXY1113 according to claim 1.

3. The bacterial agent according to claim 2, characterized in that In the bacterial agent, the amount of the red yeast CXY1113 is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

4. A product, characterized in that Contains the red yeast CXY1113 according to claim 1 or the bacterial agent according to claim 2 or 3.

5. The product according to claim 4, characterized in that The products include but are not limited to fruit wine.

6. A method for preparing cider, characterized in that: The red yeast CXY1113 and brewer's yeast according to claim 1 are added to a substrate containing apple juice for fermentation.

7. The method according to claim 6, characterized in that: The red yeast CXY1113 and the saccharomyces cerevisiae are added to the substrate simultaneously or separately.

8. The method according to claim 7, characterized in that In the substrate, the inoculation concentration of the red yeast CXY1113 is (1×10 6 )~(1×10 7 ) CFU / mL; the inoculation concentration of the brewer's yeast is (1×10 6 )~(1×10 7 ) CFU / mL; ferment at 18-28°C for at least 10 days.

9. Use of the Rhodotorula CXY1113 according to claim 1 or the bacterial agent according to claim 2 or 3 in the preparation of cider.

10. Use of the red yeast CXY1113 of claim 1 or the bacterial agent of claim 2 or 3 in increasing the content of flavor substances in cider, characterized in that: The flavor substances include one or more of isopentyl acetate, hexyl acetate, phenylethyl acetate or isopentyl alcohol.

Images