Recombinant cell based on mammal reverse transcription protein, method for delivering antigen vaccine based on recombinant cell and application

Abstract

The invention provides a recombinant cell based on mammal reverse transcription protein, a method for delivering an antigen vaccine based on the recombinant cell and application, membrane protein of the recombinant cell is fused with capsid protein PEG10 and antigens, the antigens comprise tumor specific antigens and tumor-associated antigens, the amino terminal of the recombinant cell membrane protein is modified by an adjuvant, and the recombinant cell membrane protein is modified by the adjuvant. The recombinant cell has the functions of activating DC cells, cooperatively promoting tumor neoantigen presentation and activating neoantigen specific T cells to play an anti-tumor role.

Description

Technical Field

[0001] The present invention relates to the preparation and surface modification of virus-like particles, which can be used to deliver tumor neoantigens and play a role as a tumor vaccine delivery carrier in anti-tumor applications. Background Art

[0002] Tumor neoantigens are tumor-specific antigens, which are peptides or proteins produced by tumor cells due to gene mutations. The neoantigen epitopes carried on them can be recognized by the immune system, so that immune cells can attack tumors accurately. Compared with tumor-associated antigens, immunotherapy targeting neoantigens has the advantages of strong specificity, low toxicity and side effects, low probability of immune tolerance, and personalized precision treatment. In July 2017, Nature simultaneously published two clinical studies targeting tumor neoantigens and successfully treating advanced melanoma, affirming the personalized treatment model of tumor neoantigens. Although tumor neoantigen peptide vaccines have achieved gratifying results in various trials, the synthesis cycle of peptides is long and the cost is high, and some peptides cannot be synthesized in vitro. Therefore, choosing a suitable tumor neoantigen information carrier is more conducive to exerting its anti-tumor advantages. The viroid delivery system is a new delivery system based on the traditional lentiviral system, which can not only specifically deliver mRNA but also directly deliver target proteins. At present, the more mature viroid vector for protein delivery is modified from murine leukemia virus (MLV). In 2019, Nature Communications and in 2021, Cell Reports reported on the viral gene editing delivery system developed based on MLV, which achieved effective editing of embryonic cells and immune cells. In 2022, Cell published another article confirming that the viral-like gene developed based on MLV can achieve gene editing of different tissues and organs in mice. The target protein delivered by this viral delivery system has a certain instantaneousness, so the off-target toxicity of gene editing is much less than that of the lentiviral delivery system. However, since MLV is a leukemia-related virus, it has potential safety risks, which has brought certain obstacles to the clinical transformation and application of the viral delivery system. In 2021, Science reported on the new mRNA delivery system constructed by Zhang Feng's laboratory based on the mammalian endogenous reverse transcriptase-like protein PEG10. This viral delivery system successfully verified for the first time the feasibility of endogenous viral-like proteins as viral delivery vectors. Sequence comparison found that PEG10 has a capsid structure and functional protein structure similar to that of a virus, namely the gag domain and the pol domain. However, the efficiency of PEG10 protein in specific binding to mRNA is low, only about 60% of that of lentivirus. Therefore, according to relevant research, a viral delivery system based on PEG10 fusion target protein can be designed as a new strategy for tumor neoantigen delivery.

[0003] Although great progress has been made in the immunotherapy of tumor neoantigens, its therapeutic effect is largely limited by the uptake and presentation efficiency of neoantigens by antigen-presenting cells. Summary of the invention

[0004] The purpose of the present invention is to solve the above-mentioned problem, namely, to improve the uptake and presentation efficiency of neoantigens by antigen-presenting cells, and to provide a CpG-ODN-modified virus-like particle, whose virus-like capsid protein is simultaneously fused with antigens, especially tumor neoantigens, so that the virus-like particle has the function of activating DC cells and synergistically promoting the presentation of tumor neoantigens, activating neoantigen-specific T cells to exert anti-tumor effects.

[0005] The first object of the present invention is to provide a recombinant cell, wherein VSVg is embedded in the cell membrane surface of the recombinant cell, and the recombinant cell also carries two expression vectors, including an expression vector carrying a nucleic acid encoding a fusion protein and an expression vector carrying a nucleic acid encoding a gag domain of a PEG10 protein, wherein the nucleic acid encoding the gag domain of the PEG10 protein contains a nucleotide sequence as shown in SEQ ID NO.1, and the nucleic acid encoding the fusion protein contains a nucleic acid encoding the gag domain of the PEG10 protein and a nucleic acid encoding an antigen, and the free amino terminus of the recombinant cell membrane protein is modified with an adjuvant.

[0006] The recombinant cell is HEK293T.

[0007] The expression vector is a non-pathogenic viral vector.

[0008] The non-pathogenic viral vector is a pcDNA3.1 plasmid.

[0009] The adjuvant for modifying the amino terminus of the recombinant cell membrane protein is CpG-ODN, that is, a 3'Azide-modified thiolated B-type TLR9 agonist.

[0010] The PEG10 protein has a virus-like structure, namely a capsid domain and a protease domain. It is self-assembled after being expressed by transfecting HEK293T cells with a mammalian pcDNA3.1 vector and is secreted outside the cell through cell membrane budding.

[0011] The antigens include tumor antigens, and the tumor antigens include tumor-specific antigens and tumor-associated antigens.

[0012] The tumor neoantigen is derived from the mouse liver cancer cell line Hepa1-6, and the nucleic acid encoding the fusion protein has a nucleotide sequence as shown in SEQ ID NO. 2. Tumor neoantigens also include Mapk3_S284F, Lmf1_F523V, Samd91_K752M, Traf7_C403W, Dtnb_K40T, Lbr_A341P, and Ptpn2_I383T. The tumor neoantigens are fused and expressed at the carboxyl end of the PEG10 capsid domain after being tandemly linked by GSlinker.

[0013] The CpG-ODN modification in the present invention is completed by a two-step chemical reaction. First, the collected recombinant cells are cross-linked with DBCO-C6-NHS Ester through the free amino end of the membrane protein, and then a click reaction is performed through the 3'azide-modified CpG-ODN to obtain CpG-ODN-modified virus-like particles.

[0014] A second object of the present invention is to provide an immunogenic composition consisting of recombinant cells.

[0015] The third object of the present invention is to provide a vaccine, comprising the recombinant cell and an adjuvant.

[0016] A fourth object of the present invention is to provide a method for preparing the recombinant cell, comprising the following steps:

[0017] The recombinant cells without CpG-ODN modification are cultured under conditions suitable for protein expression;

[0018] The culture treatment product is concentrated by centrifugation, then ultrafiltered to remove impurities, and finally co-incubated with azide-modified CpG-ODN. The recombinant cells are obtained after ultrafiltration to remove impurities and recovery.

[0019] Specifically, the recombinant cells without modified CpG-ODN are prepared by the following steps:

[0020] Step (1), inserting the complete PEG10 full-length gene sequence into the pcDNA3.1 empty plasmid to obtain a ligation product 1 pcDNA3.1-PEG10, inserting the fusion protein gene sequence formed by connecting the neoantigen gene sequence (Neoantigen) and the PEG10 gag domain gene sequence into the pcDNA3.1 empty plasmid to obtain a ligation product 2 pcDNA3.1-PEG10 (gag) -Neoantigens, transforming the ligation product 1 and the ligation product 2 into competent cells respectively, picking a single clone and sequencing it 16 hours after plating, amplifying the Escherichia coli containing the correct plasmid, extracting the plasmid, and storing it at -20°C for later use;

[0021] Step (2), transfect the plasmids pcDNA3.1-PEG10, pcDNA3.1-PEG10(gag)-Neoantigens and VSVg prepared in step (1) into HEK293T cells in proportion, collect the cell culture supernatant 48h and 72h after transfection, filter, ultracentrifuge and resuspend to obtain concentrated recombinant cells.

[0022] Specifically, the co-incubation with azide-modified CpG-ODN includes the following steps: taking the concentrated culture treatment product in the above step (2) and cross-linking it with DBCO-C6-NHS Ester (30 μg / μl) at 4°C overnight, centrifuging it at 12000g in an ultrafiltration tube for 10 minutes, removing the waste liquid after centrifugation and re-centrifuging it with PBS, repeating the centrifugation three times, concentrating and recovering the sample, and then incubating it with azide-modified CpG ODN (100 μM) at 37°C in the dark for 2 hours to complete the click reaction, and finally removing impurities by ultrafiltration and recovering the recombinant cells.

[0023] The plasmids pcDNA3.1-PEG10, pcDNA3.1-PEG10(gag)-Neoantigens and VSVg prepared in the step (2) are transfected into HEK293T cells at a mass ratio of 2:14:3; the amount of the recombinant cells in the step (3) is 200 μl concentrated in a 10 cm dish, the amount of DBCO-C6-NHS Ester (30 μg / μl) is 0.5 μl, and the amount of the azide-modified CpG ODN is 40 μl.

[0024] The present invention adopts a similar lentiviral particle preparation strategy to prepare virus-like recombinant cells through the virus-like structure of mammalian endogenous reverse transcriptase-like protein PEG10. First, the recombinant cell carries an expression vector encoding mammalian endogenous protein, and mammalian endogenous protein does not have any toxicity and immunogenicity of conventional viruses; secondly, the capsid structure of PEG10 can fuse different new antigen short peptides, so the recombinant cell has the ability to carry new antigen vaccines, and can express new antigens through expression vectors that encode mammalian endogenous proteins and new antigens to achieve the purpose of preparing anti-tumor therapeutic drugs. Second, the surface of the recombinant cell is a cell membrane structure, which is rich in a variety of membrane proteins. Through the modification of CpG-ODN at the free amino end of the membrane protein, the recombinant cell plays a role as a virus-like particle targeting and binding to DEC-205, enhancing the uptake efficiency of DC cells to the recombinant cell, and also plays a role in activating DC antigen presentation through the adjuvant function of CpG-ODN. CpG-ODN activates antigen-presenting cells mainly relying on intracellular TLR9. The reason why CpG-ODN can be effectively recognized and taken up by antigen-presenting cells is related to the lectin DEC-205 widely expressed on the surface of antigen-presenting cells, which contains rich cysteine ​​and fibronectin domains, and can effectively mediate the endocytosis of cells. Therefore, connecting CpG-ODN to the envelope of PEG10 virus-like particles enhances the efficiency of antigen-presenting cells to take up recombinant cells. When CpG-ODN and neoantigens are combined with recombinant cells and delivered together, they can not only synergistically activate the immune system, but also deliver neoantigens to antigen-presenting cells in a targeted manner, enhance the uptake of neoantigens by antigen-presenting cells, and further improve the efficiency of antigen presentation and subsequent anti-tumor effects. Through the organic integration of the above functions, CpG-ODN-modified PEG10 virus-like particles can activate the anti-tumor immunity of the system by delivering tumor neoantigens, achieving significant anti-tumor effects such as tumor growth regression and prevention of recurrence.

[0025] The present invention also relates to the optimization of the PEG10 and neoantigen fusion expression strategy, using molecular cloning technology to retain the capsid structure of PEG10 and the potential cleavage site (NSQTD*PTEPV) recognized by the PEG10 protease domain to improve the release efficiency of the neoantigen from the recombinant cell membrane protein.

[0026] The present invention also relates to a modification strategy of recombinant cells of CpG-ODN, which achieves targeted modification of recombinant cells and immune enhancement efficacy by efficient click reaction. The CpG-ODN used in the present invention is a 3'Azide-modified thiolated B-type TLR9 agonist.

[0027] The eVLP_CpG@Neovac recombinant cells constructed by the present invention can be administered by any known delivery method: intravenous injection, intra-arterial, intra-tumor, parenteral, intrapulmonary, and regional delivery forms of local administration.

[0028] The beneficial effects of the present invention are mainly reflected in:

[0029] 1. The eVLP_CpG@Neovac recombinant cells constructed by the present invention are derived from organisms. Compared with other lentiviruses or adenoviruses currently used for tumor cell immunotherapy, the recombinant cells have advantages such as better safety and strong specificity. The recombinant cells can not only deliver new antigens, but also this cell membrane strategy retains the biological activity of protein molecules such as VSVg.

[0030] 2. The eVLP_CpG@Neovac recombinant cells constructed in the present invention can improve the antigen presentation performance of DCs, induce neoantigen-specific T cell responses, and activate stronger anti-tumor immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The present invention is further described below in conjunction with specific examples and drawings. The virus-like particles described below are recombinant cells.

[0032] Figure 1a to Figure 1b To prepare the method of virus-like particles eVLP and verify the infection efficiency; Figure 1a eVLPs were collected by high-speed centrifugation after transfection of 293T cells with the three-plasmid system; Figure 1b Flow cytometry was used to analyze the efficiency of 293T cells infected with eVLPs carrying eGFP.

[0033] Figure 2a to Figure 2c To characterize the CpG-ODN modification strategy and modification efficiency of eVLPs; Figure 2a Cross-link DBCO-C6-NHS Ester for eVLPs and click Azide-modified CpG-ODN; Figure 2b Agarose gel electrophoresis was used to analyze the efficiency of CpG-ODN modification of eVLPs under different DBCO-C6-NHSEster concentrations; Figure 2c For flow cytometry analysis Figure 2b The infection efficiency of 293T cells by eVLPs under different modification conditions.

[0034] Figure 3a to Figure 3d Verification of infection and activation of DC2.4 cell line and mouse primary DC cells by eVLP_CpG@Neovac (briefly marked as eVLP_CpG in the figure); Figure 3a Analysis of the efficiency of eVLP_CpG@Neovac infection of DC2.4 cell line and mouse primary DC cells; Figure 3bELISA was used to detect the secretion of IL-6 and IL-12 at different times after DC2.4 cells were stimulated by eVLP_CpG@Neovac; Figure 3c To detect the activation level of TLR9 signaling pathway after eVLP_CpG@Neovac stimulated DC2.4 cells at the protein level; Figure 3d Flow cytometry was used to analyze the activation efficiency of eVLP_CpG@Neovac on primary mouse DC cells.

[0035] Figures 4a to 4c The anti-tumor effect of VLP_CpG@Neovac in the subcutaneous tumor model of mouse liver cancer cell line Hepa1-6; Figure 4a Construction of mouse subcutaneous tumors and treatment plans for Hepa1-6 cells; Figure 4b Statistics of tumor changes over time after different treatment interventions in subcutaneous tumor mouse models; Figure 4c Take photos of the tumors in the model mice after treatment.

[0036] Figure 5a to Figure 5b The anti-tumor effect of VLP_CpG@Neovac combined with αTIM3 in a mouse orthotopic liver cancer model; Figure 5a Establishment and treatment plan for orthotopic liver cancer model in mice; Figure 5b The changes of liver orthotopic tumor in situ in model mice under the intervention of different treatment regimens. DETAILED DESCRIPTION

[0037] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto.

[0038] Example 1: Preparation of virus-like packaging plasmid

[0039] 1. Preparation of pcDNA3.1-PEG10 plasmid

[0040] The mouse PEG10 nucleotide sequence was synthesized with reference to the plasmid pCMV-MmPeg10rc4 (Addgene: #174858), and double restriction sites Bgl II / Xho I were added. After double restriction digestion, it was ligated to the pcDNA3.1 vector containing the same restriction sites using T4 ligase to construct the pcDNA3.1-PEG10 plasmid.

[0041] 2. Preparation of pcDNA3.1-PEG10(gag)-eGFP plasmid

[0042] (1) PCR was performed on the plasmid pcDNA3.1-PEG10 to obtain the gag domain-related sequence of PEG10 and add the double restriction site Bgl II / EcoR I, wherein the reverse primer used in PCR contained the nucleotide sequence of the flexible peptide GS linker (ggaggcggagggagcggaggcggagggagtggaggcggcggatct).

[0043] (2) PCR was performed on the nucleotide sequence expressing eGFP protein, and double restriction sites EcoR I / Xho I were added. After double restriction digestion, the PEG10 gag domain gene sequence was connected to the pcDNA3.1 vector containing restriction sites Bgl II / Xho I by T4 ligase, and the PEG10 (gag)-eGFP gene sequence was inserted into the pcDNA3.1 empty plasmid to construct the pcDNA3.1-PEG10 (gag)-eGFP plasmid, in which the nucleotide sequence expressing the flexible peptide GS linker was introduced between PEG10 (gag) and eGFP. The plasmid structure was confirmed by gene sequencing, and the obtained PEG10 (gag)-eGFP gene sequence is shown in SEQ ID NO.1.

[0044] (3) The above ligation products were transformed into competent cells, E. coli Top10, and single clones were picked and sequenced 16 hours after plating. The plasmids containing the correct plasmids were amplified and stored at -20°C for future use.

[0045] 3. Preparation of pcDNA3.1-PEG10(gag)-Neoantigen plasmid

[0046] (1) The Hepa1-6 neoantigen gene sequence (Neoantigen) and the PEG10 gag domain gene sequence were connected to construct a new nucleotide sequence expressing a fusion protein by connecting the nucleotide sequence expressing a flexible peptide (ggaggcggagggagcggaggcggagggagtggaggcggcggatct), and the construction method was the same as that of the plasmid pcDNA3.1-PEG10 (gag) -eGFP. The obtained PEG10 (gag) -Neoantigen gene sequence is shown in SEQ ID NO.2.

[0047] (2) Specifically, the nucleotide sequence expressing the PEG10 capsid domain was amplified by PCR to add the Bgl II / EcoR I double restriction site, and the nucleotide sequence expressing the Hepa1-6 neoantigen was amplified by PCR to add the EcoR I / Xho I double restriction site. The fragments after restriction digestion were then ligated with the pcDNA3.1 vector with the Bgl II / Xho I double restriction site to construct the pcDNA3.1-PEG10 (gag) -Neoantigens plasmid, and the plasmid structure was determined by gene sequencing.

[0048] (3) The above ligation products were transformed into competent cells, E. coli Top10, and single clones were picked and sequenced 16 hours after plating. The plasmids containing the correct plasmids were amplified and stored at -20°C for future use.

[0049] Example 2: Preparation of virus-like particles carrying new antigens

[0050] HEK293T cells (from ATCC) were used to package PEG10(gag)-eGFP into viral-like form. The process was as follows:

[0051] 1. HEK293T cells were seeded in a 10 cm dish and used for virus-like packaging when the growth density reached about 75%;

[0052] 2. Prepare solution A: 500 μL Opti-MEM TM I medium and 20 μL Lipofectamine 3000 reagent were thoroughly mixed;

[0053] 3. Prepare solution B: 500 μL Opti-MEM TM I medium and pcDNA3.1-PEG10 (gag) -eGFP (14 μg), pcDNA3.1-PEG10 (2 μg), VSVg (VSVg refers to viral membrane protein, which is responsible for converting the DNA of the exogenous gene expression vector into infectious virus particles) (3 μg) and 20 μL P3000 reagent are fully mixed. Among them, VSVg is a common envelope protein expression plasmid for lentiviral particle packaging, which is used to enhance the infection efficiency of lentivirus. Here, the virus-like packaging is also combined with VSVg to assist the infection of virus-like particles; pcDNA3.1-PEG10 is a packaging plasmid including the full-length protein sequence of mouse PEG10, which is conducive to the expression of virus particles;

[0054] 4. Add solution a to solution b and mix well. After incubation for 10 to 20 minutes, add the obtained complex to HEK293T cells and shake well. Incubate in the incubator for 6 hours and replace with fresh culture medium.

[0055] 5. Collect the cell culture supernatant containing virus-like particles 48h and 72h after transfection, centrifuge (2000rpm, 15min), filter the virus solution with a filter, concentrate it by ultracentrifugation (25000rpm, 90min), and obtain virus-like particles eVLP (containing fluorescent protein eGFP protein) after aliquoting and place at -80℃ for standby use. The whole process is as follows: Figure 1a As shown;

[0056] 6. Use the concentrated virus-like particles to infect fresh HEK 293T cells, supplemented with polybrene (5 μg / mL) to enhance the virus-like infection efficiency.

[0057] 7. After 4 hours of the above experiment, flow cytometry was used to verify the infection efficiency of the virus-like substance. The results were as follows: Figure 1b As shown, it was demonstrated that virus-like particles can efficiently infect 293T cells with the assistance of VSVg.

[0058] Similarly, according to the above steps, virus-like particles containing pcDNA3.1-PEG10(gag)-Neoantigen plasmid can be obtained, which are recorded as eVLP@Neovac.

[0059] Example 3: Surface modification of virus-like particles

[0060] 1. Take 200 μl of concentrated virus-like particles in a 10 cm dish and cross-link with 2 μl of DBCO-C6-NHS Ester (30 μg / μl) at 4°C overnight. Here, the plasmid pcDNA3.1-PEG10 (gag) -eGFP in the virus-like packaging system is replaced with pcDNA3.1-PEG10 (gag) -Neoantigen. Specifically, the virus particles containing pcDNA3.1-PEG10 (gag) -Neoantigen, namely eVLP@Neovac, are obtained according to the experimental steps of Example 2;

[0061] 2. Add no more than 500 μl of the sample obtained in the above steps to the inner tube of the pre-cleaned ultrafiltration tube, and centrifuge at 12000g for 10 minutes. After centrifugation, discard the waste liquid, use PBS to fill the inner tube of the ultrafiltration tube to 500 μl and centrifuge again. Repeat the whole step three times, and finally remove the entire ultrafiltration tube from the centrifuge, take out the inner tube and invert it in the collection tube, centrifuge at 1000g for 2 minutes, so that the concentrated sample is transferred from the ultrafiltration inner tube to the collection tube;

[0062] 3. After ultrafiltration and impurity removal in the above step, the concentrated sample was incubated with 10 μl of CpG ODN (100 μM) modified with azide and labeled with FAM fluorescence at 37°C in the dark for 2 hours to complete the click reaction; CpG-ODN (CpG oligodeoxynucleotide) is an artificially synthesized oligodeoxynucleotide (ODN) containing unmethylated cytosine guanine dinucleotide (CpG). In this example, it is a 3'Azide (azide) modified thiolated B-type TLR9 agonist.

[0063] 4. After the click reaction is completed, repeat the previous step to ultrafilter and recycle. The CpG-ODN modified PEG10 virus-like particles are recorded as eVLP_CpG@Neovac. The virus particles contain the gene sequence expressing the Hepa1-6 neoantigen. The whole process is as follows Figure 2a As shown;

[0064] 5. Take 10 μl of the above virus-like particles eVLP_CpG@Neovac after the reaction, mix it in 10x loading buffer, and perform 1% agarose gel electrophoresis. By comparing the free CpG-ODN, that is, not cross-linked with eVLP, the modification efficiency of the virus-like particles can be relatively quantified. The results are as follows: Figure 2b , Due to the poor water solubility of DBCO, high concentration of DBCO is not conducive to modification, and low concentration of DBCO (0.5μl) can achieve a high modification efficiency;

[0065] 6. Also take 10 μl of the above virus-like particles eVLP_CpG@Neovac after the reaction to infect HEK293T cells.

[0066] After 4 hours of the above experiment, the positive rate of cell FAM fluorescence was detected by flow cytometry. The results were as follows: Figure 2c , when the CpG-ODN modification efficiency is high, the infection efficiency of HEK293T reaches 99.8%. In this example, the virus-like particles obtained after virus-like packaging of PEG10(gag)-Neoantigen using HEK293T cells were modified with CpG ODN labeled with FAM fluorescence, and were referred to as eVLP_CpG@Neovac in subsequent experiments.

[0067] Embodiment 4:

[0068] 1. DC2.4 cells (purchased from Fenghui Bio) were inoculated in a 24-well plate 24 hours in advance, and the modified virus-like particles eVLP_CpG@Neovac used in Example 3 were used to infect the DC2.4 cell line. After 4 hours, the FAM fluorescence was detected by flow cytometry. The virus-like particles eVLP@Neovac obtained according to the method of Example 2 were used as the control group, and the concentrated virus-like particles eVLP@Neovac and CpG-ODN in Example 2 were mixed as the control group, recorded as eVLP@Neovac+CpG. The results are shown in Figure 1. Figure 3a As shown, nearly 100% of FAM-positive cells can be observed in cells infected by modified virus-like particles eVLP_CpG@Neovac, while CpG-ODN will not produce strong fluorescent signals in infected cells if it is not modified to eVLP@Neovac. If only virus-like particles eVLP@Neovac infect DC2.4 cell line, no FAM-positive cells can be observed.

[0069] 2. The culture supernatant and cells of DC2.4 cells at 6h and 24h after infection in the above steps were collected respectively. The supernatant was used to detect cytokines IL-6 and IL-12 (p70) by ELISA, and the protein changes of phosphorylated P65 and Myd88 in DC2.4 cells were detected by WB. The virus-like particles eVLP@Neovac and CpG-ODN obtained according to the method of Example 2 were used as control groups, and the blank group was used as a negative control. Figure 3b and 3c As shown in the figure, eVLP_CpG@Neovac can effectively activate DC2.4 cells through the antigens and CpG it carries, which is mainly manifested by a significant increase in the secretion of cytokines IL-6 and IL-12. Figure 3c In the , phosphorylation of P65 in the downstream of TLR9 pathway increased (P65 is total protein, p-P65 is phosphorylated protein), and Myd88 expression was enhanced;

[0070] 3. Mouse primary DC cells were obtained from C57BL / 6 mice and inoculated into 24-well plates 24 hours in advance. The modified virus-like particles eVLP_CpG@Neovac used in Example 3 were used to infect mouse primary DC cells. FAM fluorescence was detected by flow cytometry 4 hours later. The virus-like particles eVLP@Neovac obtained according to the method of Example 2 were used as the control group. The results are shown in Figure 3a and 3d As shown, the positive rate of cells infected by the modified virus-like particles was increased by 20% compared with the unmodified group (eVLP_CpG@Neovac group relative to eVLP@Neovac group), and the proportion of mature primary DC cells stimulated by the virus-like particles eVLP_CpG@Neovac was also significantly increased.

[0071] Example 5: Construction of HCC mouse subcutaneous tumor model

[0072] 1. Digest and obtain mouse liver cancer cell Hepa1-6 cells in the logarithmic growth phase, count and resuspend in PBS to 1.5×10 7 / ml cell suspension. A total of 30 C57BL / 6 mice with the same growth condition and good condition were selected, the hair under the armpits of the C57BL / 6 mice was removed, and the Hepa1-6 cell suspension was extracted with a 1ml syringe. 200ul was injected subcutaneously under the armpit of each mouse. After the needle tip was pulled out, the puncture point was quickly pressed with a cotton swab for 2 minutes.

[0073] 2. The above 30 mice were randomly divided into 5 groups, with 6 mice in each group starting treatment (e.g. Figure 4a After inoculation, the subcutaneous tumor was about 60 mm. 3 The time was recorded as day 0, and virus-like particles were injected on day 0, day 4, and day 8 for treatment. Group 1 to Group 5 were injected with PBS, CpG-ODN, eVLP@Neovac, eVLP@Neovac+CpG, and eVLP_CpG@Neovac, respectively.

[0074] Among them, CpG-ODN was 10μl / piece, eVLP@Neovac was virus-like particles concentrated in 1 / 4 10cm culture dish / piece, eVLP@Neovac+CpG-ODN was a mixture of 10μl CpG-ODN and 1 / 4 10cm culture dish concentrated virus-like particles / piece, and eVLP_CpG@Neovac was CpG-ODN-modified PEG10 virus-like particles concentrated in 1 / 4 10cm culture dish / piece. The solvent of each treatment group was filled up to 200μl with PBS.

[0075] 3. Measure the tumor size with a vernier caliper every 2 days. The tumor volume (V) is calculated as follows: V = AB 2 / 2. A is the long diameter of the tumor, and B is the short diameter of the tumor.

[0076] Tumor growth curve and anatomical results Figure 4b and 4c As shown, it shows that eVLP_CpG@Neovac has obvious anti-tumor effect.

[0077] Example 6: Construction of a mouse liver cancer orthotopic tumor model

[0078] 1. Digest and obtain Hepa1-6 cells in the logarithmic growth phase, count and resuspend in PBS to 5×10 6 / ml of cell suspension, select 20 C57BL / 6 mice with the same growth condition and good condition, and inject 100ul into the mouse liver.

[0079] 2. Ten days later, according to the tumor growth, the 20 mice with uniform tumor size were randomly divided into 4 groups, with 5 mice in each group, and counted as day 0 ( Figure 5a ). The mice were injected on day 0, day 4, and day 8, respectively. Groups 1 to 4 were injected with PBS, αTIM3 (100ug / mouse), eVLP_CpG@Neovac (the dosage was the same as that of the subcutaneous tumor model), and eVLP_CpG@Neovac+αTIM3.

[0080] 3. The tumor growth of mice was recorded starting from the 14th day, and the records were kept for three consecutive times, with an interval of 7 days between each recording.

[0081] like Figure 5b As shown, it shows that eVLP_CpG@Neovac combined with αTIM3 has a good anti-tumor effect.

Claims

1. A recombinant cell, characterized in that VSVg is embedded in the cell membrane surface of the recombinant cell. The recombinant cell also carries two expression vectors, including an expression vector carrying a nucleic acid encoding a fusion protein and an expression vector carrying a nucleic acid encoding a gag domain of a PEG10 protein. The nucleic acid encoding the gag domain of the PEG10 protein contains a nucleotide sequence as shown in SEQ ID NO.1, and the nucleic acid encoding the fusion protein contains a nucleic acid encoding a gag domain of the PEG10 protein and a nucleic acid encoding an antigen. The free amino terminus of the recombinant cell membrane protein is modified with an adjuvant.

2. The recombinant cell according to claim 1, characterized in that The recombinant cell is HEK293T.

3. The recombinant cell according to claim 2, characterized in that The expression vector is a non-pathogenic viral vector.

4. The recombinant cell according to claim 3, characterized in that The non-pathogenic viral vector is a pcDNA3.1 plasmid.

5. The recombinant cell according to claim 4, characterized in that The adjuvant for modifying the amino terminus of the recombinant cell membrane protein is CpG-ODN, that is, a 3'Azide-modified thiolated B-type TLR9 agonist.

6. The recombinant cell according to claim 4, characterized in that The antigens include tumor antigens, and the tumor antigens include tumor-specific antigens and tumor-associated antigens.

7. The recombinant cell according to claim 4, characterized in that The tumor-specific antigen is derived from the mouse liver cancer cell line Hepa1-6, and the nucleic acid encoding the fusion protein has a nucleotide sequence as shown in SEQ ID NO.

2.

8. The recombinant cell according to any one of claims 1 to 7, which is an immunogenic composition.

9. A vaccine comprising the recombinant cell according to any one of claims 1 to 7 and an adjuvant.

10. A method for preparing the recombinant cell according to any one of claims 5 to 7, comprising the following steps: Cultivating the recombinant cell according to any one of claims 1 to 4 under conditions suitable for protein expression; The culture treatment product is concentrated by centrifugation, then ultrafiltered to remove impurities, and finally co-incubated with azide-modified CpG-ODN. The recombinant cells are obtained after ultrafiltration and recovery.

Images