Novel adeno-associated virus variant library for gene and cell therapy as well as construction and application of novel adeno-associated virus variant library

Abstract

The invention discloses a novel adeno-associated virus variant library for gene and cell therapy as well as construction and application of the novel adeno-associated virus variant library, and belongs to the field of biological medicines. Through high-throughput sequencing and gene editing, an AAV variant library containing a large number of mutants is constructed, the construction efficiency is improved, the diversity of the mutants is ensured, the cap gene of AAV is modified by the variant library through a site-directed mutagenesis technology, the transduction efficiency of human immune cells is improved, the limitation of an existing AAV modification method is overcome, and the AAV mutant library has good application prospects. The constructed novel AAV variant library has higher packaging efficiency, lower cytotoxicity and better adaptability, and provides more choices for development of gene therapy drugs; the screened novel AAV6 variant P482L has remarkable advantages in the aspects of transduction efficiency, safety and the like, and becomes a potential candidate vector in the field of gene therapy; the invention not only accelerates the progress of new drug research and development, but also provides a new tool and method for treating hereditary diseases, tumors and the like, and promotes the development of the field of gene therapy.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a novel adeno-associated virus variant library for gene and cell therapy and its construction and application. Background Art

[0002] Adeno-associated virus (AAV) is a small non-enveloped virus with a diameter of about 26 nanometers. Its virus particles are composed of icosahedral capsid proteins and a single-stranded DNA genome of about 4.7 kb. As a key viral vector in gene therapy, AAV has made remarkable achievements in the field of gene therapy due to its high safety and low immunogenicity. Among them, 7 AAV gene therapies have been approved for marketing. In addition, there are reports that artificial intelligence is used to guide the design of new AAV capsids. It is found that the available mutants produced are significantly better than random mutagenesis, which provides a powerful design method for the engineering of AAV capsid proteins. Among the currently discovered serotypes, including 13 natural ones and some variants, AAV6 shows excellent advantages in transducing human immune cells in vitro, especially when combined with gene editing technology (such as CRISPR), which provides new possibilities for genetic engineering of difficult-to-target cell types (such as primary T cells), such as producing primary T cells into chimeric antigen receptor T cells (CAR-T cells) with immunotherapy effects. Although AAV6 has advantages in transducing human immune cells, its transduction efficiency still cannot meet the needs of practical applications, limiting the widespread application of AAV6 in gene therapy. Due to the limitation of transduction efficiency, it still relies on the use of high virus infection multiplicity (MOI, 1×10 6 ) for gene delivery not only increases production costs, but also may lead to potential risks of toxic side effects; the existing AAV6-based mutant library is relatively limited in diversity, and lacks a large-scale viral mutant library targeting human immune cells, which limits the full exploration of the potential of AAV6 capsid protein modification.

[0003] In order to solve the above problems, researchers began to explore methods of engineering AAV capsid proteins to improve transduction efficiency and expand application scenarios. At present, the research focus of engineered AAV is on enhancing the targeting of vectors to different cells and tissues, and reducing the potential for neutralizing antibodies to cause vector inactivation. For example, new AAV variants obtained by methods such as fragment recombination and single-point mutation, such as AAV12 / 6 chimeras and AAV6-S663V / T492V variants, have improved transduction efficiency to a certain extent. However, these modification methods have not significantly improved the transduction efficiency of AAV6 to human immune cells. Therefore, more in-depth research and exploration are needed. There are also reports on large-scale screening for AAV6. However, the target cells of this work are mouse T cells, and the diversity of the variant library is limited. There is a lack of large-scale viral mutant libraries based on AAV6 for human immune cells. The application potential of AAV6 needs to be further explored.

[0004] Although there are existing methods for modifying AAV6, such as single-point mutation and fragment recombination of Cap protein, these modifications have not significantly improved its transduction efficiency for human immune cells and still cannot meet the needs of practical applications. Secondly, due to the limitation of transduction efficiency, gene delivery currently still relies on the use of high MOI (multiplicity of viral infection), which not only leads to an increase in production costs, but also increases the risk of potential toxic side effects. In addition, the diversity of existing mutant libraries is relatively limited, and there is a lack of large-scale viral mutant libraries based on AAV for human immune cells, which fails to fully tap the full potential of AAV capsid protein modification. Summary of the invention

[0005] In view of the fact that the existing AAV modification methods cannot significantly improve the transduction efficiency of human immune cells, the high virus infection multiplicity is required for gene delivery, which increases the risk of toxic side effects, the existing AAV mutant library is not diverse enough, and there is a lack of large-scale virus mutant libraries specifically targeting human immune cells and based on AAV. The present invention aims to provide a method for constructing a novel adeno-associated virus variant library for gene and cell therapy.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The present invention provides a method for constructing a novel adeno-associated virus variant library for gene and cell therapy, comprising: S1, based on the amino acid sequence of the cap gene of the natural serotype adeno-associated virus, identify the non-conserved region of the adeno-associated virus, perform single-point saturation mutation based on the non-conserved region of the adeno-associated virus, and generate an adeno-associated virus single-point saturation mutant library; S2, based on the adeno-associated virus single-point saturation mutant virus library, single-point mutations were introduced by high-throughput oligonucleotide DNA sequence synthesis to construct an adeno-associated virus mutant plasmid library; S3, constructing an adeno-associated virus mutant virus library based on the adeno-associated virus mutant plasmid library; S4, based on the adeno-associated virus mutant virus library, screen, extract the genome, sequence and identify, and obtain a new adeno-associated virus variant library for gene and cell therapy.

[0007] The natural serotype adeno-associated virus is any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 and AAV13.

[0008] Furthermore, the natural serotype adeno-associated virus is AAV6.

[0009] In S1, the amino acid sequences of cap genes were aligned using the Clustal Omega tool.

[0010] S2 specifically includes: S21, synthesizing an oligonucleotide DNA sequence containing a single point mutation based on the cap gene sequence of the adeno-associated virus using high-throughput oligonucleotide DNA sequencing; S22, design an 8 bp barcode sequence and add an 8 bp barcode to each oligonucleotide DNA sequence containing a single point mutation; S23, using two rounds of GoldenGate Assembly strategy, oligonucleotides with single-point mutations and Barcodes were inserted into the corresponding positions in the cap6 gene; S24, through electroporation, plasmid counting, and shaking, plasmids were extracted to construct an adeno-associated virus mutant plasmid library.

[0011] Furthermore, the 8 bp Barcode sequence was designed using python or matlab software.

[0012] S3 specifically includes: obtaining auxiliary plasmids, packaging plasmids and target plasmids; transfecting the plasmids into 293LX cells using the calcium phosphate transfection method and packaging the viruses; collecting and purifying the viruses and performing titer detection to obtain a mutant virus library.

[0013] S4 includes: inoculating the mutant virus library of adeno-associated virus into immune cells, and screening the cells that have successfully transduced the virus with drugs; extracting the genome for sequencing analysis after culture, identifying, and obtaining a new adeno-associated virus variant library for gene and cell therapy.

[0014] The drug screens cells that have been successfully transduced with the virus, using puromycin for screening.

[0015] The novel adeno-associated virus variant library for gene and cell therapy obtained by the above construction method.

[0016] Application of the above-mentioned novel adeno-associated virus variant library in the preparation of gene and cell therapy drugs.

[0017] The application of the above-mentioned novel adeno-associated virus variant library in screening novel adeno-associated virus capsid protein variants with high transduction efficiency and safety.

[0018] A novel adeno-associated virus capsid protein variant is obtained by screening the novel adeno-associated virus variant library for gene and cell therapy.

[0019] Furthermore, the screening includes the steps of constructing a new viral vector in vitro and testing it in primary human T cells.

[0020] Furthermore, the novel adeno-associated virus capsid protein variant is a novel AAV6 variant P482L.

[0021] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a method for constructing a novel adeno-associated virus variant library for gene and cell therapy. The present invention constructs a novel AAV variant library containing a large number of mutants by means of high-throughput sequencing, gene editing and other technical means. The method not only improves the construction efficiency, but also ensures the diversity and randomness of the mutants, providing rich resources for subsequent screening and application. The construction method transforms the cap gene of AAV6 by site-directed mutagenesis technology, in order to obtain a novel adeno-associated virus variant virus library with specific biological characteristics. By identifying non-conserved regions and performing single-point saturation mutagenesis, the diversity of AAV mutants can be significantly increased, and it is expected that AAV variants with higher transduction efficiency for human immune cells can be screened out, solving the problem that the existing AAV transformation method cannot significantly improve the transduction efficiency for human immune cells. In this way, the targeting requirements for different tissue cells in gene and cell therapy are met, and the tissue tropism limitation of natural serotype AAV is overcome. By modifying the cap gene, the risk of viral vectors being recognized and cleared by the human immune system can be reduced, thereby improving the safety and stability of adeno-associated virus variants, which is of great significance for the long-term effect and safety of gene and cell therapy. The construction method of a novel adeno-associated virus variant library provides more options for gene and cell therapy, which can be applied to the treatment of a variety of genetic diseases and tumors. It can also be used in combination with other gene editing technologies (such as CRISPR-Cas system) to further improve the accuracy and effectiveness of gene therapy. It shortens the development cycle of novel adeno-associated virus vectors, reduces R&D costs, and helps promote the development of gene therapy drugs. Through high-throughput screening and sequencing identification technology, a large number of novel viral vectors with potential clinical application value can be quickly obtained, providing strong support for the development of gene therapy drugs.

[0022] The novel adeno-associated virus variant library obtained by the present invention can well maintain the diversity of mutants. The mutants in the variant library have higher packaging efficiency, lower cytotoxicity and better adaptability, and are the focus of further research and optimization. By deeply analyzing the characteristics and mechanisms of these advantageous mutants, the AAV vector design can be further optimized to improve the efficiency and safety of gene therapy. It has significant technical effects in solving transduction efficiency problems, increasing the diversity of mutant libraries, constructing human immune cells, and promoting the development of gene therapy. It can not only improve the tissue tropism and safety of viral vectors, broaden the scope of clinical application, but also promote the research and development of gene therapy drugs. With the continuous development of genetic engineering technology, more efficient, safe and specific gene therapy vectors can be developed by continuously screening and optimizing advantageous mutants, thereby promoting the development of the field of gene therapy.

[0023] The application provided by the present invention, the AAV variant library can be used for the research and development of gene and cell therapy drugs, which can accelerate the process of new drug research and development, and provide a new tool for the treatment of genetic diseases, tumors, etc. By screening mutants with specific properties, more efficient and safe gene therapy vectors can be developed, which is of great significance for the treatment of diseases requiring efficient gene expression; by screening mutants with low immunogenicity and low cytotoxicity, safer gene therapy vectors can be developed to reduce adverse reactions and complications during the treatment process; the application of the new AAV variant library is not limited to the traditional gene therapy field, but can also be expanded to cell therapy, gene editing and other fields, providing new ideas and methods for the treatment of more diseases.

[0024] The present invention utilizes the novel adeno-associated virus capsid protein variant screened by the AAV variant library, the novel AAV6 variant P482L, which exhibits remarkable technical effects in terms of transduction efficiency, safety, gene expression and clinical application, becoming a potential candidate vector in the field of gene therapy and providing new options for the treatment of more diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Comparison and analysis of the amino acid sequences of the VP proteins of 13 natural serotypes of AAV of the present invention; Figure 2 Design of a single-site saturation mutant library of AAV6 of the present invention; Figure 3 A molecular cloning and construction scheme for the AAV6 mutant plasmid library of the present invention; Figure 4 The present invention screens the AAV6 mutant plasmid library, virus library and transduced target cells, extracts the Barcode sequence in the cell genomic DNA, amplifies it by PCR, and then performs high-throughput deep sequencing detection and analysis; Figure 5 The present invention compares and analyses the high-throughput deep sequencing results of the AAV6 mutant plasmid library and the virus library; Figure 6 The present invention compares and analyses the high-throughput deep sequencing test results of the AAV6 mutant virus library and the Jurkat cell genomic DNA samples, wherein A is the result analysis of Jurkat cells transduced with a high MOI of the virus library, and B is the result analysis of Jurkat cells transduced with a low MOI of the virus library; Figure 7 The efficiency of the mutants is evaluated by the enrichment index ES and the proportion rank fcellrank of each mutant in the Jurkat cell sample of the present invention, wherein A is the result analysis of Jurkat cells transduced with a high MOI of the virus library, and B is the result analysis of Jurkat cells transduced with a low MOI of the virus library; Figure 8To screen the mutant AAV6-P482L and AAV6 wild type WT and AAV6.2FF, GFP-positive cells were counted by flow cytometry 48 hours after transduction of Jurkat cells. A is the flow cytometry result of Jurkat cells transduced with MOI of 10,000, B is the flow cytometry result of Jurkat cells transduced with MOI of 25,000, and C is the statistical results of GFP-positive cell ratio and mean fluorescence intensity under two conditions. Fig. 9 The human primary T cells were transduced with the virus of the present invention for 48 hours, and the proportion of GFP-positive cells was detected by flow cytometry, wherein A was a negative control group, B was AAV6-WT, C was AAV6.2FF, and D was AAV6-P482L. DETAILED DESCRIPTION

[0026] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0027] The present invention is further described in detail below in conjunction with the accompanying drawings: Example 1 The embodiments provide methods for designing and constructing novel adeno-associated virus variant libraries for gene and cell therapy.

[0028] 1. Design of a large-scale AAV6 mutant virus library The amino acid sequence comparison analysis of the VP proteins of 13 natural serotypes of AAV and the design of the single-site saturation mutant library of AAV6 are shown in Table 1.

[0029]

[0030] (1) Multiple sequence alignment analysis See attached Figure 1 The amino acid sequences of the cap genes of 13 natural serotypes were compared using the multiple sequence alignment tool Clustal Omega. The amino acid sequences of the cap genes of the 13 serotypes are shown in SEQ ID NO.1 to SEQ ID NO.13, respectively. The sequence of cap6 was analyzed to identify the conservative and non-conservative regions in the AAV6 (cap6) sequence.

[0031] (2) Design of AAV6 single-site saturation mutant library See attached Figure 2 In the cap gene of AAV6, a non-conserved region was selected as the target region for mutation; single-point saturation mutation was performed on the selected non-conserved region, that is, all possible amino acid substitutions were introduced at each amino acid position in the region to generate an AAV6 mutant library containing a large number of different single-point mutations, with a library capacity of 5000 to 6000 mutants.

[0032] 2. Construction of AAV6 mutant plasmid library See attached Figure 3 , combining high-throughput oligonucleotide DNA sequence synthesis and GoldenGate Assembly's molecular cloning design strategy: (1) High-throughput oligonucleotide DNA sequence synthesis Based on the cap6 gene sequence of AAV6, an oligonucleotide DNA sequence with a single point mutation was designed, and an 8bp barcode was added to each synthesized oligonucleotide DNA sequence for subsequent deep sequencing to identify mutants; Twist Bioscience was commissioned to complete the synthesis of high-throughput oligonucleotide DNA sequences.

[0033] The oligonucleotide DNA fragments were amplified by PCR and recovered using the column recovery kit QIAquick PCR Purification Kit (QIAGEN, 28104). The recovered products were subjected to high-throughput deep sequencing to ensure that their sequences were correct.

[0034] (2) GoldenGate Assembly molecular cloning design strategy The first round of GoldenGate Assembly The empty vector and the synthesized oligonucleotide DNA sequence were digested with PaqCI restriction endonuclease, and the oligonucleotide DNA sequence after digestion was connected to the empty vector using T4 DNA ligase to obtain an intermediate vector with a single point mutation and a corresponding barcode; the ligation product was transformed into Escherichia coli, the transformed Escherichia coli was screened, and the positive clones were selected for sequencing verification.

[0035] The second round of GoldenGate Assembly The intermediate vector obtained in the first round and the downstream fragment of the cap6 gene deletion were digested with SapI restriction endonuclease, and the digested downstream fragment was connected back to the intermediate vector using T4 DNA ligase to form a complete cap6 gene. The first-round ligation product that was not connected to the second-round fragment was digested with HapI restriction endonuclease, and the second-round ligation product was recovered by column using the column recovery kit QIAquick PCR Purification Kit (QIAGEN, 28104) to obtain the designed plasmid library.

[0036] (3) Introduction and amplification of plasmid library The recovered plasmid library was introduced into electro-competent Escherichia coli by electroporation. The transformed Escherichia coli was revived in a 37°C shaker for 1 h and spread on agar plates containing appropriate selection markers after gradient dilution. The colonies on the plates were counted to estimate the coverage of the plasmid library. The rest was expanded and the plasmid DNA was extracted from the bacteria using the plasmid extraction kit QIAGEN Plasmid Maxi Kit (QIAGEN, 12163) to obtain the AAV6 mutant plasmid library that can be used for virus packaging.

[0037] (4) Identification of plasmid library The constructed mutant plasmid library was amplified by PCR, and the column recovery kit QIAquick PCR Purification Kit (QIAGEN, 28104) was used for column recovery. The recovered products were tested by high-throughput deep sequencing. The proportion of each mutant sequence in the plasmid library in all sequences was counted, and the coverage and uniformity of the mutant sequences were analyzed. Primers were designed upstream and downstream of the Barcode fragment: PCR-Barcode-F: CAGCAAACGCTGGAATCC (as shown in SEQ ID NO. 14); PCR-Barcode-R: GGCATTAAAGCAGCGTATCC (as shown in SEQ ID NO. 15).

[0038] 3. Construction of AAV6 mutant virus library (1) Plasmid preparation The high-purity, endotoxin-free extraction kit QIAprep Spin Miniprep Kit (QIAGEN, 27104) was used to obtain three plasmids: helper plasmid, modified packaging plasmid and target plasmid; the helper plasmid provides the enzymes and factors required for viral replication, the modified packaging plasmid carries the gene rep required for viral packaging, and removes the cap gene, while the target plasmid contains the target gene for introduction into the host cell and the cap gene required for viral packaging, that is, the AAV6 mutant plasmid library constructed above.

[0039] (2) Cell preparation 293LX was selected as adherent cells; The culture medium used was DMEM medium containing 10% fetal bovine serum and 1% Penicillin-Streptomycin antibiotics; Culture conditions: cells were cultured in a 37°C, 5% CO2 incubator to ensure normal cell growth and division.

[0040] Cell seeding: 5×10 cells were seeded in a 10 cm cell culture dish one day in advance. 6 293LX cells were cultured to allow the cells to reach a confluence of 70% to 80% on the second day, providing the best cell state for subsequent virus packaging.

[0041] (3) Virus packaging Calcium phosphate transfection was used to transfect 293LX cells with 10 μg each of the auxiliary plasmid, packaging plasmid, and target plasmid. After 6 to 8 hours, the culture medium was replaced with fresh culture medium to remove residual transfection reagent and cell debris and provide a better growth environment for the cells. The cells were continued to be cultured in a 37°C incubator until viral particles were formed.

[0042] (4) Virus collection The virus was collected 72 hours after transfection, at which time the yield of virus particles was higher; since AAV virus particles exist in both packaging cells and culture supernatant, both cells and culture supernatant can be collected and processed separately to obtain a higher yield.

[0043] (5) Virus treatment Treatment of supernatant: Add 40% (w / v) PEG8000 and 3M NaCl to the supernatant to a final concentration of 8% and 0.5M, and concentrate overnight at 4°C. Centrifuge at 12,000 g for 30 min at 4°C; remove the supernatant and resuspend the precipitate with PBS to obtain concentrated virus particles.

[0044] Cell treatment: Cells were lysed by repeated freezing and thawing. The cells were resuspended in cell lysis buffer and repeatedly transferred between liquid nitrogen and a 37°C water bath. The cells were frozen and thawed four times. Each solidification and thawing lasted for 10 minutes. The cells were slightly shaken after each thawing. The cells were centrifuged at 4°C, 12,000 g for 30 minutes to remove cell debris and obtain a cell lysate containing virus particles.

[0045] (6) Virus purification After the supernatant and cell lysate are combined, an equal volume of chloroform is added to remove protein impurities. After centrifugation, the supernatant is aspirated and can be concentrated again with PEG8000 and NaCl, followed by the addition of Benzonase universal nuclease to digest and remove residual nucleic acids, and incubated at 37°C for 30 min; an equal volume of chloroform is added again, and after centrifugation, the supernatant is carefully aspirated to obtain the preliminarily purified AAV virus.

[0046] (7) Virus titer detection The obtained virus was treated with DNase and proteinase K, and the virus titer was determined by quantitative PCR. The primers were designed in the SFFV promoter region. qPCR-SFFV-F: atcagatgtttccaggctcccc (as shown in SEQ ID NO.16); qPCR-SFFV-R: actcagtctgtcggaggact (as shown in SEQ ID NO.17).

[0047] (8) Identification of virus library See attached Figure 4 The obtained virus was treated with DNase and proteinase K, and then PCR amplified. The column recovery kit QIAquick PCR Purification Kit (QIAGEN, 28104) was used for column recovery. The recovered products were subjected to high-throughput deep sequencing detection. The proportion of each mutant sequence in the virus library in all sequences was counted, and the coverage and uniformity of the mutant sequence were analyzed. The primer design was the same as described in the identification of the plasmid library above.

[0048] The high-throughput deep sequencing results of the AAV6 mutant plasmid library and the virus library were compared and analyzed. The results are shown in the attached Figure 5 . Figure 5From the data, we can see that about 20 million sequences were detected in the two samples respectively, of which 97% of the sequencing results contained the designed Barcode sequence. Plasmid library sequencing contains a total of 4417 Barcode sequences, and virus library sequencing contains a total of 4238 Barcode sequences, indicating that most mutants can be assembled into AAV virus particles normally. The distribution frequencies of these mutants are counted and plotted together. Each point represents the distribution of a mutant in the plasmid library and the virus library respectively. The frequency distribution levels of most mutants in the plasmid library and the virus library are similar (diagonal area), and a small number of mutants show certain advantages in the virus packaging level (upper left corner area).

[0049] Example 2 In this example, based on Example 1, a rapid screening of the AAV6 mutant library for in vitro transduction of target cells was performed to obtain viral mutants with enhanced transduction of specific target cells.

[0050] 1. Evaluating the transduction efficiency of different AAV6 mutant virus libraries Jurkat cells in the logarithmic growth phase were used to transduce Jurkat cells in vitro using two MOI gradients (50,000 and 100,000). In order to reduce the toxicity of the virus solution to the cells, the medium can be replaced 8 to 12 hours after transduction. Three days after viral infection, fresh culture medium containing puromycin was added for screening. After the addition of the drug, the cells were cultured for 3 to 7 days, and then the Jurkat cells were collected, genomic DNA was extracted, PCR amplification was performed, and column recovery was performed using the column recovery kit QIAquick PCR Purification Kit (QIAGEN, 28104). The recovered products were subjected to high-throughput deep sequencing (Illumina sequencing), and the proportion of each mutant sequence in all sequences in the cell was counted, and the coverage and uniformity of the mutant sequences were analyzed. The primer design was the same as described in the identification of the plasmid library above.

[0051] The high-throughput deep sequencing results of the AAV6 mutant virus library and the Jurkat cell genome were compared and analyzed. The results are shown in the attached Figure 6. More than 30 to 40 million sequences were measured in the two enriched cell samples, of which about 17 million contained Barcodes, and the Barcode coverage was about 46% and 40%. This proportion was significantly lower than that of the plasmid library and the virus library, because the complexity of the genomic sample template sequence of the enriched cells was higher than that of the plasmid library and the virus library. Although the proportion of Barcode sequences decreased in number, the difference in species richness was small compared with the virus library. 3786 and 3850 Barcode sequences were measured in the two groups of samples, respectively. Similarly, the distribution frequency of each mutant in the cell sample and the virus library was counted and plotted together. Each point represents the distribution of a mutant in the cell sample and the virus library, respectively. The frequency distribution level of most mutants in the two is similar (diagonal area), and a small number of mutants are distributed slightly away from the diagonal.

[0052] The transduction efficiency of each mutant in the cell sample is evaluated by calculating the two scoring parameters, Enrichment Score ES=log10(fcell / fv) and proportion ranking fcellrank. Among them, fcell represents the proportion frequency of each mutant in the cell sample among all mutants, and fv represents the proportion frequency of each mutant in the virus library among all mutants. The enrichment index ES represents the distribution level of each mutant in the cell compared with the virus library. The larger the ES, the more advantageous the distribution level of the mutant in the cell is compared with the virus library, indicating that its transduction efficiency to the cell is stronger. Considering that the number of some mutants in the sequencing sample is very small, it is easy to cause errors. When fcell and fv are very small, ES may also be relatively large, but the advantage of the mutant is not obvious. Therefore, the proportion ranking fcell rank of each mutant in the cell sample is further introduced to evaluate the efficiency of the mutant to filter out possible errors. The proportion ranking fcell rank of each mutant in the cell sample is used to evaluate the efficiency of the mutant. The enrichment index was sorted from large to small, and the proportion order was sorted from small to large, and mutants with both rankings at the top were selected for subsequent functional verification. Figure 7 .

[0053] By the attached Figure 7The data shows that in two Jurkat cell samples (recorded as J1 and J2), the enrichment index and proportion of the mutant P482L numbered lib5-P7L are both in the top ten. The pie chart shows the proportion of the mutant P482L in the top ten mutants with the largest enrichment index. At the same time, the barcode sequence related to the mutant P482L is provided. The barcode sequence ensures that different mutants can be accurately distinguished during the sequencing process and the unique identifier of the mutant can be identified. The above data show that a new mutant P482L with a high transduction efficiency for Jurkat cells was screened out, and the amino acid sequence is: * (as shown in SEQ ID NO.18), “*” represents the end of the protein sequence.

[0054] The barcode sequences of the mutants with the top ten enrichment indices are as follows:

[0055] 2. Testing and screening of novel AAV6 mutants (1) Construction of novel viral vectors The mutants obtained by the screening described above were used to construct a separate new viral vector, and the mutant sequences were cloned into the conventional AAV6 packaging plasmid. The target plasmid contained the GFP reporter gene and was co-transfected with the auxiliary plasmid into 293LX cells. The titer of the mutant AAV virus obtained was tested.

[0056] (2) Transduction of Jurkat cells for verification Three AAV viruses with GFP reporter gene were prepared using three packaging plasmids: Cap6-P482L, natural Cap6, and the previously reported Cap6 triple mutant 6.2FF (F129L-Y445F-Y731F) (A Novel Triple-Mutant AAV6 Capsid Induces Rapid and Potent Transgene Expression in the Muscle and Respiratory Tract of Mice [J]. Mol Ther Methods Clin Dev, 2018, 9: 323-9). Jurkat cells were transduced at high and low MOI (10000 and 25000), and the proportion of GFP-positive cells and the average fluorescence intensity were counted by flow cytometry. The results are shown in the attached figure. Figure 8 .

[0057] By the attached Figure 8The data show that at the same MOI transduction level, the transduction efficiency of AAV6-P482L on Jurkat is significantly higher than that of AAV6 (low MOI-10K: 50% versus 11%; high MOI-25K: 80% versus 55%), and is statistically equivalent to the triple mutant AAV6.2FF (low MOI-10K: 50% versus 35%; high MOI-25K: 80% versus 74%). From the statistical results of flow cytometry, when the MOI of the virus is increased, both AAV6 and AAV6.2FF show an increase in both the proportion of GFP-positive cells and the average fluorescence intensity of GFP-positive cells, showing an obvious tailing phenomenon in the flow cytometric peak graph. AAV6-P482L shows a significant increase in the proportion of GFP-positive cells, but the average fluorescence intensity of GFP-positive cells does not change much, and the distribution of the flow cytometric peak graph is more concentrated, indicating that the expression level difference of transduced positive cells is smaller, which is helpful to prepare a cell population with lower heterogeneity in exogenous gene expression.

[0058] (3) Transduced human primary T cell test 24 hours after human peripheral blood mononuclear cells (PBMCs) were revived, Dynabeads™ Human T-Activator CD3 / CD28 immunomagnetic beads (ThermoFisher, 11132D) were used to activate T cells. 48 hours after activation, three AAV viruses were added respectively. 48 hours after viral transduction, cells were collected and flow cytometry was used to detect transduction efficiency. The results are shown in the attached Fig. 9 .

[0059] By the attached Fig. 9 The data show that at the same MOI, P482L is better than AAV6 and AAV6.2FF. Similar to the results of Jurkat transduction, the average fluorescence intensity of GFP-positive cells transduced with P482L is similar, indicating that the cell heterogeneity of GFP expression is lower.

[0060] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. A method for constructing a novel adeno-associated virus variant library for gene and cell therapy, characterized in that: include: S1, based on the amino acid sequence of the cap gene of the natural serotype adeno-associated virus, identify the non-conserved region of the adeno-associated virus, perform single-point saturation mutation based on the non-conserved region of the adeno-associated virus, and generate an adeno-associated virus single-point saturation mutant library; S2, based on the adeno-associated virus single-point saturation mutant virus library, single-point mutations were introduced by high-throughput oligonucleotide DNA sequence synthesis to construct an adeno-associated virus mutant plasmid library; S3, constructing an adeno-associated virus mutant virus library based on the adeno-associated virus mutant plasmid library; S4, based on the adeno-associated virus mutant virus library, screen, extract the genome, sequence and identify, and obtain a new adeno-associated virus variant library for gene and cell therapy.

2. A method for constructing a novel adeno-associated virus variant library for gene and cell therapy according to claim 1, characterized in that: The natural serotype adeno-associated virus is any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 and AAV13.

3. A method for constructing a novel adeno-associated virus variant library for gene and cell therapy according to claim 1, characterized in that: In S1, the amino acid sequences of cap genes were aligned using the Clustal Omega tool.

4. A method for constructing a novel adeno-associated virus variant library for gene and cell therapy according to claim 1, characterized in that: S2 specifically includes: S21, synthesizing an oligonucleotide DNA sequence containing a single point mutation based on the cap gene sequence of the adeno-associated virus using high-throughput oligonucleotide DNA sequencing; S22, design an 8 bp barcode sequence and add an 8 bp barcode to each oligonucleotide DNA sequence containing a single point mutation; S23, using two rounds of GoldenGate Assembly strategy, oligonucleotides with single-point mutations and Barcodes were inserted into the corresponding positions in the cap6 gene; S24, through electro-transformation, plating counting, and shaking, plasmids were extracted to construct a new adeno-associated virus mutant plasmid library.

5. A method for constructing a novel adeno-associated virus variant library for gene and cell therapy according to claim 1, characterized in that: S3 specifically includes: obtaining auxiliary plasmids, packaging plasmids and target plasmids; transfecting the plasmids into 293LX cells using the calcium phosphate transfection method and packaging the viruses; collecting and purifying the viruses and performing titer detection to obtain a novel adeno-associated virus mutant virus library.

6. A method for constructing a novel adeno-associated virus variant library for gene and cell therapy according to claim 1, characterized in that: S4 includes: inoculating the novel adeno-associated virus mutant virus library into immune cells, and screening the cells that have successfully transduced the virus with drugs; extracting the genome for sequencing analysis after culture, identifying, and obtaining a novel adeno-associated virus variant library for gene and cell therapy.

7. A novel adeno-associated virus variant library for gene and cell therapy obtained according to the construction method according to any one of claims 1 to 6.

8. Use of the novel adeno-associated virus variant library described in claim 7 in the preparation of gene and cell therapy drugs.

9. Use of the novel adeno-associated virus variant library described in claim 7 in screening novel adeno-associated virus capsid protein variants with high transduction efficiency and safety.

10. A novel adeno-associated virus capsid protein variant, characterized in that: The novel adeno-associated virus capsid protein variant is obtained by screening the novel adeno-associated virus variant library for gene and cell therapy as described in claim 7.

Images