Application of threonine dehydratase in regulation and control of growth of Didymeria segeticola and application of threonine dehydratase as bactericide target

Abstract

The invention discloses application of threonine dehydratase in regulation and control of growth of Didymeria segeticola and application of threonine dehydratase serving as a bactericide target in regulation and control of growth of Didymeria segeticola. The threonine dehydratase gene Td disclosed by the invention is derived from Didymeria segeticola, and a knockout mutant is obtained by constructing a knockout gene segment of the Td gene and introducing the knockout gene segment into a D.segeticola protoplast. Experiments find that the Td gene plays a role in growth of D.segeticola, in-vivo pyruvic acid content, in-vivo ATP (adenosine triphosphate) content and sensitivity to wuyiencin. Molecular docking analysis, molecular dynamics simulation and trace thermophoresis experiments prove that the threonine dehydratase can be used as a bactericide target, and the bactericide wuyiencin is obtained through screening. The threonine dehydratase disclosed by the invention can be used as a bactericide target and a key protein of a disease pathogenic mechanism, and has a wide application prospect in prevention and treatment of plant pathogenic fungal diseases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the application of threonine dehydratase in regulating the growth of Didymella segeticola and serving as a fungicide target. Background Art

[0002] Didymella belongs to the family Didymellaceae, class Dothideomycetes, order Pleosporales, phylum Ascomycota. The fungi of this genus are pathogenic to some plants (Crous, PW, Gams, W., Stalpers, JA, Robert, V., Stegehuis, G. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology, 2004, 50: 19-22; Chen, Q., Hou, LW, Duan, WJ, Crous, PW, Cai, L. Didymellaceae revisited. Studies in Mycology, 2017, 87: 105-159).For example, Didymellasegeticola can cause leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science,2022,51:694-703), tobacco leaf spot (Guo,ZN,Xie,HL,Wang,HC,Huang,Y.,Chen,QL,Xiang,LG,Yu,ZH,Yang,XHLeaf spot caused by Didymella segeticola on tobacco in China.Plant Disease,2019,104:1559-1560), Fritillaria taipaiensis PYLi) Leaf spot disease (Chen, LJ, Hu, YW, Huang, L., Luo, M., Wang, GZIsolation and identification of two pathogens causing leaf spotof Fritillaria taipaiensis PYLi.in China. Archives Of Microbiology, 2023, 206:1) Tea leaf spot disease (Zhao Xiaozhen, Wang Yong, Li Dongxue, Ren Yafeng, Chen Zhuo. Morphological characteristics and systematic analysis of the new pathogen Phoma segeticolavar. camelliae of tea trees. Acta Phytopathologica Sinica, 2018, 48:556-559; Deng, XY, Yang, J., Wan, YH, Han, YX, Tong, HR, Chen, YJCharacteristics of leaf spotdisease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113:516-527).D. segeticola var. camelliae strain GZSQ-4 (China General Microbiological Culture Collection Center, strain collection number CGMCC3.20152) was isolated and identified by the research group of the inventor from tea leaf spot disease in Shiqian County, Guizhou Province. The pathogen can infect new shoots, tender leaves and mature leaves of tea trees, causing serious impact on the quality and yield of tea leaves. It is necessary to develop a technology for this disease (Zhao Xiaozhen, Wang Yong, Li Dongxue, Ren Yafeng, Chen Zhuo. Morphological characteristics and systematic analysis of the pathogenic fungus Phoma segeticola var. camelliae of new tea tree diseases. Acta Phytopathologica Sinica, 2018, 48: 556-559).

[0003] To date, research on the pathogenic biology of D. segeticola is still relatively weak at home and abroad, especially the lack of reports on the pathogenic mechanism and host defense response mechanism. Although there are some studies on the pathogen D. segeticola, and fungicides that can prevent and control D. segeticola have been screened in production, such as zhongshengmycin, shenqinmycin, griseofulvin, carvacrol and other biological pesticides (Ren, YF, Li, DX, Jiang, SL, Wang, Y., Tang, Q., Huang, HL, Wang, DL, Song, BA, Chen, Z. Integration of transcriptomic and proteomic data reveals the possible action mechanism of the antimicrobial zhongshengmycin against Didymella segeticola, the causal agent of tea leafspot. Phytopathology, 2021, 111: 2238-2249; Zhao, XZ, Chen, Z., Yu, L., Hu, DY, Song, BA Investigating the antifungal activity and mechanism of a microbialpesticide shenqinmycin against Phoma sp. Pesticide Biochemistry andPhysiology,2018,147:46-50; Huang,HK,Li,DX,Jiang,SL,Yang,R.,Yang,YQ,Xia,ZQ,Jiang,XY,Zhao,YT,Wang,DL,Song,BA,Chen,Z.Integrated transcriptome and proteome analysis reveals that the antimicrobialgriseofulvin targets Didymella segeticola beta-tubulin to control tea leafspot. Phytopathology, 2023,113:194-205; Yin, JY, Wu, S., Yang, YL, Wang, DL, Ma, Y., Zhao, YT, Sheth, S., Huang, H.L., Song, BA, Chen, Z. In addition to damaging the plasma membrane, phenolic monoterpenoid carvacrol can bind to minor groove of DNA of Phytopathogenic fungi to potentially control tea leaf spot caused by Lasiodiplodia theobromae. Phytopathology, 2023, 114: 700-716). However, the unclear pathogenicity and infection mechanisms of D. segeticola limit the development and application of fungicides. Therefore, it is very important to construct a target screening model for D. segeticola fungicides and study the mechanism of action of fungicides. . Summary of the invention

[0004] In view of this, one of the objects of the present invention is to provide any application of the threonine dehydratase gene Td in the following 1)-5):

[0005] 1) Regulate the hyphal growth of Didymella segeticola;

[0006] 2) Regulate the content of pyruvate in Didymella segeticola;

[0007] 3) Regulate the ATP content in Didymella segeticola;

[0008] 4) Regulate the sensitivity of Didymella segeticola to wuyinomycin;

[0009] 5) Design and screen antifungal drugs;

[0010] The nucleotide sequence of the Td gene is shown as SEQ ID NO.1 or the encoded amino acid sequence is shown as SEQ ID NO.2.

[0011] Preferably, the regulating the hyphae growth of Didymella segeticola, regulating the content of pyruvate in Didymellasegeticola and regulating the content of ATP in Didymella segeticola are all reduced; and the regulating the sensitivity of Didymella segeticola to wuyimycin is increased.

[0012] A second object of the present invention is to provide an application of a threonine dehydratase gene Td in cultivating transgenic Didymella segeticola with reduced mycelial growth ability and / or reduced pyruvate content in the body and / or reduced ATP content in the body and / or increased sensitivity to wuyimycin, wherein the nucleotide sequence of the Td gene is shown in SEQ ID NO.1 or the encoded amino acid sequence is shown in SEQ ID NO.2.

[0013] The third object of the present invention is to provide a method for cultivating transgenic Didymella segeticola with reduced mycelial growth ability and / or reduced pyruvate content in the body and / or reduced ATP content in the body and / or increased sensitivity to wuyimycin, comprising the step of reducing the expression amount and / or activity of mRNA or protein of the threonine dehydratase gene Td in the receptor Didymella segeticola to obtain transgenic Didymella segeticola; the nucleotide sequence of the Td gene is shown in SEQ ID NO.1 or the encoded amino acid sequence is shown in SEQ ID NO.2.

[0014] Preferably, the method of reducing the expression level and / or activity of the mRNA or protein of the threonine dehydratase gene Td in the receptor Didymella segeticola is achieved by knocking out, inhibiting or silencing the expression of the Td gene of the receptor.

[0015] A fourth object of the present invention is to provide an application of threonine dehydratase protein as a drug target in screening fungicides, wherein the amino acid sequence of the threonine dehydratase protein is shown in SEQ ID NO.2.

[0016] A fifth object of the present invention is to provide a method for screening fungicides using threonine dehydratase protein as a drug target, comprising the following steps:

[0017] 1) Protein expression and purification of threonine dehydratase gene;

[0018] 2) Prediction of candidate fungicides, the prediction method comprises the following steps:

[0019] A1) Homology modeling of threonine dehydratase;

[0020] A2) Molecular docking analysis with the fungicide to be tested. If the fungicide component to be tested can form a stable chemical bond with the residue of the threonine dehydratase in homology modeling, it is determined to be the intended fungicide; for the chemical bonds formed, the more and more stable they are, the stronger the interaction between the two molecules, the greater the conformational change of the protein, the more affected the protein activity, and the more prominent the bactericidal effect of the fungicide; in addition, hydrogen bonds in intermolecular interactions are relatively stable chemical bonds;

[0021] A3) Molecular dynamics simulation of threonine dehydratase and intended fungicide by homology modeling, confirming that threonine dehydratase has conformational changes, and then screening to obtain candidate fungicides;

[0022] 3) Microthermophoresis experiments are performed to detect the interaction between the candidate fungicide and the threonine dehydratase protein purified in step 1). If there is interaction, it is determined to be a fungicide.

[0023] Preferably, the protein expression and purification method in step 1) comprises the following steps:

[0024] B1) Construction of prokaryotic expression vector;

[0025] B2) Inducible expression of fusion protein;

[0026] B3) Purification of fusion protein;

[0027] The number of stable chemical bonds in step 2) is at least 5.

[0028] Preferably, the fungicide component determined as the fungicide in step 3) is wuyinomycin.

[0029] The sixth object of the present invention is to provide the application of Wuyimycin in regulating the structure and activity of threonine dehydratase protein.

[0030] The present invention provides an application of a threonine dehydratase gene (Td) derived from Didymella segeticola in regulating the growth, in vivo pyruvate content, in vivo ATP content and sensitivity to wuyijincin of D. segeticola. After knocking out the Td gene in wild-type D. segeticola, it is found that the hyphae growth, in vivo pyruvate content and in vivo ATP content of the knocked-out D. segeticola are significantly reduced. The method for screening bactericides of the present invention uses threonine dehydratase (Td) as a target to establish an activity screening model for bactericides, improves the accuracy of drug activity screening, and lays a foundation for the subsequent development of new drugs. The protein expression and purification method of threonine dehydratase has the advantages of high expression amount, simple separation and purification of exogenous proteins, and high recovery rate; the molecular docking analysis, molecular dynamics simulation and microthermophoresis experiments prove that wuyijincin has a strong interaction with the threonine dehydratase protein (Td) of the present invention, that is, threonine dehydratase can be used as a bactericide target. Therefore, the threonine dehydratase of the present invention can be used as a fungicide target and a key protein in the pathogenic mechanism of diseases, and has broad application prospects in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1Schematic diagram of the Td gene knockout and mutant screening strategy in the pathogen D. segeticola;

[0032] Figure 2 Map of plasmid pct74;

[0033] Figure 3 Schematic diagram of microscopic observation of prepared protoplasts;

[0034] Figure 4 PCR electrophoresis diagram during transformant verification;

[0035] Figure 5 WT and ΔTd enzyme activity assay diagram;

[0036] Figure 6 Colony growth of WT and ΔTd under different concentrations of wuyimycin;

[0037] Figure 7 Recombinant plasmid restriction enzyme detection;

[0038] Figure 8 Alignment results of the target gene fragment and the Td gene sequence;

[0039] Fig. 9 SDS-PAGE analysis of the fusion protein expression test;

[0040] Fig.10 SDS-PAGE analysis of the final purified protein;

[0041] Fig.11 Molecular docking and molecular dynamics simulation techniques were used to analyze the interaction between Td and wuyimycin.

[0042] Fig.12 MST was used to study the in vitro interaction between Td and wuyimycin. DETAILED DESCRIPTION

[0043] The present invention will be described in detail below in conjunction with examples, which are merely illustrative and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations made without violating the spirit of the present invention should be included within the scope of the present invention. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0044] In the following examples, the wild strain GZSQ-4 of D. segeticola var. camelliae was isolated and identified from tea leaf spot disease in Shiqian County, Guizhou Province, and sent to the China General Microbiological Culture Collection Administration Center for preservation, with the culture collection number CGMCC3.20152. The CDS sequence of the threonine dehydratase gene Td in the strain is shown in SEQ ID NO.1, and the amino acid sequence of the Td protein encoded by the Td gene is shown in SEQ ID NO.2.

[0045] Experimental Example 1: Construction of D. segeticola gene knockout ΔTd mutant

[0046] Schematic diagram of the knockout and mutant screening strategy of the D. segeticola threonine dehydratase gene Td Figure 1 As shown, the specific construction and screening methods are:

[0047] 1. Construction of knockout gene fragments

[0048] 1) Amplification of upstream and downstream homologous sequences of the target gene: Using the genomic DNA of the wild strain CGMCC3.20152 of D. segeticola as a template, primers 1F and 1R were used to amplify the upstream A fragment, and primers 2F and 2R were used to amplify the downstream B fragment. The 5' end of primer 1R has a reverse complementary sequence of primer hph-F, and the 5' end of primer 2F has a reverse complementary sequence of primer hph-R. The sequences of primers 1F, 1R, 2F, 2R, hph-F and hph-R (5' to 3') are:

[0049] 1F: AGGTCTATCACCAGAAGTAGCTCAG

[0050] 1R: ACCTCCACTAGCTCCAGCCAAGGTGTGTATGTTGTGTTGTGTTGGG 2F: GAATAGAGTAGATGCCGACCGGGGGGATTGAACTTCTATCACGTCTTG 2R: CATAGCTGACACAAGCGACAGC

[0051] hph-F: CTTGGCTGGAGCTAGTGGAGGT

[0052] hph-R:CCCGGTCGGCATCTACTCTATTC

[0053] 2) Amplification of the hygromycin resistance gene hph: Using plasmid pct74 (map as shown Figure 2The first half of the hygromycin resistance gene, H1 (1094 bp), was amplified using primers hph-F and hph-1R; the second half of the hygromycin resistance gene, H2 (748 bp), was amplified using primers hph-1F and hph-R. The sequences of primers hph-1F and hph-1R (5' to 3') are:

[0054] hph-1F:CGTTGCAAGACCTGCCTGAA

[0055] hph-1R:GGATGCCTCCGCTCGAAGTA

[0056] 3) Fusion of upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A and B fragments with the H1 and H2 fragments to obtain A-H1 connection fragments and H2-B connection fragments. Primers 1F / hph-1R and hph-1F / 2R were used to amplify A-H1 and H2-B fragments, respectively, and the knockout fragments were purified to a concentration of 500 ng / μL.

[0057] 2. Preparation of D. segeticola protoplasts

[0058] 1) Inoculate D. segeticola on potato dextrose agar medium and culture at 25°C for 48 hours. Add 2-3 mL of sterile water on the surface of the colony, break the mycelium with an inoculation loop, transfer the bacterial suspension to CM liquid medium and shake for 12 hours, and collect the fresh mycelium of D. segeticola by filtration;

[0059] 2) Using 10 mL of 0.8 mol / L sodium chloride solution as an osmotic pressure stabilizer, a mixed enzymatic solution of Drislase, Snailase and Lyticase was prepared to lyse 5 g of suspended mycelium, and the enzymatic hydrolysis was carried out at 30°C and 120 rpm for 4 h;

[0060] 3) Filter through 2-3 layers of sterilized lens paper (pore size of the fiber mesh is 45±12 μm), rinse with 0.8 mol / L sodium chloride, collect the filtrate, centrifuge the filtrate at 4°C and 4000 rpm for 6 min, and resuspend in 15 mL of 1.2 mol / L sorbitol buffer (STC) solution;

[0061] 4) Discard the supernatant and resuspend the protoplast pellet in 1 mL STC buffer to a concentration of 1×10 7 / mL protoplast suspension (protoplast microscope observation diagram as shown in Figure 3 Place on ice until use.

[0062] 3. D. segeticola protoplast transformation

[0063] 1) Take 200 μL of protoplast suspension and add it to a 50 mL centrifuge tube. Add 10-20 μg of A-H1 and H2-B knockout transformation fragments, mix gently, and let stand on ice for 20 min.

[0064] 2) Add 200 μL, 200 μL, and 800 μL of 60% polyethylene glycol 4000 buffer (PTC) in sequence, gently invert to mix, let stand at room temperature for 20 min, add 5 mL of TB3 liquid culture medium, invert to mix, and let stand for 8-12 h.

[0065] 3) Centrifuge at room temperature, 4000 rpm / min for 6 min, discard the supernatant, and resuspend the remaining 1 mL with the regenerated protoplasts.

[0066] 4) Add to 50 mL of warm TB3 regeneration solid medium, mix well and prepare plates. After inverted culture at 25°C for 10 hours, cover with PDA medium containing 50 μg / mL hygromycin B and culture at 25°C for about 3-4 days until transformants grow, and then subculture and screen for 3 generations.

[0067] 4. PCR verification of transformants

[0068] DNA was extracted using WT and ΔTd mutant as templates, and four pairs of primers were used to detect the upstream, downstream, hph gene and target gene of the fusion fragment. Figure 4 (M: Plus ⅡDNA Marker; lanes 1-4 are WT, lane 1: Td-up, lane 2: Td-down, lane 3: hph, lane 4: Td; lanes 5-8 are ΔTd mutants, lane 5: Td-up, lane 6: Td-down, lane 7: hph, lane 8: Td) as shown, the sizes of the upstream and downstream fragments, hph fragment and target gene fragment were 1506bp, 1521bp, 1376bp and 1729bp respectively, and the fragment sizes were the same as expected, proving that the transformant ΔTd mutant was obtained, so we entered the subsequent experiments.

[0069] Experimental Example 2: Comparison of biochemical experiments between wild type WT and mutant △Td

[0070] 1. Determination of pyruvate and ATP content in wild type WT and mutant △Td

[0071] WT and △Td were inoculated on potato dextrose agar medium and cultured at 25°C for 48 h before in vivo pyruvate determination (kit: Solebold BC2205) and ATP content determination (kit: Bio-Tech S0026). The results are shown in Figure 5 ( Figure 5 A: Determination of pyruvic acid content; Figure 5 B: ATP content determination) As shown in the figure, the pyruvate and ATP contents of △Td were significantly lower than those of WT, indicating that knocking out the Td gene affected the synthesis of pyruvate and ATP in the strain.

[0072] 2. Observation of WT and △Td colony morphology

[0073] WT and △Td were inoculated on PDA medium, cultured at 25℃ in the dark, and the colony diameter was measured by cross method at 7 days, and the colony morphology was observed; 5 replicates were set for each treatment. Figure 6 As shown in plates A0 and B0, the mycelial growth of the knockout mutant ΔTd on PDA medium was significantly slower than that of the wild type WT, indicating that the Td gene affects the growth of Didymella segeticola.

[0074] 3. Determination of sensitivity of WT and △Td to Wuyimycin

[0075] WT and △Td were inoculated on PDA medium containing different concentrations (20, 40, 60, 80, 100, 120, 140 μg / mL) of wuyijincin, and cultured at 25℃ in the dark. The colony diameter was measured by the cross method at 7 days, and the colony morphology was observed; 5 replicates were set for each treatment. The results showed that the indoor toxicity regression equation of wuyijincin to WT was y=1.5442x+1.804, R 2 =0.9846,EC 50 The indoor toxicity regression equation of Wuyimycin to △Td is y=1.6399x+2.5775, R 2 =0.9608,EC 50 Compared with WT and △Td, the mycelium of △Td grew slowly, indicating that the sensitivity to wuyimycin was increased ( Figure 6 As shown, Figure 6 A: WT strain; Figure 6 B is: △Td strain; A1-A7, B1-B7 are PDA plates corresponding to 7 concentrations of Wuyimycin from low to high).

[0076] Experimental Example 3: Prokaryotic expression and protein purification of Td gene

[0077] 1. Construction of prokaryotic expression vector of Td gene

[0078] The Td gene was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. according to SEQ ID NO.1, and the synthesized Td gene was inserted into the pET-28a(+) vector by double restriction enzyme digestion to obtain the recombinant plasmid ( Figure 7 A: Td fragment; Figure 7 B: pET-28-Td recombinant vector; Figure 8 : Comparison of sequencing results shows that the target sequence is completely consistent with the Td gene sequence).

[0079] 2. Experimental expression of Td protein

[0080] Transformation: The recombinant plasmid was transformed into competent E. coli BL21 DE3 cells, heat-shocked at 42°C, plated on plates containing 30 μg / mL kanamycin, and cultured at 37°C;

[0081] Activation: Pick a monoclonal colony and culture it in liquid culture medium containing antibiotics at 37°C;

[0082] Induction: When the OD value reaches 0.6, add the inducer IPTG at a working concentration of 0.2-1mM and continue to culture at 16℃ overnight. The one without the inducer is the negative control.

[0083] Collect the cells: centrifuge at 4000 rpm for 10 min, discard the supernatant, and collect the cells;

[0084] Expression detection: Add binding buffer (150mL PBS, 0.2M mercaptoethanol, 100mL glycerol, 17.4 sodium chloride, sterile water to 1L) to the collected bacteria and suspend them. Use an ultrasonic disruptor to fully dissolve them. Centrifuge and collect the supernatant. Prepare samples for supernatant protein and apply gel for detection. The results are as follows: Fig. 9 (M: standard molecular weight of protein; lane 1: 16°C overnight, no IPTG; lane 2: 16°C overnight, 0.2 mM IPTG; lane 3: 16°C overnight, 0.4 mM IPTG; lane 4: 16°C overnight, 0.6 mM IPTG; lane 5: 16°C overnight, 0.8 mM IPTG; lane 6: 16°C overnight, 1 mM IPTG) as shown, 16°C overnight with 0.8 mM IPTG had a better effect of inducing protein expression.

[0085] 3. Extensive expression of Td protein

[0086] Re-expression: Culture the bacterial liquid in a medium containing the corresponding antibiotics. When the OD value reaches 0.6, add 0.8mM inducer IPTG, culture overnight at 16℃ for large-scale expression, and collect the cell bodies by centrifugation.

[0087] 4. Td expression and purification

[0088] The large shake samples were collected and processed for affinity purification;

[0089] Collect crude protein: Dissolve the cells with buffer (150 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 sodium chloride, sterile water to 1 L), disrupt by ultrasonication, and collect crude protein in the supernatant by centrifugation;

[0090] Balance: Take Ni-NTA filler and load it into the column, and wash and balance the column with Binding buffer;

[0091] Loading: Incubate the crude protein with the equilibrated column packing and collect the effluent;

[0092] Equilibration: Wash and equilibrate the column with Binding buffer;

[0093] Washing: Wash the column with washing buffer and collect the outflow;

[0094] Elution: Elute with Elution buffer and collect the flow-through;

[0095] Purification detection: The crude protein outflow components were processed separately, samples were prepared, and SDS-PAGE detection was prepared.

[0096] Collection and processing: The purified fractions were dialyzed into a protein storage buffer (50 mM Tris, 300 mM NaCl, 0.1% sarkosyl, 2 mM DTT, pH 8.0), concentrated, sterilized by filtration, packaged in 1 mL / tube, and stored at -80°C.

[0097] 5. Target protein detection

[0098] SDS-PAGE detection: protein samples were processed, sample preparation was performed, 12% separation gel, 5% concentration gel, gel running, and molecular weight detection ( Fig.10 , M: Marker; Lane 1: desalted protein), which is consistent with the target size and is used for subsequent micro-thermophoresis experiments.

[0099] Experimental Example 4: Molecular docking, molecular dynamics simulation and microthermophoresis technology experiment

[0100] 1. Molecular docking and molecular dynamics simulation

[0101] Using the homologous protein of Td (PDB accession number: 2XTS.1) as a template, we conducted a homology modeling of Td, and then conducted a molecular docking analysis between it and the fungicide molecule to be tested. The molecule to be tested that forms a stable chemical bond with the residue of threonine dehydratase is the intended fungicide. Then, we conducted a molecular dynamics simulation to screen the intended fungicide that interacts with threonine dehydratase and causes conformational changes in the protein, and determined it as a candidate fungicide. The molecular docking analysis and molecular dynamics simulation process include: TMV4.5 was used for protein pretreatment, hydrogenation and charge, and PyMol 2.5.4 was used for protein visualization after processing; since there was no active site reported for this protein structure, a global search mode was used for docking, and the entire protein was wrapped in a docking box; before docking, the energy of the small molecule was optimized and all rotatable bonds were set to rotate freely. At the same time, the protein structure was minimized, hydrogenated and charged to obtain the optimal conformation. In the Centroid of Workspace ligand module, Pick was clicked on the original ligand on the protein interface to generate a binding cavity with a spacing of 1. , the small drug molecule was docked 100 times independently, the parameter was set to SP (Standard Precision), the docking results were grouped according to RMSD (0.1nm), and the docking conformation with the lowest binding energy and the most operations was selected to obtain the interaction mode between the test molecule and Td. Fig.11 ( Fig.11 A: Molecular docking results of Wuyimycin and Td; Fig.11 B: Molecular dynamics simulation results of Wuyimycin and Td) shows the molecular docking and molecular dynamics simulation results of Wuyimycin and Td. Wuyimycin interacts with Td, and the amino acids N380, N382, K175, A145, and D300 of Td form stable hydrogen bonds. This indicates that Td can be used as a target for screening fungicides, and Wuyimycin is screened as a candidate fungicide.

[0102] 2. Microscale thermophoresis (MST) was used to verify the interaction between Td and the candidate fungicide molecule Wuyijinsu

[0103] Preparation of Td protein samples: Take 5 μL of RED-NHS dye and NHS labeling buffer and mix them gently by blowing. Take 10 μL of purified desalted protein and 90 μL of the above RED-NHS solution and add them to the 1.5 mL centrifuge tube with enzyme inactivated. Mix well on ice, put in a dark environment, and incubate at room temperature for 30 min. Take 10 μL of protein fluorescent labeling solution with a capillary tube and place it on a micro-thermophoresis instrument for measurement. Keep the protein labeling solution with a fluorescence value of 400-1200 for subsequent experiments.

[0104] Setting of microthermophoresis instrument parameters: Monolith NT.115 microthermophoresis instrument will be used to study the interaction between wuyimycin and Td, and the instrument parameters are LED power 40%, Laser power 30%, Red excitation;

[0105] Interaction analysis between Wuyijincin and Td: Microthermophoresis analysis showed that Wuyijincin interacted with Td, and the dissociation constant K d=8.992±2.380( Fig.12 ), indicating that Td has a strong affinity with wuyinomycin. The experiment proved that Td can be used as a target for screening fungicides.

[0106] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, so they will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical scheme of the present invention can be subjected to a variety of simple modifications, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. The threonine dehydratase gene Td is used in any one of the following 1)-5): 1) Regulate the hyphal growth of Didymella segeticola; 2) Regulate the content of pyruvate in Didymella segeticola; 3) Regulate the ATP content in Didymella segeticola; 4) Regulate the sensitivity of Didymella segeticola to wuyinomycin; 5) Design and screen antifungal drugs; The nucleotide sequence of the Td gene is shown as SEQ ID NO.1 or the encoded amino acid sequence is shown as SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The regulation in the step of regulating the hyphae growth of Didymella segeticola, regulating the content of pyruvate in Didymella segeticola and regulating the content of ATP in Didymella segeticola is all reduction; the regulation in the step of regulating the sensitivity of Didymella segeticola to wuyimycin is increase.

3. Use of the threonine dehydratase gene Td in cultivating transgenic Didymella segeticola with reduced mycelial growth ability and / or reduced pyruvate content in the body and / or reduced ATP content in the body and / or increased sensitivity to wuyimycin, characterized in that: The nucleotide sequence of the Td gene is shown as SEQ ID NO.1 or the encoded amino acid sequence is shown as SEQ ID NO.

2.

4. A method for cultivating transgenic Didymella segeticola with reduced mycelial growth ability and / or reduced pyruvic acid content and / or reduced ATP content and / or increased sensitivity to wuyimycin, characterized in that: The method comprises the steps of reducing the expression amount or / and activity of the mRNA or protein of the threonine dehydratase gene Td in the receptor Didymella segeticola to obtain transgenic Didymella segeticola; the nucleotide sequence of the Td gene is shown in SEQ ID NO.1 or the encoded amino acid sequence is shown in SEQ ID NO.

2.

5. The method according to claim 4, characterized in that The method for reducing the expression amount or / and activity of the mRNA or protein of the threonine dehydratase gene Td in the receptor Didymella segeticola is achieved by knocking out, inhibiting or silencing the expression of the Td gene of the receptor.

6. Application of threonine dehydratase protein as a drug target in screening fungicides, characterized in that: The amino acid sequence of the threonine dehydratase protein is shown in SEQ ID NO.

2.

7. A method for screening fungicides using threonine dehydratase protein as a drug target, characterized in that: The following steps are involved: 1) Protein expression and purification of threonine dehydratase gene; 2) Prediction of candidate fungicides, the prediction method comprises the following steps: A1) Homology modeling of threonine dehydratase; A2) molecular docking analysis with the fungicide to be tested, if the fungicide component to be tested can form a stable chemical bond with the residue of the threonine dehydratase in homology modeling, it is determined to be the intended fungicide; A3) molecular dynamics simulation of homology modeling of threonine dehydratase and intended fungicides, and those with conformational changes in threonine dehydratase are identified as candidate fungicides; 3) Microthermophoresis experiments are performed to detect the interaction between the candidate fungicide and the threonine dehydratase protein purified in step 1). If there is interaction, it is determined to be a fungicide.

8. The method according to claim 7, characterized in that The protein expression and purification method in step 1) comprises the following steps: B1) Construction of prokaryotic expression vector; B2) Inducible expression of fusion protein; B3) Purification of fusion protein; The number of stable chemical bonds in step 2) is at least 5.

9. The method according to claim 8, characterized in that The fungicide component determined in step 3) is wuyinomycin.

10. Application of wuyinomycin in regulating the structure and activity of threonine dehydratase protein.

Images