Varicella-zoster virus mRNA vaccine and application thereof

Abstract

The invention provides a varicella-zoster virus mRNA (messenger Ribonucleic Acid) vaccine and application thereof. The invention firstly provides an mRNA molecule, a coding region sequence of the mRNA molecule comprises a nucleotide sequence for coding an amino acid sequence as shown in SEQ ID NO: 1, and the coding region sequence preferably comprises a nucleotide sequence as shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11, or a nucleotide sequence which has at least 93% similarity with the nucleotide sequence as shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11 and codes the same amino acid sequence. When the mRNA molecule is used for preparing the vaccine, the production cost of the vaccine can be reduced, the physicochemical property of the vaccine is stable, the protein expression is improved to enhance the immune effect of the vaccine, and the humoral immunity and cellular immunity effects of the VZV-gE specificity are enhanced.

Description

Technical Field

[0001] The invention relates to a varicella-zoster virus mRNA vaccine and application thereof. Background Art

[0002] Varicella-zoster virus (VZV) is a highly contagious alpha-herpes virus. It is characterized by oval particles with a diameter of about 150-200nm. The linear double-stranded DNA molecule is encapsidated by an icosahedral nucleocapsid as the genetic material. The nucleocapsid is covered with a lipoprotein envelope on the outside. There are 9 glycoproteins on the envelope, namely gE, gI, gC, gH, gL, gB, gK, gM and gN. These glycoproteins are related to the virus's infection, replication, assembly and cell-to-cell transmission. During primary infection, VZV enters the local lymph nodes through the respiratory mucosal epithelium to replicate. The virus-infected lymphocytes then enter the blood circulation through the lymphatic circulation to infect peripheral blood mononuclear leukocytes. The virus spreads to the skin with the bloodstream, and the clinical manifestation is chickenpox. After chickenpox is cured, the virus lurks in the cranial ganglia, dorsal root ganglia of the spinal cord, autonomic neurons or intestinal neurons. When the body's resistance is reduced, the latent virus is reactivated, replicated, and migrated along the peripheral nerves to the skin, clinically manifesting as herpes zoster.

[0003] There is currently no specific treatment for varicella and herpes zoster. Treatment is mainly symptomatic. Antiviral drugs include acyclovir, famciclovir and valacyclovir. Drug treatment can help patients with varicella and herpes zoster recover quickly, but it cannot solve the problem of virus elimination and prevention of invisible infection. Vaccination is currently the most effective means to prevent and control herpes zoster and its complications. There are currently three vaccines approved for marketing, two of which are live attenuated vaccines and one is a subunit vaccine.

[0004] In 2005, Merk Company prevented herpes zoster by injecting a high-dose of the Oka strain live attenuated vaccine once to people over 50 years old infected with VZV virus. The vaccine has an efficiency of 60%-70% in preventing herpes zoster. However, the vaccine antigen usage is high, the immunogenicity is poor, especially the induced cellular immunity effect is poor, the protection efficiency gradually decreases with age, and because it is a live attenuated vaccine, it limits its use in immunosuppressed people, pregnant women, etc. Therefore, in July 2020, the vaccine market has been completely replaced by subunit vaccines.

[0005] Shingrix, a herpes zoster subunit vaccine launched by GSK in 2017, is a conserved viral glycoprotein E (gE protein) expressed by CHO cells as an antigen, and is composed of AS01B adjuvant. It is approved for the prevention of herpes zoster and post-healing neuralgia in people over 50 years old. gE is most abundant in the viral envelope and is the most important glycoprotein recognized by the immune system. It exists on the surface of viral particles and the surface and cytoplasm of infected cells. It is an essential glycoprotein for the generation of infectious viral particles. Cellular immunity and humoral immunity induced by it as the main target can protect animals from viral attacks, so it has become an important target for immunity. The full-length gE is generally 623 amino acids, including a hydrophilic extracellular region (including a signal peptide), a hydrophobic transmembrane region, and an intracellular tail. The Shingrix vaccine uses a truncated gE. The vaccine is 97.2% effective in preventing herpes zoster. AS01B adjuvant includes two immunostimulants, MPLA and QS-21. QS-21 is a polysaccharide mixture that can only be extracted from the bark of the sapodilla tree that grows in temperate regions of South America. It cannot be synthesized artificially at present, and has problems such as limited sources and difficulty in quality control during the preparation process. It is also hemolytic and needs to be combined with liposomes to eliminate its side effects. According to the Shingrix instructions for use, the use of adjuvants requires temporary mixing with antigens, suggesting that the stability of the liposome system when used for vaccines needs to be further improved. Summary of the invention

[0006] One object of the present invention is to provide a varicella-zoster virus vaccine that reduces the production cost of the vaccine, stabilizes the physical and chemical properties of the vaccine itself, improves protein expression to enhance the vaccine immune effect, and / or enhances VZV-gE-specific humoral immunity and cellular immunity.

[0007] Another object of the present invention is to provide the application of the vaccine.

[0008] According to some embodiments of the present invention, the present invention provides an mRNA molecule, the coding region sequence of nucleotides thereof comprises:

[0009] A nucleotide sequence as shown in any one of SEQ ID NO:2 to SEQ ID NO:11; or

[0010] A nucleotide sequence that has at least 93% similarity, at least 95% similarity, at least 98% similarity or at least 99% similarity to the nucleotide sequence shown in any one of SEQ ID NO:2 to SEQ ID NO:11 and encodes the same amino acid sequence.

[0011] According to some specific embodiments of the present invention, the mRNA molecule of the present invention has one or more of the following modifications:

[0012] Modified with 1-methylpseudouridine;

[0013] After 3' tailing modification;

[0014] After at least one 5' capping modification;

[0015] including at least one 5'UTR sequence;

[0016] Includes at least one 3'UTR sequence.

[0017] According to some specific embodiments of the present invention, in the mRNA molecule of the present invention, the cap structure of the 5' capping modification is selected from one or more of Cap1, Cap2 (38), Cap2 (2-1), Cap2 (2-2), Cap2 (2-6), Cap2 (2-48), and Cap2 (2-51). The chemical formulas of each cap structure are shown in Table 2.

[0018] According to some embodiments of the present invention, the present invention also provides an mRNA molecule, which includes a coding region sequence, and further includes: a 5' cap structure, a 5'UTR sequence, a 3'UTR sequence and a PloyA tail sequence;

[0019] Wherein, the coding region sequence comprises a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1; preferably, the coding region sequence is selected from the nucleotide sequence shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11, or is selected from a nucleotide sequence having at least 93% similarity, at least 95% similarity, at least 98% similarity or at least 99% similarity to the nucleotide sequence shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11;

[0020] The 5' cap structure is selected from one or more of Cap1, Cap2(38), Cap2(2-1), Cap2(2-2), Cap2(2-6), Cap2(2-48), and Cap2(2-51). The chemical formulas of the cap structures are shown in Table 2.

[0021] According to some specific embodiments of the present invention, in the mRNA molecule of the present invention, the 5'UTR sequence includes the nucleotide sequence shown in SEQ ID NO:12.

[0022] According to some specific embodiments of the present invention, in the mRNA molecule of the present invention, the 3'UTR sequence includes the nucleotide sequence shown in SEQ ID NO:13.

[0023] According to some specific embodiments of the present invention, in the mRNA molecule of the present invention, the PloyA tail sequence includes the nucleotide sequence shown in SEQ ID NO:14.

[0024] According to some embodiments of the present invention, the present invention also provides a DNA molecule that can be transcribed in vitro into the mRNA molecule of the present invention.

[0025] According to some embodiments of the present invention, the present invention also provides a recombinant plasmid containing the DNA molecule of the present invention.

[0026] According to some embodiments of the present invention, the present invention also provides a lipid nanoparticle loaded with the mRNA molecule of the present invention.

[0027] According to some embodiments of the present invention, the present invention also provides a pharmaceutical composition comprising: the mRNA molecule of the present invention, and a pharmaceutically acceptable excipient. The excipient can be selected from solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersants, suspension aids, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, lipids, lipidoid liposomes, lipid nanoparticles, core-shell nanoparticles, polymers, lipoplexes, peptides, proteins, cells, hyaluronidase, and mixtures thereof.

[0028] According to some embodiments of the present invention, the present invention also provides the use of the mRNA molecule, the DNA molecule, the recombinant plasmid, the lipid nanoparticle or the pharmaceutical composition in the preparation of a herpes zoster mRNA vaccine.

[0029] According to some embodiments of the present invention, the present invention also provides a herpes zoster mRNA vaccine, which comprises the mRNA molecule described in the present invention.

[0030] In some specific embodiments of the present invention, the vaccine is in the form of lipid nanoparticles.

[0031] According to a specific embodiment of the present invention, in the vaccine of the present invention, the particle size of the lipid nanoparticles is 50nm to 200nm, preferably 50nm to 150nm.

[0032] According to a specific embodiment of the present invention, the vaccine of the present invention is a freeze-dried dosage form or a frozen dosage form.

[0033] According to a specific embodiment of the present invention, the vaccine of the present invention is a subcutaneous or intramuscular injection vaccine.

[0034] According to a specific embodiment of the present invention, in the vaccine of the present invention, the lipid nanoparticles include mRNA and lipid LNPs. Wherein: the lipid LNPs include one or more of cationic lipids, supporting lipids, sterol substances and polymer-conjugated lipids.

[0035] According to a specific embodiment of the present invention, in the vaccine of the present invention, the cationic lipids include but are not limited to 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl) azadiyl) bis(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 8-((7-((3-(hexylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanol (T19, see Table 5 for the structural formula), 8-((5-((3-(octylthio)-2-methylpropanoyl)oxy)n-pentyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanol (T13, see Table 5 for the structural formula).

[0036] According to a specific embodiment of the present invention, in the vaccine of the present invention, the polymer-conjugated lipids include but are not limited to PEG-modified lipids, such as one or more of PEG-DMG, ALC0159, PEG-DSPE, and PEG-DSG.

[0037] According to a specific embodiment of the present invention, in the vaccine of the present invention, the supporting phospholipids (or neutral auxiliary lipids) include but are not limited to one or more of DSPC, DOPE, DOPC, and DOPS.

[0038] According to a specific embodiment of the present invention, in the vaccine of the present invention, the sterol substances include but are not limited to one or more of cholesterol and β-sitosterol.

[0039] According to a specific embodiment of the present invention, in the vaccine of the present invention, based on the total molar amount of lipids as 100%, the molar ratio of each lipid component is: cationic lipid 35%-57.5%, supporting lipid 5%-16%, sterol substance 27.5%-55%, polymer conjugated lipid 0-3%, preferably 0.5%-2.5%.

[0040] According to a specific embodiment of the present invention, the mRNA vaccine of the present invention further includes an adjuvant; the adjuvant used may be, for example, an aqueous solution of salt and sugar. Specifically, the salt is selected from one or more of citrate, acetate, phosphate or Tris salt; the sugar is selected from one or more of sucrose and trehalose. More specifically, in the vaccine product, the adjuvant salt concentration is 5mM to 50mM, more preferably 5mM to 25mM; the adjuvant sugar concentration is 5% to 20% W / V.

[0041] According to a specific embodiment of the present invention, the pH of the mRNA vaccine of the present invention is 6.5 to 8.5, preferably 7.0 to 8.0.

[0042] According to a specific embodiment of the present invention, the vaccine of the present invention is a vaccine for preventing and / or improving varicella, herpes zoster and / or postherpetic neuralgia. The vaccine of the present invention can effectively induce specific humoral immunity, stimulate CD4+ cellular immune response, and enhance long-term protective effect; at the same time, it can reduce the use of adjuvants, improve safety, and reduce side effects.

[0043] According to some embodiments of the present invention, the present invention also provides a method for preparing the mRNA vaccine, which includes a process for preparing the mRNA molecule. Specifically, it includes the following steps:

[0044] Synthesize a DNA fragment encoding the amino acid sequence shown in SEQ ID NO: 1, such as the nucleotide sequence shown in any one of SEQ ID NO: 2 to SEQ ID NO: 11;

[0045] The DNA fragment is cloned into a plasmid as a template and transcribed to prepare the target mRNA molecule.

[0046] In some specific embodiments of the present invention, the present invention provides a method for preparing the mRNA molecule, wherein the process of synthesizing the DNA fragment encoding the amino acid sequence shown in SEQ ID NO: 1 can be synthesized by itself or commissioned. The DNA fragment is cloned into a plasmid as a template, and the target mRNA molecule can be prepared according to the following reaction:

[0047] a. Three-step method: uncapped and untailed mRNA is obtained by in vitro transcription, a polyA structure is added to the tail of the mRNA under the conditions of RNA polymerase and ATP (a linker may or may not be inserted in the middle of the polyA structure), and a cap structure is added to the 5' end of the uncapped mRNA under the catalysis of a capping enzyme to obtain a capped and tailed mRNA molecule;

[0048] b. Two-step method: in vitro transcription to obtain tailed but uncapped mRNA; under the catalysis of capping enzyme, a cap structure is added to the 5' end of the uncapped mRNA to obtain a capped and tailed mRNA molecule;

[0049] c. One-step method: perform in vitro transcription and capping to obtain capped and tailed mRNA molecules.

[0050] In some specific embodiments of the present invention, the method for preparing the mRNA molecule further comprises an mRNA purification process: subjecting the mRNA to lithium chloride / ethanol precipitation, centrifugal column, chlorine extraction / ethanol precipitation or gel purification to obtain purified mRNA.

[0051] According to a specific embodiment of the present invention, the method for preparing the mRNA vaccine of the present invention further comprises:

[0052] The prepared mRNA molecules are dissolved in an aqueous phase consisting of a citric acid buffer, and are mixed with lipid components dissolved in an ethanol phase by a microfluidics or impact jet method to prepare lipid nanoparticles loaded with mRNA.

[0053] According to a specific embodiment of the present invention, the method for preparing the mRNA vaccine of the present invention also includes a process of making the prepared lipid nanoparticles into a frozen preparation or a freeze-dried preparation.

[0054] In summary, the herpes zoster mRNA vaccine described in the present invention can be prepared by in vitro transcription compared to attenuated live and subunit protein vaccines, which effectively reduces the production cost of the vaccine. At the same time, the freeze-dried dosage form increases the stability and storage market at room temperature, greatly reduces transportation costs, and improves accessibility. The vaccine itself has stable physical and chemical properties, and the production process is simple and standardized operations can be achieved, saving time and cost.

[0055] The experimental studies of the present invention show that the herpes zoster mRNA vaccine of the present invention can have a self-adjuvant effect without the addition of additional adjuvants. It can be activated by Toll-like receptor 7 / 8 (TLR7 / 8), and the activated receptors are transmitted by downstream molecular signals, such as Myd88, and ultimately produce IFN-γ and other pro-inflammatory factors IL-2, etc. These signal pathways activate and promote different innate immune responses to induce specific immune responses against pathogens.

[0056] The herpes zoster mRNA vaccine described in the present invention is modified by 5' capping, introduction of 3' end PloyA sequence, pseudouridine replacement and other modifications, which further improves the stability of mRNA, effectively reduces the body's recognition of exogenous mRNA, and reduces the degradation rate by regulating the activity of RNaseI, increases translation efficiency, and improves protein expression to enhance the immune effect of the vaccine.

[0057] The herpes zoster mRNA vaccine described in the present invention can increase its distribution in immune organs, such as lymph nodes and spleen, increase the chance of contact with APC antigen presenting cells and T cells, and be recognized by CD4+ helper T cells through presentation. B cells and Th interact to produce specific antibodies and factors, thereby generating a dual response of humoral immunity and cellular immunity, thereby enhancing the VZV-gE-specific humoral immunity and cellular immunity effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 Shows the effect of sequence optimization of Seq ID No. 2 to 11 on the expression level of gE protein.

[0059] Figure 2The cap analog experiment shows the effect of mRNA-LNP formed by mRNA with different capping methods on the expression levels of gE-specific binding antibodies and CD4+ cytokines.

[0060] Figure 3 The effects of different delivery vectors on gE-specific binding antibodies and CD4+ cytokine expression levels in the delivery vector experiment are shown.

[0061] Figure 4 The effect of freeze-dried mRNA-LNP on the expression levels of gE-specific binding antibodies and CD4+ cytokines is shown. DETAILED DESCRIPTION

[0062] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical scheme of the present invention is now described in detail below, but it should not be understood as limiting the scope of the present invention. The experimental methods without specific conditions in each embodiment are operated according to the conventional conditions in the field. The starting reagents and materials used in the embodiments can be obtained commercially or prepared with reference to the prior art in the field.

[0063] The corresponding relationship between the amino acid and nucleotide sequences used in each embodiment and the sequence listing is as follows:

[0064] Amino acid sequence derived from mutation of varicella zoster virus glycoprotein E: SEQ ID NO: 1;

[0065] Sequence eight: SEQ ID NO: 2;

[0066] Sequence 1: SEQ ID NO: 3;

[0067] Sequence 2: SEQ ID NO: 4;

[0068] Sequence 3: SEQ ID NO: 5;

[0069] Sequence 4: SEQ ID NO: 6;

[0070] Sequence 5: SEQ ID NO: 7;

[0071] Sequence 6: SEQ ID NO: 8;

[0072] Sequence 7: SEQ ID NO: 9;

[0073] Sequence 9: SEQ ID NO: 10;

[0074] Sequence ten: SEQ ID NO:11.

[0075] Example 1. Vaccines with different mRNA sequences

[0076] Use SM102:Cholesterol:DSPC:PEG 2k -DMG was dissolved in anhydrous ethanol in a ratio of 50:38.5:10:1.5 to prepare an organic phase A (the average lipid concentration was 10 mg / ml), and the mRNAs transcribed from the sequences in SEQ ID No. 2 to 11 were selected (each mRNA was modified with 100% mlψ, and the 5' cap structure was Cap2 (2-6) as shown in Table 2), 5'UTR sequence: AGGGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCC ACC (SEQ ID NO: 12), 3'UTR sequence: CTGCCTTCTGCGGGGCTTGCCTTCTGGCCATG CCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTA GGAAG (SEQ ID NO: 13), and the PloyA tail sequence was: AAAAAAAAAAAAAAAAAAAAA AAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 14)) was dissolved in a pH = 4.0 citric acid / sodium citrate buffer to prepare aqueous phase B (mRNA concentration was 0.54 mg / ml), and a microfluidic device was used to mix solution A: solution B at a volume ratio of 1:3 to form mRNA-LNP. After preparation, it was dialyzed in 20mM Tris buffer for 24 hours, and the solution was replaced every 8 hours. After 24 hours, the herpes zoster vaccine was obtained after sterilization through a 0.22μm filter membrane.

[0077] Transfect the prepared vaccine into 293T cells, and prepare western samples 24 hours after transfection. Discard the culture medium first, rinse 3 times with 2-3ml PBS, and discard. Then add lysis buffer for lysis, gently scrape the bottom with a scraper, transfer the sample to an EP tube, and then centrifuge. The centrifugation conditions are: 13500r / min, 4℃ centrifugation for 15min. Transfer the supernatant to a new EP tube. Use the BCA kit (Biyuntian Biotechnology Co., Ltd.) to detect the protein concentration, and add lysis buffer to adjust according to the concentration. Finally, add loading buffer, boil at 100℃ for 8min, and store frozen at -20℃.

[0078] The sample was added to the SDS-PAGE gel prepared in advance, connected to the electrode for running, and then transferred to the PVDF membrane. Anti-gE protein antibody (abcam, ab272686) was added. After incubation at 4°C overnight, the primary antibody was recovered, and the membrane was washed 3 times with TBST solution for 10 minutes each time. Then, goat anti-mouse secondary antibody (Proteintech, SA00001-1) was added and incubated at room temperature for 1 hour. Then, the membrane was washed 3 times with TBST for 10 minutes each time. Finally, ECL color developer was used for development to detect the expression level of gE protein.

[0079] The results are as follows Figure 1 And as shown in Table 1.

[0080] Table 1. Expression ratios of gE proteins of different sequences

[0081]

[0082] Example 2: Vaccines with different capping methods

[0083] SEQ ID NO: 2 (i.e., sequence eight) was used as the target sequence, and different cap analogs were used in the in vitro transcription process, namely, Cap1 (CleanCap AG, Shanghai Zhaowei Technology Co., Ltd.), Cap2 (38), Cap2 (2-1), Cap2 (2-2), Cap2 (2-6), Cap2 (2-48), and Cap2 (2-51) to form different mRNAs by in vitro transcription. Each mRNA was modified with 100% m1ψ, 5'UTR, 3'UTR, and 3'Poly A tail as in Example 1.

[0084] The specific structure of each cap is shown in Table 2. In addition to being commercially available, each cap analog can also be synthesized by referring to the method described in CN202310391954.9.

[0085] Table 2. Names and structures of different cap analogs

[0086]

[0087]

[0088] Use T19:Cholesterol:DSPC:PEG 2k-DMG=50:38.5:10:1.5 was dissolved in anhydrous ethanol to form organic phase A (average lipid concentration was 10 mg / ml), and mRNA transcribed from SEQ ID NO:2 was selected (different cap analogs in Table 2 were used for modification during in vitro transcription, and 100% m1ψ was modified as in Example 1, and the same 5'UTR, 3'UTR, and 3'PolyA tail were added), and dissolved in citric acid / sodium citrate buffer at pH=4.0 to form aqueous phase B (mRNA concentration was 0.54 mg / ml), and mRNA-LNP was prepared by mixing solution A: solution B at a volume ratio of 1:3 using a microfluidic device. After preparation, it was dialyzed in 20mM Tris buffer for 24 hours, and the solution was replaced every 8 hours. After 24 hours, mRNA-LNP was obtained after sterilization through a 0.22μm filter membrane. C57 mice (10 / group, female, 8 weeks old for primary immunization, weighing 18-22 g) were set up into experimental group and blank control group. The experimental groups were immunized twice with 5 μg of LNP containing the above-mentioned different mRNAs by intramuscular injection 2 weeks apart. Two weeks after each immunization, blood was collected from the eye sockets of the experimental group and the control group mice, respectively, and the serum was obtained by centrifugation and stored at -20 degrees Celsius for later use. Two weeks after the second immunization, the spleens of the experimental group and the control group were removed for later use.

[0089] The above-mentioned experimental group mouse serum was diluted to a gradient of 10000x, 20000x, 40000x, 80000x, 160000x, 320000x, and 640000x, and added to the Elisa plate pre-coated with standard gE protein together with the negative control group serum. 100 μL of each sample was taken, and 3 parallel wells were made. The plate was sealed with a sealing film and incubated at 4°C for 2 h. Take out the 96-well plate after incubation with primary antibody, pour out the primary antibody liquid, pat dry on absorbent paper until there is no residue in the well, add the diluted secondary antibody (Goat pab to Ms IgG (HRP), 1:50000) to each well of the 96-well plate at a volume of 100 μL, seal the plate with a sealing film, and incubate at room temperature in the dark for 1 hour; take out the ELISA plate after incubation with secondary antibody, pour out the secondary antibody liquid, pat dry on absorbent paper until there is no residue in the well, take out the disposable sample slot at room temperature in the dark, pour TMB (3,3′,5,5′-Tetramethylbenzidine) solution into the sample slot, add 100 μL TMB to each well with a spray gun, and color at room temperature in the dark for 20 minutes. At this time, the positive sample is blue. The sample must record the liquid addition and color reaction time of each plate to ensure consistent incubation time. After color development, add 100 μL Stop Solution to each well using a dispenser. The sample will then turn yellow and its absorbance will be measured at 450 nm. Read each ELISA plate within two minutes after adding Stop Solution.

[0090] Add mouse lymphocyte separation solution to a six-well plate, put in a 70μm cell sieve, place the spleen of the immunized mouse on the sieve, grind the spleen with a syringe piston until it becomes colorless, draw the lower layer of cell suspension into a 15ml centrifuge tube, slowly add 1ml RPMI1640 medium to the cell suspension layer (do not break the interface), centrifuge at 800g for 30min at room temperature (up 3 times down 3), draw the lymphocyte layer, add 10mL RPMI-1640, centrifuge at 350g for 10min at room temperature, discard the supernatant, and resuspend in 2mL RPMI-1640 complete medium (+10% inactivated serum +1% double antibody) to prepare spleen cell fluid. Add spleen cells to the cell culture 2×10 6 / well, and add culture medium to 200 μL, add the corresponding peptide library (2 μg / mL) or an equal volume of solvent for stimulation; after standing in a carbon dioxide incubator at 37°C for 1 hour, add 0.4 μL of protein transport inhibitor to each well, culture at 37°C for 5 hours, and store at 4°C overnight. Then, the cells in the well plate were pipetted into a 2 mL centrifuge tube, centrifuged at 350 g, 4 °C for 5 min, the supernatant was discarded, 100 μL of Zombie staining solution was added to each well, and the supernatant was discarded after further centrifugation. PBS containing 1% BSA containing anti-mouse CD16 / CD32 (Biolegend) mAb, 50 μL of anti-mouse CD3 (Biolegend), anti-mouse CD4 (Biolegend), and anti-mouse CD8 (Biolegend) were added in sequence, 150 μL of Fixation / Permeabilization solution (Biolegend), and a mixture of Anti-mouse IFN-γ (Biolegend) and Anti-mouse IL-2 (Biolegend) were added. The supernatant was discarded after each step of the centrifugation. Finally, 200 μL of PBS containing 1% BSA was added for detection by flow cytometry. The CD3 stimulated and unstimulated cells were recorded. + CD4 + IFN-γ + 、CD3 + CD8 + IFN-γ + 、CD3 + CD4 + IL-2 + 、CD3 + CD8 + IL-2 + The cell ratios were analyzed and processed by CytExpert 2.4 software.

[0091] The results are as follows Figure 2 As shown in Table 3 and Table 4.

[0092] Table 3. Expression levels of different cap mRNA experiments combined with antibodies

[0093]

[0094] Table 4. Experiments with different capped mRNAs IL2 + IFN-g + CD4 + T cell factor levels

[0095]

[0096] Example 3: Vaccines with different carriers

[0097] T13 and T19 were selected as cationic lipids, and LNPs with different proportions were formed based on the cationic lipids, cholesterol, DSPC, and PEG-DMG. The groups were named T13-3 (T13: DSPC: PEG-DMG: CHOL = 48: 9.5: 2: 40.5), T13-5 (T13: DSPC: PEG-DMG: CHOL = 48: 16: 1.5: 34.5), T19-5 (T19: DSPC: PEG-DMG: CHOL = 48: 16: 1.5: 34.5), T13-6 (T13: DSPC: PEG-DMG: CHOL = 48: 16: 2: 34), and T19-6 (T19: DSPC: PEG-DMG: CHOL = 48: 16: 2: 34). The lipid was dissolved in anhydrous ethanol according to the designed ratio to form solution A, and the mRNA transcribed from SEQ ID NO: 2 (modified with Cap2 (2-6) cap analogs during in vitro transcription, and modified with 100% m1ψ as in Example 1, with the same 5'UTR, 3'UTR, and 3'PolyA tail) was selected and dissolved in a citric acid / sodium citrate buffer at pH = 4.0 to form an aqueous phase B (mRNA concentration was 0.54 mg / ml), and a microfluidic device was used to mix solution A: solution B at a volume ratio of 1:3 to form mRNA-LNP. After preparation, the solution was dialyzed in 20mM Tris buffer for 24 hours, and the solution was replaced every 8 hours. After 24 hours, the mRNA-LNP was obtained after sterilization through a 0.22μm filter membrane. C57 mice (10 mice / group, female, 8 weeks old for primary immunization, weighing 18-22 g) were set up in an experimental group and a blank control group. The experimental group was immunized once with 5 μg mRNA by intramuscular injection of the above-mentioned different LNP vectors. Two weeks after immunization, blood was collected from the orbits of the experimental group and the control group mice, respectively, and the serum was centrifuged and stored at -20 degrees Celsius for later use; the spleen was removed for later use, and the binding antibody and T cell factor detection were performed according to the operation of Example 2.

[0098] The structural diagrams of T13 and T19 are shown in Table 5.

[0099] Table 5. Cationic lipid structures

[0100]

[0101] The results are as follows Figure 3 , as shown in Table 6 and Table 7.

[0102] Table 6. Antibody expression levels in different vector experiments

[0103] Carrier Type Shingrix T13-3 T13-5 T13-6 T19-5 T19-6 Average value 708647 413580 264182 222720 225489 263705

[0104] Table 7. Experimental IL2 with different vectors + IFN-g + CD4 + T cell factor levels

[0105] Carrier Type Shingrix T13-3 T13-5 T13-6 T19-5 T19-6 Average value 0.317 0.10 0.568 0.675 0.543 0.177

[0106] Example 4

[0107] The vaccine of the T13-5 vector in Implementation Case 3 was selected and freeze-dried to form a freeze-dried preparation, which was compared with the samples of the commercial vector (ALC0315: DSPC: cholesterol: PEG-DMG = 46.3: 9.4: 42.7: 1.6) before and after freeze-drying and the samples of the T13-5 vector before and after freeze-drying. The animal experiments were as follows: C57 mice were immunized once with T13-5 or commercial LNP containing 5 μg mRNA before and after freeze-drying (10 mice / group, female, 8 weeks of age for the first immunization, weighing 18-22 g). Three weeks after immunization, blood was collected from the eye sockets and centrifuged to obtain serum, which was stored at -20 degrees Celsius for later use. The spleen was also removed for later use.

[0108] The binding antibody and T cell factor detection were performed according to the procedure of Example 2.

[0109] The results are as follows Figure 4 , as shown in Table 8 and Table 9.

[0110] Table 8. Binding antibody expression levels before and after lyophilization

[0111]

[0112] Table 9. IL2 before and after lyophilization + IFN-g + CD4 + T cell factor levels

[0113]

[0114] The research results of this example prove that the freeze-dried dosage form of the herpes zoster candidate vaccine is achievable.

Claims

1. An mRNA molecule, the coding region sequence of which comprises: A nucleotide sequence as shown in any one of SEQ ID NO:2 to SEQ ID NO:11; or A nucleotide sequence that has at least 93% similarity, at least 95% similarity, at least 98% similarity or at least 99% similarity to the nucleotide sequence shown in any one of SEQ ID NO:2 to SEQ ID NO:11 and encodes the same amino acid sequence.

2. The mRNA molecule according to claim 1, wherein The mRNA has one or more of the following modifications: Modified with 1-methylpseudouridine; After 3' tailing modification; After at least one 5' capping modification; preferably, the cap structure of the 5' capping modification is selected from one or more of Cap1, Cap2 (38), Cap2 (2-1), Cap2 (2-2), Cap2 (2-6), Cap2 (2-48), Cap2 (2-51); including at least one 5'UTR sequence; Includes at least one 3'UTR sequence.

3. An mRNA molecule comprising a coding region sequence, further comprising: 5' cap structure, 5' UTR sequence, 3' UTR sequence, and PloyA tail sequence; Wherein, the coding region sequence includes a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1; Wherein, the 5' cap structure is selected from one or more of Cap1, Cap2(38), Cap2(2-1), Cap2(2-2), Cap2(2-6), Cap2(2-48), and Cap2(2-51); Preferably, the 5'UTR sequence comprises the nucleotide sequence shown in SEQ ID NO: 12; Preferably, the 3'UTR sequence comprises the nucleotide sequence shown in SEQ ID NO: 13; Preferably, the PloyA tail sequence includes the nucleotide sequence shown in SEQ ID NO:

14.

4. A DNA molecule which can be transcribed in vitro into the mRNA molecule according to any one of claims 1 to 3. A recombinant plasmid comprising the DNA molecule according to claim 4. A lipid nanoparticle loaded with the mRNA molecule according to any one of claims 1 to 3.

7. A pharmaceutical composition comprising: the mRNA molecule according to any one of claims 1 to 3, and a pharmaceutically acceptable excipient.

8. Use of the mRNA molecule according to any one of claims 1 to 3, the DNA molecule according to claim 4, the recombinant plasmid according to claim 5, the lipid nanoparticle according to claim 6 or the pharmaceutical composition according to claim 7 in the preparation of a herpes zoster mRNA vaccine.

9. A herpes zoster mRNA vaccine comprising the mRNA molecule according to any one of claims 1 to 3; Preferably, the vaccine is in the form of lipid nanoparticles; Preferably, the vaccine dosage form is a freeze-dried dosage form or a frozen dosage form; Preferably, the vaccine is administered subcutaneously or intramuscularly.

10. The herpes zoster mRNA vaccine according to claim 9, wherein The lipid nanoparticles include mRNA and lipid LNP, wherein: The lipid LNP comprises one or more of a cationic lipid, a supporting lipid, a sterol substance, and a polymer-conjugated lipid; Preferably, the cationic lipids include 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl) azadiyl) bis(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 8-((7-((3-(hexylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl) The polymer-conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, and PEG-DSG; the supporting phospholipid comprises one or more of DSPC, DOPE, DOPC, and DOPS; the sterol comprises one or more of cholesterol and β-sitosterol; Preferably, based on the total molar amount of lipid as 100%, the molar ratio of each lipid component is: cationic lipid 35%-57.5%, supporting lipid 5%-16%, sterol substance 27.5%-55%, polymer conjugated lipid 0-3%, preferably 0.5%-2.5%; Preferably, the mRNA vaccine further comprises an adjuvant; the adjuvant used may be, for example, an aqueous solution of salt and sugar; preferably, the salt is selected from one or more of citrate, acetate, phosphate or Tris salt; the sugar is selected from one or more of sucrose and trehalose; Preferably, the vaccine is a vaccine for preventing and / or ameliorating varicella, herpes zoster and / or postherpetic neuralgia.

Images