Cultivation method for promoting rapid growth and development of spring wheat

Abstract

The invention discloses a cultivation method for promoting rapid growth and development of spring wheat, and belongs to the technical field of wheat breeding and cultivation. The cultivation method comprises the following steps: 1, seed pretreatment; 2, field planting and soil culture: transplanting wheat seeds with white buds into a seedling culture hole tray, transferring the seedling culture hole tray into a culture room with a long photoperiod, culturing until the wheat seeds are mature, and harvesting; lED light is adopted in the culture room for illumination; the LED light is blue light, white light or a mixture of red light and blue light according to a light quantum ratio of 3: 1. The method has the beneficial effects that the condition combination of regulating and controlling the light period, the light quality and the light intensity is provided. Through the combination of fixed and widely applicable illumination conditions, the method significantly shortens the growth cycle of the spring wheat. The method has the beneficial effects that the time from seed germination to mature harvesting of the spring wheat is generally 50-60 days, so that 6-7 generations of spring wheat can be harvested in one year. The wheat growth cycle is shortened, the breeding efficiency is remarkably improved, and a solid technical foundation is laid for improvement and cultivation of chassis varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat breeding and cultivation, and particularly relates to a cultivation method for promoting rapid growth and development of spring wheat. Background Art

[0002] As the world's second largest food crop, the increase in wheat yield and the improvement in quality are crucial to responding to the global food crisis. In particular, with the intensification of the climate crisis and the increasing severity of problems such as drought, flood, disease and pests, global food security faces huge challenges. At present, modern wheat breeding faces serious homogeneity problems, a lack of original high-quality germplasm resources, insufficient mining of key new genes, and the lagging application of molecular design breeding technology, which have become a "neck-stuck" problem restricting the development of the wheat seed industry. The key to solving this problem lies in enriching genetic resources based on conventional breeding methods, supplemented by molecular marker-assisted selection technology, radiation mutagenesis and gene editing, and empowering breeding research with artificial intelligence, that is, breeding 4.0 technology.

[0003] Traditional breeding methods mainly rely on hybridization and self-pollination for variety improvement and selection. From parental hybridization to the stable introduction of traits of new varieties, it usually takes 6 to 8 generations of breeding process, and 4 to 5 years of variety approval process. However, due to the limitations of climate and natural conditions, wheat can only be planted for one generation a year, resulting in the cultivation of a new wheat variety usually taking more than 10 years. This long growth cycle severely limits the efficiency and progress of wheat breeding.

[0004] At present, there have been some reports on the research of multi-generation breeding technology of crops, as follows:

[0005] The Chinese patent application document with publication number CN117716987A discloses a method for accelerating wheat growth and shortening the growth cycle in a plant factory, but lacks a detailed description of the specific regulatory mechanism of wheat growth. The Chinese patent application document with publication number CN117378504A proposes a method for increasing the wheat breeding speed by in vitro culturing wheat post-flowering embryos, avoiding the time of waiting for wheat to mature and significantly shortening the growth cycle. However, the practical application of this method is limited by the high cost of equipment and the complexity of operation. The Chinese patent application document with publication number CN113557864A discloses an LED light formula and its application for promoting the flowering and maturation of rapeseed, which successfully shortens the flowering and maturation time of rapeseed by accurately controlling light environment parameters such as light quality, light intensity and photoperiod. However, the applicability and effect of this method on other crops (such as wheat) are still unclear. Summary of the invention

[0006] The technical problem to be solved by the present invention is how to solve the problems of long cycle and low efficiency in the traditional wheat cultivation process.

[0007] The present invention solves the above technical problems through the following technical means:

[0008] The present invention provides a cultivation method for promoting rapid growth and development of spring wheat, comprising the following steps:

[0009] (1) Seed pretreatment: selecting plump and uniform-sized spring wheat seeds and sterilizing them; placing the sterilized seeds in a culture dish filled with wet filter paper and culturing them until the seeds turn white; the spring wheat is photoperiod-insensitive spring wheat;

[0010] (2) Planting and soil culture: Transplant the white wheat seeds into seedling trays, move them to a culture room with a long light period, and culture them until they are mature and harvested; the culture room is illuminated by LED light; the LED light is blue light, white light, or (composite light of red light: blue light = 3:1); the ambient temperature of the culture room is 22-28°C, the air humidity is 46-80%, and the carbon dioxide concentration is 460-880 ppm.

[0011] Preferably, the photoperiod-insensitive spring wheat is specifically selected from any one of Ningchun No. 4, Ningchun No. 50 and Ningchun No. 55.

[0012] Preferably, in step (2), the spectral range of blue light is 410-490 nm, the spectral range of white light is 400-780 nm; and the spectral range of red light is 620-750 nm.

[0013] Preferably, in step (2), the long photoperiod specifically refers to a photoperiod of 18 to 22 hours of light / 2 to 6 hours of darkness, and more preferably.

[0014] Preferably, in step (2), the light intensity is controlled at 250-350 μmol m -2 s -1 , more preferably 300 μmol m -2 s -1 .

[0015] Preferably, in step (2), the ambient temperature in the culture room is 25.3° C., the air humidity is 67.2%, and the carbon dioxide concentration is 540 ppm.

[0016] Preferably, in step (2), the soil in the seedling tray is a mixture of nutrient soil: vermiculite:perlite=3.6:2.8:1.4 in volume ratio.

[0017] Preferably, the cultivation process in step (2) further comprises irrigating with 43-52% (v / v) Hoagland's standard nutrient solution once a week with an irrigation volume of 1-3 L.

[0018] The beneficial effects of the present invention are:

[0019] 1. The present invention proposes a cultivation method for promoting the rapid growth and development of spring wheat, which is based on the method of regulating the rapid iteration of wheat by combining the three light elements of LED light spectrum, light intensity and light period, and provides important technical support for the creation of new wheat germplasm and the breeding of new varieties. By regulating the three major elements of light period, light quality and light intensity, the time of the entire growth and development process of wheat from seed germination to harvest is shortened, the cultivation cycle is shortened, and the breeding efficiency is improved.

[0020] 2. Significantly shorten the growth cycle: By optimizing the combination of light cycle, light quality and light intensity, the time from seed germination to mature harvest of wheat is greatly shortened, so that spring wheat can complete the growth cycle within 50 to 60 days. This efficient growth model allows 6 to 7 generations of harvests to be achieved in a year, thus breaking through the limitation of the long growth cycle of traditional wheat.

[0021] 3. Accelerate the breeding process: Through rapid growth, development and maturity, the present invention provides important technical support for wheat breeding. The shortened growth cycle not only improves the breeding efficiency, but also accelerates the improvement and breeding process of chassis varieties, providing a solid foundation for breeding research and application.

[0022] 4. Flexible adaptability: This lighting combination is suitable for a variety of wheat varieties, including photoperiod-sensitive and non-sensitive varieties. By adjusting the photoperiod, light quality and light intensity, it can be appropriately adjusted according to the growth needs of different varieties to ensure optimal growth and development and acceleration effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The photoperiod molecular marker detection of the six spring wheats in Example 1 of the present invention. M: Maker, molecular marker; C: control, control; W: white light, 1: Ningchun 4; 2: Ningchun 10; 3: Ningchun 34; 4: Ningchun 36; 5: Ningchun 50; 6: Ningchun 55.

[0024] Figure 2 The six spring wheat varieties in Example 1 of the present invention were grown under 22 h light / 2 h dark conditions and a light intensity of 100 μmol m -2 s -1 The wheat species represented by 1 to 6 are the same as those represented by Figure 1 .

[0025] Figure 3 The six spring wheat varieties in Example 1 of the present invention were grown under the conditions of 18 h light / 6 h dark, red:blue=3:1, and light intensity of 100 μmol m - 2 s -1 The growth and development status of wheat varieties represented by 1 to 6 is the same as that of wheat varieties represented by 1 to 6. Figure 1.

[0026] Figure 4 The growth state diagram of 6 kinds of spring wheat in Example 1 of the present invention after being cultured for 52 days under 8 light spectra with a photoperiod of 22h light / 2h dark. The wheat types represented by 1 to 6 are the same. Figure 1 .

[0027] Figure 5 The growth state diagram of 6 kinds of spring wheat in Example 1 of the present invention after being cultured under 8 light spectra with a photoperiod of 18h light / 6h dark for 52 days, and the wheat types represented by 1 to 6 are the same. Figure 1 .

[0028] Figure 6 The following is a comparison chart of the LED light spectra used in Examples 2 to 4 and Comparative Examples 1 to 5.

[0029] Figure 7 This is a growth state diagram of Ningchun 50 wheat when it is cultured to 48 days under different light spectra in Examples 2 to 4 of the present invention and Comparative Examples 1 to 5.

[0030] Figure 8 The results of Example 4 and Comparative Examples 6-7 of the present invention show that under the white light condition of 22 hours of light / 2 hours of darkness, the Ningchun 50 wheat has a photon flux density of 100 μmol m -2 s -1 , 200 μmol m -2 s -1 and 300 μmol m -2 s -1 The growth status of the wheat plants was cultured for 28, 34 and 60 days, and the statistical data of plant height, stem diameter, ear length and number of grains per ear at 60 days under different light intensities were obtained. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0033] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the art or according to the product instructions.

[0034] Embodiment 1:

[0035] Accelerated growth and development of spring wheat materials with different photoperiod sensitivity alleles under the same light conditions:

[0036] (1) Ppd-D1 genotype detection:

[0037] First, the photoperiod-1 (Ppd-D1) molecular marker was used to identify and analyze the photoperiod-sensitive genes of the tested spring wheat materials. The specific operations are as follows:

[0038] The following primer sequences were designed and commissioned to be synthesized by Shanghai Sangon Biotechnology Co., Ltd.:

[0039] Ppd-D1_F:ACGCCTCCCACTACACTG

[0040] Ppd-D1_R1:GTTGGTTCAAACAGAGAGC

[0041] Ppd-D1_R2:CACTGGTGGTAGCTGAGATT

[0042] The genomic DNA samples of the tested spring wheat materials were extracted, including Ningchun 4, Ningchun 10, Ningchun 34, Ningchun 36, Ningchun 50, Ningchun 55 and other varieties. The three-primer method was used for PCR amplification, and the amplified products were detected by gel electrophoresis. The experimental results showed that the electrophoresis patterns of Ningchun 4, Ningchun 50 and Ningchun 55 were short bands of 288 bp, indicating that these varieties belonged to photoperiod-insensitive wheat; while Ningchun 10, Ningchun 34 and Ningchun 36 showed long bands of 414 bp, indicating that they were photoperiod-sensitive wheat (such as Figure 1 shown).

[0043] (2) Growth and development process of two types of wheat varieties under the same light conditions:

[0044] Six spring wheat varieties were planted in the same plug tray, with 15 plants of each variety. The growth period was determined when more than half of the plants reached that growth stage. Under the same light conditions in the accelerated culture room, the growth and development speed of photoperiod-insensitive wheat was significantly faster than that of photoperiod-sensitive wheat. The specific performance is as follows:

[0045] Under the white light condition of 22 h light / 2 h dark, 12 plants of Ningchun 4, Ningchun 50 and Ningchun 55 were close to the booting stage after 25 days of cultivation, while the photoperiod-sensitive varieties Ningchun 10, Ningchun 34 and Ningchun 36 were only at the jointing stage (e.g. Figure 2 shown).

[0046] Under the conditions of 18-hour light / 6-hour dark photoperiod and red:blue ratio of 3:1, after 52 days of cultivation, Ningchun 4, Ningchun 50 and Ningchun 55 basically all entered the heading stage, while Ningchun 10, Ningchun 34 and Ningchun 36 were still in the jointing stage (e.g. Figure 3 shown).

[0047] Based on the experimental results, in order to speed up the experimental process, subsequent experiments can select Ningchun 4, Ningchun 50, and Ningchun 55, spring wheat varieties with faster growth and development and insensitive to light periods, as experimental subjects.

[0048] The growth status of the above six spring wheats cultivated under eight light spectrums with a photoperiod of 22h light / 2h dark for 52 days is shown in the figure below. Figure 4 As shown in the figure, the growth status of 6 varieties of spring wheat cultivated under 8 light spectrums with a photoperiod of 18h light / 6h dark for 52 days is shown in the figure Figure 5 (8 different spectra: pure red light (R), pure blue light (B), white light (W), and 5 composite spectra composed of red light and blue light in different proportions, namely R:B = 1:1 (1R1B), R:B = 3:1 (3R1B), R:B = 5:1 (5R1B), R:B = 1:3 (1R3B), R:B = 1:5 (1R5B).

[0049] The experimental results show that under the conditions of 22 hours of light / 2 hours of darkness, the growth and development rate of wheat is significantly accelerated.

[0050] Embodiment 2:

[0051] This example specifically uses Ningchun 50 for research. A long photoperiod of 22 hours of light / 2 hours of darkness is selected as the standard light condition.

[0052] A cultivation method for promoting rapid growth and development of spring wheat comprises the following steps:

[0053] (1) Seed pretreatment: Select full and uniform-sized Ningchun No. 50 spring wheat seeds and disinfect them (specifically, disinfect them with 72% (v / v) ethanol for 20 seconds, then disinfect them with 5.6% (v / v) sodium hypochlorite solution for 4 minutes, and finally wash them with pure water for 4 times); place the disinfected seeds in a culture dish filled with wet filter paper and culture them until the seeds turn white; the spring wheat is photoperiod-insensitive spring wheat;

[0054] (2) Planting and cultivation: Transplant the white wheat seeds into seedling trays (the soil in the seedling trays is a mixture of nutrient soil: vermiculite: perlite = 3.6:2.8:1.4 by volume), randomly select 15 plants and move them to a culture room with a long light cycle (22 hours of light / 2 hours of darkness) and culture them until they are mature and harvested; the culture room is illuminated by LED light; the LED light is a composite light composed of red light (R) and blue light (B) in a light quantum ratio of 3:1 (denoted as 3R1B); the spectral range of red light is 620-750nm; the spectral range of blue light is 410-490nm. The light intensity is 300μmol m -2 s -1 , the ambient temperature in the culture room was 25.3°C, the air humidity was 67.2%, and the carbon dioxide concentration was 540ppm.

[0055] (The light intensity refers to the photon flux density in the vertical space between the soil surface and the LED light source; the growth period is determined when more than half (i.e. 8 plants or more) reach this growth stage)

[0056] Embodiment 3:

[0057] The difference between this embodiment and embodiment 2 is that the LED light is blue light (B) with a spectrum range of 410-490 nm, and the rest is the same as embodiment 2.

[0058] Embodiment 4:

[0059] The difference between this embodiment and embodiment 2 is that the LED light is white light (W) with a spectrum range of 400 to 780 nm, and the rest is the same as embodiment 2.

[0060] Embodiment 5:

[0061] The difference between this embodiment and embodiment 2 is that the long photoperiod is (18 hours of light / 6 hours of darkness), and the rest is the same as embodiment 2.

[0062] Embodiment 6:

[0063] The difference between this embodiment and embodiment 4 is that the light intensity is 250 μmol m -2 s -1 , the rest is the same as Example 4.

[0064] Embodiment 7:

[0065] The difference between this embodiment and embodiment 4 is that the light intensity is 350 μmol m -2 s -1 , the rest is the same as Example 4.

[0066] Embodiment 8:

[0067] The difference between this embodiment and embodiment 2 is that the ambient temperature of the culture room is 22° C., the air humidity is 80%, the carbon dioxide concentration is 460 ppm, and the rest is the same as embodiment 2.

[0068] Embodiment 9:

[0069] The difference between this embodiment and embodiment 2 is that the ambient temperature of the culture room is 28°C and the air humidity is 46%.

[0070] The carbon dioxide concentration is 880 ppm, and the rest is the same as in Example 2.

[0071] Embodiment 10:

[0072] The difference between this embodiment and embodiment 2 is that: the cultivation process in step (2) also includes irrigation with 48% (v / v) Hoagland's standard nutrient solution once a week with an irrigation volume of 2 L.

[0073] Comparative Example 1:

[0074] The difference between this comparative example and Example 1 is that the ratio of red light (R) to blue light (B) is 1:1 (denoted as 1R1B), and the rest is the same as Example 1.

[0075] Comparative Example 2:

[0076] The difference between this comparative example and Example 1 is that the ratio of red light (R) to blue light (B) is 5:1 (denoted as 5R1B), and the rest is the same as Example 1.

[0077] Comparative Example 3:

[0078] The difference between this comparative example and Example 1 is that the LED light is red light (R), the spectrum of the red light is in the range of 620 to 750 nm, and the rest is the same as Example 1.

[0079] Comparative Example 4:

[0080] The difference between this comparative example and Example 1 is that the ratio of red light (R) to blue light (B) is 1:3 (denoted as 1R3B), and the rest is the same as Example 1.

[0081] Comparative Example 5:

[0082] The difference between this comparative example and Example 1 is that the ratio of red light (R) to blue light (B) is 1:5 (denoted as 1R5B), and the rest is the same as Example 1.

[0083] Comparative Example 6:

[0084] The difference between this comparative example and Example 4 is that the light intensity is 100 μmol m -2 s -1 , the rest is the same as Example 4.

[0085] Comparative Example 7:

[0086] The difference between this comparative example and Example 4 is that the light intensity is 200 μmol m -2 s -1 , the rest is the same as Example 4.

[0087] Comparative Example 8:

[0088] The difference between this comparative example and Example 4 is that the light intensity is 400 μmol m -2 s -1 , the rest is the same as Example 4.

[0089] The comparison of the LED light spectra used in Examples 2 to 4 and Comparative Examples 1 to 5 is shown in the figure below: Figure 6 shown.

[0090] Results: After 48 days of cultivation, the growth and development of Ningchun 50 wheat under different light quality conditions showed significant differences. Under the white light (W) of Example 4 and the blue light (B) of Example 3, Ningchun 50 had completed grain filling and entered the grain dough stage, which was the spectral condition with the fastest growth process; secondly, the faster growth process was in the post-flowering stage under the conditions of Example 2 (3R1B), and the grains began to fill.

[0091] In contrast, the wheat under the light quality conditions of Comparative Example 1 (1R1B), Comparative Example 2 (5R1B), and Comparative Example 3 (R) was still in the heading stage. Under the light quality conditions of Comparative Example 4 (1R3B), the wheat was only in the heading stage, and under the light quality conditions of Comparative Example 5 (1R5B), it was still in the jointing stage, with the initial spikelet formation (such as Figure 7 shown).

[0092] The comparison of wheat growth conditions under different light intensities between Example 4 and Comparative Examples 6-7 is shown in the figure below: Figure 8 shown.

[0093] Results: With the increase of light intensity, the growth rate of Ningchun 50 wheat was significantly accelerated, and the stem diameter, ear length and number of grains per ear also increased. -2 s -1 ) light intensity, Ningchun 50 basically completed grain filling on the 60th day and reached a mature state ready for harvest. Its growth performance was significantly better than that of comparative example 6 (100 μmol m -2 s -1 ) and Comparative Example 7 (200 μmol m -2 s -1 ) light intensity. In Comparative Example 8 (400 μmol m -2 s -1) light intensity, Ningchun 50 showed yellow leaves in the vegetative stage, showing obvious signs of stress. Therefore, the applicant team used 400 μmol m -2 s -1 Light intensity is not used as a light intensity condition for the accelerated cultivation of Ningchun 50 wheat.

[0094] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A cultivation method for promoting rapid growth and development of spring wheat, characterized in that: The following steps are involved: (1) Seed pretreatment: Select full and uniform-sized spring wheat seeds and disinfect them; Placing the sterilized seeds in a culture dish filled with wet filter paper and culturing until the seeds turn white; the spring wheat is photoperiod-insensitive spring wheat; (2) Planting and soil culture: Transplant the white wheat seeds into seedling trays, move them to a culture room with a long light period, and culture them until they are mature and harvested; the culture room is illuminated by LED light; the LED light is a composite light of blue light, white light or red light: blue light = 3:1; the ambient temperature of the culture room is 22-28°C, the air humidity is 46-80%, and the carbon dioxide concentration is 460-880ppm.

2. The cultivation method according to claim 1, characterized in that The photoperiod-insensitive spring wheat is specifically selected from any one of Ningchun 4, Ningchun 50 and Ningchun 55.

3. The cultivation method according to claim 1, characterized in that In step (2), the spectrum range of blue light is 410-490nm, the spectrum range of white light is 400-780nm; and the spectrum range of red light is 620-750nm.

4. The cultivation method according to claim 1, characterized in that In step (2), the long photoperiod specifically refers to a photoperiod of 18 to 22 hours of light / 2 to 6 hours of darkness.

5. The cultivation method according to claim 4, characterized in that: In step (2), the long photoperiod specifically refers to 22 hours of light / 2 hours of darkness.

6. The cultivation method according to claim 1, characterized in that: In step (2), the light intensity is controlled at 250-350 μmol m -2 s -1 .

7. The cultivation method according to claim 6, characterized in that: In step (2), the light intensity was controlled at 300 μmol / m -2 s -1 .

8. The cultivation method according to claim 1, characterized in that: In step (2), the ambient temperature in the culture room is 25.3° C., the air humidity is 67.2%, and the carbon dioxide concentration is 540 ppm.

9. The cultivation method according to claim 1, characterized in that: In step (2), the soil in the seedling hole tray is a mixture of nutrient soil: vermiculite: perlite = 3.6:2.8:1.4 in volume ratio.

10. The cultivation method according to claim 1, characterized in that: The cultivation process of step (2) also includes irrigating with 43-52% (v / v) Hoagland's standard nutrient solution once a week with an irrigation volume of 1-3 L.

Images