Human lung cancer fibroblast stably transfected strain for knocking down PTPN11 and construction method thereof

Abstract

The invention discloses a human lung cancer fibroblast stably transfected strain for knocking down PTPN11 and a construction method thereof. The construction method comprises the following steps: obtaining an in-vitro human lung cancer tissue operation specimen, and dissociating primary lung cancer tissue; carrying out digestion separation and purification to obtain primary human lung cancer fibroblasts; inoculating into a 24-pore plate for subculture, and transfecting human lung cancer fibroblasts with lentivirus containing PTPN11 target gene fragments according to the use amount of MOI 50; puromycin with the concentration of 4.0 mu g / mL is used for screening the transfected human lung cancer fibroblast to obtain a human lung cancer fibroblast stable transfected strain with PTPN11 knocked down, and the preservation number of the human lung cancer fibroblast stable transfected strain is GDMCC No: 64707. Compared with the prior art, the human lung cancer fibroblast stable transfection strain knocking down PTPN11 can be rapidly and efficiently constructed, and the human lung cancer fibroblast stable transfection strain can be applied to models of PTPN11 genes of fibroblasts in a lung cancer tumor microenvironment and downstream signal channels of the PTPN11 genes and basic and clinical researches of malignant clone evolution, pathogenesis, drug resistance mechanisms and biological targeted drugs.

Description

Technical Field

[0001] The present invention relates to the technical field of cell engineering, and in particular to a PTPN11 knocked-down human lung cancer fibroblast stable transfection strain and a construction method thereof. Background Art

[0002] Lung cancer is one of the most common cancers worldwide, and its treatment still faces major challenges. The microenvironment of lung cancer plays an important role in tumor development and treatment, among which fibroblasts play a key role. Fibroblasts are a type of cell that mainly exists in connective tissue. They are involved in regulating the extracellular matrix, maintaining tissue structure and regulating immune responses.

[0003] PTPN11 is a gene encoding a protein tyrosine phosphatase that plays a key role in multiple signaling pathways, including growth factor receptor signaling pathways. The abnormal activity of PTPN11 in tumors has been widely studied, and it may be associated with tumor growth, proliferation, and invasion. However, the exact role of PTPN11 as a regulatory factor in lung cancer and its impact on fibroblast function are still unclear.

[0004] Cancer-associated fibroblasts play an important role in the occurrence and development of tumors. PTPN11 plays a key role in multiple signaling pathways. Currently, there is no method to construct fibroblast PTPN11 knockdown stable lines derived from lung cancer patient tissues. Therefore, establishing human lung cancer-associated fibroblast PTPN11 knockdown stable lines can help us understand how the lung cancer-associated fibroblast PTPN11 gene perturbs downstream signaling pathways, helping us understand its specific role in tumor growth and microenvironment, and how it affects the development of lung cancer.

[0005] However, it is difficult to knock out the PTPN11 gene in human lung cancer-associated fibroblasts for the following reasons: 1) The PTPN11 gene and the PTPN6 gene are highly homologous, and off-target effects are likely to occur when the PTPN11 gene is targeted for inhibition, which may lead to the inhibition of PTPN6 or the simultaneous inhibition of PTPN11 and PTPN6.

[0006] 2) The PTPN11 gene is highly conserved in many species, meaning that its sequence has changed little during evolution. This high degree of conservation makes it difficult to design specific shRNA.

[0007] 3) Primary cells may have a higher proportion of cells in the G0 phase (quiescent phase), which makes them less sensitive to transfection.

[0008] 4) Primary cells may be more sensitive to transfection reagents, and the toxicity of transfection reagents may cause cell death or damage, making it difficult to knock down. Summary of the invention

[0009] In order to solve the above technical problems, the present invention provides a PTPN11 knockdown human lung cancer fibroblast stable cell line and a construction method thereof.

[0010] To achieve the above object, the present invention is implemented according to the following technical solutions: One of the purposes of the present invention is to provide a stable human lung cancer fibroblast cell line with PTPN11 knockdown, which is named H358-shPTPN11, and was deposited in the Guangdong Provincial Microbiological Culture Collection Center on May 30, 2024, with a collection number of GDMCCNo: 64707, and the collection address is 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou.

[0011] The second object of the present invention is to provide a method for constructing a stable human lung cancer fibroblast cell line with knockdown of PTPN11, comprising the following steps: S1. Obtain an ex vivo human lung cancer tissue surgical specimen and quickly transfer it to a 50 mL centrifuge tube containing 5 mL of 4°C pre-cooled adDMEM / F12+++ medium, ensuring that the liquid level covers the human lung cancer tissue surgical specimen. Place the centrifuge tube on ice and transfer it to the laboratory to dissociate the primary lung cancer tissue to obtain a single cell suspension of lung cancer tissue that can be used for culture. S2, culturing single cell suspension of lung cancer tissue, digesting, separating and purifying to obtain primary human lung cancer fibroblasts; S3, after primary human lung cancer fibroblasts were inoculated into 24-well plates for subculture, the lentivirus containing the target gene fragment of PTPN11 was transfected into the human lung cancer fibroblasts at an MOI of 50 to obtain human lung cancer fibroblasts into which the target gene PTPN11 was inserted; S4. The transfected human lung cancer fibroblasts were screened with puromycin at a concentration of 4.0 ug / mL to obtain a stable human lung cancer fibroblast cell line with PTPN11 knockdown.

[0012] Furthermore, in step S1, the dissociation of primary lung cancer tissue includes: (1) Tissue washing: transfer the centrifuge tube containing lung cancer tissue into the biosafety cabinet, use sterile forceps that have been sterilized in advance to transfer the lung cancer tissue to a culture dish with a diameter of 10 cm, rinse the tissue block with 1 mL of PBS solution and discard it into the waste tank, and repeat the washing three times; (2) Trimming lung cancer tissue: Add 1 mL of DMEM solution to the culture dish to keep the tissue moist at all times. Use sterile scissors to cut off the part of the lung cancer tissue close to the normal tissue and remove the part that was burned and necrotic during the operation. (3) Mincing tissue: Use sterile scissors to repeatedly mince the tissue into small pieces with a diameter of less than 1 mm within 5 minutes. The tissue should resemble minced meat after mincing. (4) Tissue dissociation: Tissue dissociation is performed using a human tumor tissue dissociation kit; the human tumor tissue dissociation kit contains Enzyme H, Enzyme A, and Enzyme R; ① Add 3.675 mL of DMEM solution to the culture dish containing the tissue and transfer to the gentleMACS C Tube using a Pasteur pipette; ② Add 200ul of Enzyme H, 100ul of Enzyme R, and 25ul of Enzyme A to the gentleMACS C Tube to make the total volume of the solution 5mL; ③ Place the gentleMACS C Tube into the gentleMACS Dissociator, set the mode to "h_tumor_02" and start the program. After the program runs for about 37 seconds, transfer the gentleMACS C Tube to the constant temperature oscillator and incubate at 37°C for 30 minutes. ④Repeat step ③; ⑤Put the gentleMACS C Tube into the gentleMACS Dissociator, set the mode to "h_tumor_02" and start the program. The program will run for about 37 seconds and then stop. ⑥ Add 15 mL of DMEM solution to the gentleMACS C Tube, place a cell filter with a pore diameter of 100 um on the mouth of a 50 mL centrifuge tube, and use a Pasteur pipette to transfer the tissue cell suspension in the gentleMACS C Tube to the centrifuge tube. The incompletely digested tissue is intercepted by the filter, and a single cell suspension of lung cancer tissue is obtained.

[0013] Furthermore, the step S2 comprises: S21, removing red blood cells: centrifuge the obtained 20 mL lung cancer tissue single cell suspension at 300g centrifugal force for 7 minutes, discard the supernatant, resuspend the cells with 4 mL of DMEM solution, add 4 mL of human lymphocyte separation solution to a 15 mL centrifuge tube, slowly add 4 mL of cell suspension to the upper layer of human lymphocyte separation solution, and centrifuge at 2000 rpm for 15 minutes, set the centrifuge speed to 1 gear to increase and 0 gear to decrease; after centrifugation, the cell layers from bottom to top are red blood cells, human lymphocyte separation solution, non-red blood cell layer, and DMEM solution; S22. Cell culture: Aspirate the non-red blood cell layer into a 15 mL centrifuge tube, add 5 mL of PBS solution to wash thoroughly, centrifuge at 200 g for 3 min, discard the supernatant, resuspend the cells with 5 mL of PneumaCult-Ex Plus Medium, transfer the cell suspension to a T25 culture flask, and culture in a 37°C constant temperature incubator; S23. Cell preparation: When the primary cells dissociated from lung cancer tissue adhere to the wall of the culture flask and proliferate to about 70%-80% of the culture surface area, move them into the biosafety cabinet; S24, washing: after discarding the culture medium, wash once with 1 mL of PBS solution; S25, digestion: add 2 mL of TrypLE Express solution and incubate in a CO2 incubator at 37°C for 3 min; S26. Terminate digestion: transfer the liquid in the T25 bottle to a 15 mL centrifuge tube, and add 2 mL of DMEM medium containing 10% serum to the centrifuge tube to terminate digestion; S27, centrifugation: 800 rpm, 3 min, discard the supernatant; S28, washing: add 1 mL PBS to the centrifuge tube for washing, centrifuge at 800 rpm for 3 min, and discard the supernatant; S29. Resuspend the cell pellet and culture: resuspend in 1 mL of DMEM high-glucose medium containing 10% FBS and transfer to a T25 culture flask for culture to obtain primary human lung cancer fibroblasts.

[0014] Furthermore, the step S3 comprises: S31. Cell preparation: Inoculate primary human lung cancer fibroblasts in a 24-well plate until the well confluence reaches 80%; S32, adding lentivirus: take out the lentivirus from the refrigerator and slowly melt it on ice, remove the original cell culture medium, add 250uL DMEM culture medium containing 10% serum, add the lentivirus stock solution to the cells with an MOI of 3-100, mix gently, add polybrene to make the final concentration of polybrene 5ug / mL; after 4h, add 50uL DMEM culture medium containing 10% serum; S33, medium change: 24 hours after infection, remove the culture medium containing lentivirus, replace with fresh complete culture medium, and continue to culture at 37°C; S34. Observation: 48 h after infection, the GFP expression efficiency was preliminarily observed by fluorescence microscopy; S35. Subculture and amplification: The cells are continued to be subcultured and amplified until the fullness of the six-well plate reaches more than 95%, thereby obtaining human lung cancer fibroblasts inserted with the target gene PTPN11.

[0015] Furthermore, the step S4 comprises: Human lung cancer fibroblasts not infected with lentivirus were taken and puromycin at a concentration of 4.0 ug / mL was added, which was recorded as the control group NC; human lung cancer fibroblasts inserted with the target gene PTPN11 and amplified to more than 95% of the fullness of the six-well plate were taken, and puromycin at a concentration of 4.0 ug / mL was added as the transfected lentivirus group; the death of human lung cancer fibroblasts in the control group NC was observed after adding the drug for 48 hours. If the death rate of human lung cancer fibroblasts in the control group NC reached more than 90%, the puromycin in the transfected lentivirus group was removed and replaced with fresh culture medium to obtain a stable human lung cancer fibroblast cell line with knockdown of PTPN11.

[0016] Preferably, the dosage of the lentivirus is MOI 50.

[0017] Preferably, the concentration of puromycin is 4.0 ug / mL.

[0018] Compared with the prior art, the present invention can quickly and efficiently construct a stable human lung cancer fibroblast cell line with knockdown of PTPN11, which can be applied to the model of PTPN11 gene and its downstream signaling pathway of fibroblasts in the tumor microenvironment of lung cancer and the basic and clinical research of malignant clone evolution, pathogenesis, drug resistance mechanism and biological targeted drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is an image of fibroblasts isolated and purified from lung cancer tissue of L26 patient (10x).

[0020] Figure 2 Fluorescence images 72 hours after L31 fibroblasts were infected with lentivirus MOI for screening: A, MOI 3; B, MOI 10; C, MOI 30; D, MOI 50; E, MOI 100.

[0021] Figure 3 The following are cell images of L26 fibroblasts infected with lentivirus and treated with different concentrations of puromycin 48 hours later: A, 0.5 ug / mL puromycin treatment; B, 1.0 ug / mL puromycin treatment; C, 2.0 ug / mL puromycin treatment; D, 3.0 ug / mL puromycin treatment; E, 4.0 ug / mL puromycin treatment; F, 5.0 ug / mL puromycin treatment.

[0022] Figure 4 Fluorescence quantitative PCR was used to detect the expression level of PTPN11 in cell lines.

[0023] Figure 5This is a stable L26 fibroblast cell line with PTPN11 knockdown (10x).

[0024] Figure 6 This is the map of the pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0026] Unless otherwise specified, the raw materials and reagents used in the following examples were commercially available.

[0027] Preparation of adDMEM / F12+++ solution: Add penicillin-streptomycin (Gibco, #15140122), HEPES solution (R&D Systems, #B35110), GlutaMAX solution (Gibco, #35050061), and Y27632 solution (MedChemExpress, #HY-10071) to Advanced DMEM / F12 (Gibco, #12634010) to obtain adDMEM / F12+++ solution with Advanced DMEM / F12 as the basal medium and containing 100 U / mL penicillin-streptomycin solution, 10 mM HEPES solution, lx (vol / vol) GlutaMAX solution, and 5 μM Y27632 solution; Glutamax is a stable glutamine substitute used to prevent ammonia toxicity in cell culture; HEPES is a buffer used to maintain the pH stability of the culture medium; Y27632 is a rock Inhibitor can inhibit cell apoptosis and keep cells in a better active state.

[0028] Example 1: Construction of a stable human lung cancer fibroblast cell line with knockdown of PTPN11 (1) Obtain surgical specimens of lung cancer tissue from L26 lung cancer patients in vitro and transfer them on ice: After the surgical specimens of lung cancer tissue are isolated, quickly transfer the lung cancer tissue to a 50 mL centrifuge tube containing 5 mL of 4°C pre-cooled adDMEM / F12+++ solution, ensuring that the liquid level covers the tissue, and place the centrifuge tube on ice and transfer it to the laboratory.

[0029] (2) Dissociation of primary tumor tissue: Ⅰ. Rinse tissue: Transfer the centrifuge tube containing lung cancer tissue into the biosafety cabinet, use sterile tweezers that have been sterilized in advance to transfer the lung cancer tissue to a 10 cm diameter culture dish (NEST, #704202), use 1 mL of PBS solution (Gibco, #C10010500BT) to rinse the tissue block and discard it into the waste tank, and repeat the washing three times.

[0030] Ⅱ. Trimming lung cancer tissue: Add 1 mL of DMEM solution (Gibco, #C11965500BT) to the culture dish to keep the tissue moist at all times. Use sterile scissors to cut off the part of the lung cancer tissue close to the normal tissue, and remove the part that was burned and necrotic during the operation. Keep about 1 g of the lung cancer lesion tissue with the best activity, tough touch, and white color.

[0031] III. Cut the tissue into pieces: Use sterile scissors to repeatedly cut the lung cancer tissue into small pieces with a diameter of less than 1 mm within 5 minutes. The pieces should be minced meat-like and should be completed in the shortest possible time to ensure cell activity.

[0032] IV. Tissue dissociation: Human tumor tissue dissociation kit (Miltenyi, #130-095-929) contains Enzyme H, Enzyme A, and Enzyme R.

[0033] ① Add 3.675 mL of DMEM solution to the culture dish containing lung cancer tissue and transfer to gentleMACS C Tube (Miltenyi, #130-093-237) using a Pasteur pipette (NEST, #318314); ② Add 200ul Enzyme H, 100ul Enzyme R, and 25ul Enzyme A to the gentleMACS C Tube to make the total volume of the solution 5mL; ③ Place the gentleMACS C Tube into the gentleMACS Dissociator (Miltenyi, #130-093-235), set the mode to "h_tumor_02" and start the program. After the program runs for about 37 seconds, transfer the gentleMACS C Tube to the constant temperature oscillator and incubate at 37°C for 30 minutes. ④Repeat step ③; ⑤ Place the gentleMACS C Tube into the gentleMACS Dissociator (Miltenyi, #130-093-235), set the mode to "h_tumor_02" and start the program. The program runs for about 37 seconds and then stops. ⑥ Add 15 mL of DMEM solution to the gentleMACS C Tube, place a cell filter with a pore diameter of 100 μm (Thermo Fisher, #T_70122363549) on the mouth of a 50 mL centrifuge tube, and use a Pasteur pipette to transfer the tissue cell suspension in the gentleMACS C Tube to the centrifuge tube. The incompletely digested tissue is intercepted by the filter, thus obtaining a single cell suspension; Ⅴ. Remove red blood cells: Centrifuge the obtained 20mL single cell suspension (300g, 7min), discard the supernatant, resuspend the cells with 4mL DMEM solution, add 4mL human lymphocyte separation solution (Cytiva, #17144003) to a 15mL centrifuge tube, slowly add 4mL cell suspension to the upper layer of human lymphocyte separation solution and centrifuge (2000rpm, 15min), set the centrifuge speed to 1 gear to increase and 0 gear to decrease, to avoid poor stratification caused by too fast speed changes. After centrifugation, the cell layers from bottom to top are red blood cells, human lymphocyte separation solution, non-red blood cell layer, DMEM solution; VI. Cell culture: Aspirate the non-red blood cell layer into a 15 mL centrifuge tube, add 5 mL of PBS solution to wash thoroughly, centrifuge (200 g, 3 min), discard the supernatant, and resuspend the cells in 5 mL of PneumaCult-Ex Plus Medium (Stemcell, #05040). Transfer the cell suspension to a T25 culture flask (Thermo Fisher, #156367) and culture in a 37°C constant temperature incubator.

[0034] (4) Fibroblast separation: Because fibroblasts and epithelial cells have different tolerance to trypsin, under the action of trypsin, fibroblasts detach from the wall first, while epithelial cells take a long time to digest before detaching from the wall. Therefore, differential digestion methods can be used to separate epithelial cells and fibroblasts.

[0035] Ⅰ. Cell preparation: When the primary cells dissociated from lung cancer tissue adhere to the wall of the culture flask and proliferate to about 70%-80% of the culture surface area, move them into the biosafety cabinet; Ⅱ. Washing: After discarding the culture medium, wash once with 1 mL of PBS solution; III. Digestion: Add 2 mL of TrypLE Express solution (Gibco, #12604021) and incubate in a CO2 incubator at 37°C for 3 min. IV. Terminate digestion: transfer the liquid in the T25 bottle to a 15 mL centrifuge tube, and add 2 mL of DMEM medium containing 10% serum to the centrifuge tube to terminate digestion; Ⅴ. Centrifugation: 800 rpm, 3 min, discard the supernatant; Ⅵ. Washing: Add 1 mL of PBS to the centrifuge tube for washing, centrifuge (800 rpm, 3 min), and discard the supernatant; Ⅶ. Resuspend the cell pellet and culture: Use 1mL DMEM high-glucose medium containing 10% FBS to resuspend and transfer to T25 culture flask for culture to obtain primary human lung cancer fibroblasts. The fibroblasts after isolation and purification from lung cancer tissue of L26 patient are shown in Figure (10x) as follows Figure 1 shown.

[0036] (5) Lentiviral transfection: Ⅰ. Cell preparation: Inoculate primary human lung cancer fibroblasts in a 24-well plate until the well concentration reaches 80%; II. Add lentivirus: Take out the lentivirus from the refrigerator and slowly thaw it on ice. The lentivirus used in this example is a customized lentivirus for human PTPN11 gene interference, provided by Hanheng Biotechnology. The interference vector selected for the lentivirus is pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector. The pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector map is shown in 6. The control virus vector siRNA sequence and shRNA sequence are as follows: siRNA sequence: TTCTCCGAACGTGTCACGTAA; shRNA sequences: Top strand:GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC Bottom strand: AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG siRNA sequences and shRNA sequences targeting the target gene PTPN11: siRNA1 sequence: CGGTTTGATTCTTTGACAGAT; shRNA1 sequence: Top strand: GATCCGCGGTTTGATTCTTTGACAGATGTTAATATTCATAGCATCTGTCAAAGAATCAAACCGTTTTTTG Bottom strand: AATTCAAAAAACGGTTTGATTCTTTGACAGATGCTATGAATATTAACATCTGTCAAAGAATCAAACCGCG.

[0037] Remove the original culture medium of primary human lung cancer fibroblasts, add 250uL DMEM culture medium containing 10% serum, add the lentivirus stock solution to the cells with a lentivirus dosage of MOI 50, mix gently, add polybrene to make the final concentration of polybrene 5ug / mL. After 4h, add 50uL DMEM culture medium containing 10% serum; III. Medium change: On the second day after infection (about 24 h), remove the culture medium containing lentivirus and replace it with fresh complete culture medium, and continue to culture at 37°C; IV. Observation: 48 hours after infection, the GFP expression efficiency can be preliminarily observed by fluorescence microscopy. Generally, the expression peak is reached 72 hours after infection. V. Subculture and amplification: The cells are continued to be subcultured and amplified until the fullness of the six-well plate reaches more than 95%, and human lung cancer fibroblasts with the target gene PTPN11 inserted are obtained.

[0038] (6) Puromycin screening: Since the virus carries puromycin resistance, cancer-associated fibroblasts also have puromycin resistance after being infected with the lentivirus. Therefore, puromycin purification can be used to obtain PTPN11 knockdown cells.

[0039] During screening, human lung cancer fibroblasts that were not infected with lentivirus were taken, and puromycin at a concentration of 4.0 ug / mL was added, which was recorded as the control group NC; human lung cancer fibroblasts inserted with the target gene PTPN11 and amplified to more than 95% of the fullness of the six-well plate were taken, and puromycin at a concentration of 4.0 ug / mL was added as the transfected lentivirus group; the death of human lung cancer fibroblasts in the control group NC was observed after adding the drug for 48 hours. If the mortality rate of human lung cancer fibroblasts in the control group NC reached more than 90%, the puromycin in the transfected lentivirus group was removed and replaced with fresh culture medium for culture, and a stable human lung cancer fibroblast cell line with knockdown of PTPN11 was obtained, which was named H358-shPTPN11 and deposited in Guangdong Microbiological Culture Collection Center on May 30, 2024, with the deposit number GDMCC No: 64707. The results of fluorescence quantitative PCR showed that the expression of PTPN11 in the fibroblasts stably transfected with lentivirus selected by 4.0 ug / mL puromycin was significantly lower than that in the control group of lentivirus-transfected L26 fibroblasts (see Figure 4 ); The final screened L26 fibroblast PTPN11 knockdown stable cell line (10x) is as follows Figure 5As shown. It can be seen that this embodiment successfully constructed a stable transformant with PTPN11 knockdown. In this embodiment, fibroblasts were transfected by lentivirus assembled by plasmids. The genome of the lentivirus can be integrated into the genome of the host cell. Due to the integration of the viral genome, the carried plasmid can be stably expressed in the cell for a long time. This allows the effect of gene knockdown or editing to persist, even during cell passage. A plasmid is a small, usually circular DNA molecule that can exist independently of chromosomal DNA in the cell and can replicate itself, which allows the plasmid to replicate itself during cell division, ensuring that each daughter cell can obtain a copy of the plasmid; therefore, these cell lines can always maintain the PTPN11 knockdown state, providing a stable tool for research. In contrast, some existing technologies such as SiRNA may only achieve short-term gene knockdown effects. The construction of a stable PTPN11 knockdown cell line allows long-term research and experiments without having to frequently re-transfect cells. This stability is very important for long-term research and experiments, especially considering the instability and variability of cell passage. The construction of stable transformants also helps to accurately track the long-term effects of PTPN11 knockdown on cell behaviors and signaling pathways.

[0040] Comparative Example 1 The difference from Example 1 is that the dosage of lentivirus is MOI 3.

[0041] Comparative Example 2 The difference from Example 1 is that the dosage of lentivirus is MOI 10.

[0042] Comparative Example 3 The difference from Example 1 is that the dosage of lentivirus is MOI 30.

[0043] Comparative Example 4 The difference from Example 1 is that the amount of lentivirus used is MOI 100.

[0044] Effects of different doses of lentivirus infection on L26 fibroblasts Figure 2 As shown by Figure 2 It can be seen that the efficiency of infecting L26 primary fibroblasts is optimal when the lentivirus dosage is MOI 50; therefore, the lentivirus dosage in subsequent examples is MOI 50.

[0045] Comparative Example 5 The difference from Example 1 is that the concentration of puromycin is 0.5 ug / mL.

[0046] Comparative Example 6 The difference from Example 1 is that the concentration of puromycin is 1.0 ug / mL.

[0047] Comparative Example 7 The difference from Example 1 is that the concentration of puromycin is 2.0 ug / mL.

[0048] Comparative Example 8 The difference from Example 1 is that the concentration of puromycin is 3.0 ug / mL.

[0049] Comparative Example 9 The difference from Example 1 is that the concentration of puromycin is 5.0 ug / mL.

[0050] The cells were treated with different concentrations of puromycin and infected with lentivirus L26 fibroblasts for 48 hours. Figure 3 As shown in Figure 2, the concentration of puromycin was 4.0 ug / mL, which had the best screening effect on lentivirus-infected L26 primary fibroblasts ( Figure 3 It can be seen from the A, B, C, and D pictures that most of the cells are in an adherent state and still maintain the spindle-shaped morphology of fibroblasts, indicating that puromycin at concentrations of 0.5 ug / mL, 1.0 ug / mL, 2.0 ug / mL, and 3.0 ug / mL did not kill the cells well and did not play a screening role. Figure 3 In E and F, the number of cells in the adherent state is the least, and the cells have lost their original spindle shape and become round, indicating that both 4.0 ug / mL and 5.0 ug / mL of puromycin can kill cells and play a screening role. 4.0 ug / mL and 5.0 ug / mL of puromycin can also achieve the screening effect, so 4.0 ug / mL of puromycin is preferred for subsequent experiments).

[0051] In summary, the present invention quickly and efficiently constructs a method for knocking down PTPN11 in human lung cancer fibroblasts. This method allows researchers to precisely manipulate the expression level of the PTPN11 gene to deeply study its function in fibroblasts and its interaction with the lung cancer microenvironment. This helps to reveal the molecular mechanism of lung cancer development. By constructing a stable transformant with PTPN11 knockdown, the function of PTPN11 in fibroblasts can be studied in detail, including its effects on cell proliferation, signal transduction and immunoregulation. This helps to understand the importance of PTPN11 in the lung cancer microenvironment. Understanding the role of PTPN11 in lung cancer may help to find new therapeutic targets. This can provide new ideas for the development of lung cancer treatment strategies, and is expected to improve the treatment effect of lung cancer patients.

[0052] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A stable human lung cancer fibroblast cell line with knockdown of PTPN11, characterized in that: It was named H358-shPTPN11 and was deposited in the Guangdong Provincial Microbiological Culture Collection Center on May 30, 2024, with the deposit number GDMCC No: 64707.

2. A method for constructing a stable human lung cancer fibroblast cell line knocking down PTPN11 as claimed in claim 1, characterized in that: The following steps are involved: S1. Obtain an ex vivo human lung cancer tissue surgical specimen and quickly transfer it to a 50 mL centrifuge tube containing 5 mL of 4°C pre-cooled adDMEM / F12+++ medium, ensuring that the liquid level covers the human lung cancer tissue surgical specimen. Place the centrifuge tube on ice and transfer it to the laboratory to dissociate the primary lung cancer tissue to obtain a single cell suspension of lung cancer tissue that can be used for culture. S2, culturing single cell suspension of lung cancer tissue, digesting, separating and purifying to obtain primary human lung cancer fibroblasts; S3, after primary human lung cancer fibroblasts were inoculated into 24-well plates for subculture, the lentivirus containing the target gene fragment of PTPN11 was transfected into the human lung cancer fibroblasts at an MOI of 50 to obtain human lung cancer fibroblasts into which the target gene PTPN11 was inserted; S4. The transfected human lung cancer fibroblasts were screened with puromycin at a concentration of 4.0 ug / mL to obtain a stable human lung cancer fibroblast cell line with PTPN11 knockdown.

3. The method for constructing a stable human lung cancer fibroblast cell line with PTPN11 knockdown according to claim 2, characterized in that: In step S1, the dissociation of primary lung cancer tissue includes: (1) Tissue washing: transfer the centrifuge tube containing lung cancer tissue into the biosafety cabinet, use sterile forceps that have been sterilized in advance to transfer the lung cancer tissue to a culture dish with a diameter of 10 cm, rinse the tissue block with 1 mL of PBS solution and discard it into the waste tank, and repeat the washing three times; (2) Trimming lung cancer tissue: Add 1 mL of DMEM solution to the culture dish to keep the tissue moist at all times. Use sterile scissors to cut off the part of the lung cancer tissue close to the normal tissue and remove the part that was burned and necrotic during the operation. (3) Mincing tissue: Use sterile scissors to repeatedly mince the tissue into small pieces with a diameter of less than 1 mm within 5 minutes. The tissue should resemble minced meat after mincing. (4) Tissue dissociation: Tissue dissociation is performed using a human tumor tissue dissociation kit; the human tumor tissue dissociation kit contains Enzyme H, Enzyme A, and Enzyme R; ① Add 3.675 mL of DMEM solution to the culture dish containing the tissue and transfer to the gentleMACSC Tube using a Pasteur pipette; ② Add 200ul of Enzyme H, 100ul of Enzyme R, and 25ul of Enzyme A to the gentleMACS C Tube to make the total volume of the solution 5mL; ③ Place the gentleMACS C Tube into the gentleMACS Dissociator, set the mode to "h_tumor_02" and start the program. After the program runs for 37 seconds, transfer the gentleMACS C Tube to the constant temperature oscillator and incubate at 37°C for 30 minutes. ④Repeat step ③; ⑤Put the gentleMACS C Tube into the gentleMACS Dissociator, set the mode to "h_tumor_02" and start the program. The program stops after running for 37 seconds. ⑥ Add 15 mL of DMEM solution to the gentleMACS C Tube, place a cell filter with a pore diameter of 100 um on the mouth of a 50 mL centrifuge tube, and use a Pasteur pipette to transfer the tissue cell suspension in the gentleMACS C Tube to the centrifuge tube. The incompletely digested tissue is intercepted by the filter, and a single cell suspension of lung cancer tissue is obtained.

4. The method for constructing a stable human lung cancer fibroblast cell line with knockdown of PTPN11 according to claim 2, characterized in that: The step S2 comprises: S21, removing red blood cells: centrifuge the obtained 20 mL lung cancer tissue single cell suspension at 300g centrifugal force for 7 minutes, discard the supernatant, resuspend the cells with 4 mL of DMEM solution, add 4 mL of human lymphocyte separation solution to a 15 mL centrifuge tube, slowly add 4 mL of cell suspension to the upper layer of human lymphocyte separation solution, and centrifuge at 2000 rpm for 15 minutes, set the centrifuge speed to 1 gear to increase and 0 gear to decrease; after centrifugation, the cell layers from bottom to top are red blood cells, human lymphocyte separation solution, non-red blood cell layer, and DMEM solution; S22. Cell culture: Aspirate the non-red blood cell layer into a 15 mL centrifuge tube, add 5 mL of PBS solution to wash thoroughly, centrifuge at 200 g for 3 min, discard the supernatant, resuspend the cells with 5 mL of PneumaCult-Ex Plus Medium, transfer the cell suspension to a T25 culture flask, and culture in a 37°C constant temperature incubator; S23. Cell preparation: When the primary cells dissociated from lung cancer tissue adhere to the wall of the culture flask and proliferate to 70%-80% of the culture surface area, move them into the biosafety cabinet; S24, washing: after discarding the culture medium, wash once with 1 mL of PBS solution; S25, digestion: add 2 mL of TrypLE Express solution and incubate in a CO2 incubator at 37°C for 3 min; S26. Terminate digestion: transfer the liquid in the T25 bottle to a 15 mL centrifuge tube, and add 2 mL of DMEM medium containing 10% serum to the centrifuge tube to terminate digestion; S27, centrifugation: 800 rpm, 3 min, discard the supernatant; S28, washing: add 1 mL of PBS to the centrifuge tube for washing, centrifuge at 800 rpm for 3 min, and discard the supernatant; S29. Resuspend the cell pellet and culture: resuspend in 1 mL of DMEM high-glucose medium containing 10% FBS and transfer to a T25 culture flask for culture to obtain primary human lung cancer fibroblasts.

5. The method for constructing a stable human lung cancer fibroblast cell line with PTPN11 knockdown according to claim 2, characterized in that: The step S3 comprises: S31. Cell preparation: Inoculate primary human lung cancer fibroblasts in a 24-well plate until the well confluence reaches 80%; S32, adding lentivirus: take out the lentivirus from the refrigerator and slowly melt it on ice, remove the original cell culture medium, add 250uL DMEM culture medium containing 10% serum, add the lentivirus stock solution to the cells with an MOI of 3-100, mix gently, add polybrene to make the final concentration of polybrene 5ug / mL; after 4h, add 50uL DMEM culture medium containing 10% serum; S33, medium change: 24 hours after infection, remove the culture medium containing lentivirus, replace with fresh complete culture medium, and continue to culture at 37°C; S34. Observation: 48 h after infection, the GFP expression efficiency was preliminarily observed by fluorescence microscopy; S35. Subculture and amplification: The cells are continued to be subcultured and amplified until the fullness of the six-well plate reaches more than 95%, thereby obtaining human lung cancer fibroblasts inserted with the target gene PTPN11.

6. The method for constructing a stable human lung cancer fibroblast cell line with knockdown of PTPN11 according to claim 5, characterized in that: The step S4 comprises: Human lung cancer fibroblasts not infected with lentivirus were taken and puromycin at a concentration of 4.0 ug / mL was added, which was recorded as the control group NC; human lung cancer fibroblasts inserted with the target gene PTPN11 and amplified to more than 95% of the fullness of the six-well plate were taken, and puromycin at a concentration of 4.0 ug / mL was added as the transfected lentivirus group; the death of human lung cancer fibroblasts in the control group NC was observed after adding the drug for 48 hours. If the death rate of human lung cancer fibroblasts in the control group NC reached more than 90%, the puromycin in the transfected lentivirus group was removed and replaced with fresh culture medium to obtain a stable human lung cancer fibroblast cell line with knockdown of PTPN11.

7. The method for constructing a stable human lung cancer fibroblast cell line with knockdown of PTPN11 according to claim 5, characterized in that: The lentivirus dosage was MOI 50.

8. The method for constructing a stable human lung cancer fibroblast cell line with knockdown of PTPN11 according to claim 6, characterized in that: The concentration of the puromycin is 4.0 ug / mL.

Images