H9N2 avian influenza virus attenuated strain as well as preparation method and application thereof

Abstract

The invention provides an H9N2 avian influenza virus attenuated strain as well as a preparation method and application thereof, and belongs to the technical field of virus attenuation. The invention provides an attenuated strain of an H9N2 type avian influenza virus. The attenuated strain is obtained by modifying an M2 gene; the modification comprises the following steps: carrying out synonymous mutation on overlapped genes for coding the M1 protein and the M2 protein, replacing adjacent genes subjected to synonymous mutation with genes for coding termination codons, and carrying out deletion mutation on intracellular structural domain genes for coding the M2 protein. The H9N2 type avian influenza virus attenuated strain disclosed by the invention can be used for preparing an H9N2 type avian influenza virus attenuated vaccine. After chickens are immunized with the H9N2 avian influenza virus attenuated vaccine, a high-level hemagglutination inhibition antibody can be induced, no toxin is expelled after the chickens are immunized, safety is high, potential harm to the environment is avoided, and a new strategy is provided for prevention and control of H9N2 avian influenza.

Description

Technical Field

[0001] The invention belongs to the technical field of virus attenuation, and in particular relates to an attenuated strain of H9N2 avian influenza virus and a preparation method and application thereof. Background Art

[0002] The H9N2 subtype avian influenza virus is a low pathogenic avian influenza virus. When chickens are infected with the H9N2 virus, the eggs will have irregular shapes, thin eggshells, and embryonic death, which will cause weight loss, respiratory distress, diarrhea, and reduced egg production in the flock. In addition, H9N2 is a zoonotic pathogen. The H9N2 virus can rearrange or recombinant genes with other influenza viruses, increasing the possibility of avian influenza viruses crossing species barriers to infect humans and other mammals.

[0003] Vaccination is generally considered the most effective measure to quickly control avian influenza. Live virus vaccines can effectively induce humoral immunity and cellular immunity without adjuvants, and a single dose produces long-lasting immunity. The prior art discloses an attenuated vaccine for the cold-adapted strain of the H9N2 subtype avian influenza virus, but the attenuation method of the attenuated vaccine does not completely excrete toxins after immunizing animals, and there is a risk of excreting toxins into the environment, and the safety needs to be further improved. Summary of the invention

[0004] The purpose of the present invention is to provide an attenuated strain of H9N2 avian influenza virus and a preparation method and application thereof. The attenuation method of the H9N2 avian influenza virus attenuated vaccine prepared from the attenuated strain of H9N2 avian influenza virus of the present invention is not affected by temperature, has no potential risk of reversion mutation, does not excrete toxins after immunizing animals, and has high safety.

[0005] The invention provides an attenuated strain of H9N2 avian influenza virus, which is obtained by modifying the M2 gene; the modification comprises performing synonymous mutation on overlapping genes encoding M1 protein and M2 protein, replacing the adjacent gene after the synonymous mutation with a gene encoding a stop codon, and performing deletion mutation on an intracellular domain gene encoding the M2 protein.

[0006] Preferably, the modification further comprises a deletion mutation of the transmembrane domain gene encoding the M2 protein.

[0007] Preferably, the modification also includes ensuring that the amino acid sequence of M1 is intact and unchanged.

[0008] Preferably, the base number of the gene with the deletion mutation includes 38 bp or 48 bp; the nucleotide sequence of the gene with the deletion mutation is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0009] Preferably, the base number of the gene with the deletion mutation includes 58bp, 68bp or 88bp; the nucleotide sequence of the gene with the deletion mutation is shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0010] Preferably, the HA and NA of the background strain of the attenuated strain of the H9N2 avian influenza virus are the HA and NA of the S2 strain; the nucleotide sequence of the HA of the S2 strain is shown in SEQ ID NO.31; and the nucleotide sequence of the NA of the S2 strain is shown in SEQ ID NO.32.

[0011] The present invention also provides a method for constructing the attenuated strain of H9N2 avian influenza virus described in the above scheme, comprising the following steps: constructing a plasmid containing the modified M2 gene; using a reverse genetics system, mixing a plasmid expressing an avian influenza gene fragment, a plasmid containing the modified M2 gene and a plasmid expressing the full-length M2 protein, and then transfecting the mixture into cells, harvesting the virus, and obtaining the attenuated strain of H9N2 avian influenza virus; preferably, the primer sequences required for constructing the plasmid containing the modified M2 gene are shown in SEQ ID NOs.8 to 22.

[0012] The present invention also provides the use of the attenuated H9N2 avian influenza virus strain described in the above scheme or the attenuated H9N2 avian influenza virus strain constructed by the construction method in the preparation of an attenuated H9N2 avian influenza virus vaccine.

[0013] The present invention also provides an attenuated H9N2 avian influenza virus vaccine, the active ingredients of which include the attenuated H9N2 avian influenza virus strain described in the above scheme or the attenuated H9N2 avian influenza virus strain constructed by the construction method.

[0014] The present invention provides an attenuated strain of H9N2 avian influenza virus, which is obtained by modifying the M2 gene; the modification includes performing synonymous mutation on the overlapping genes encoding the M1 protein and the M2 protein, replacing the adjacent genes after the synonymous mutation with genes encoding the stop codon, and performing deletion mutation on the intracellular domain gene encoding the M2 protein. The attenuation method of the H9N2 avian influenza virus attenuated vaccine prepared by the attenuated strain of the H9N2 avian influenza virus of the present invention is not affected by temperature, has no potential risk of reversion mutation, and has high safety. After immunizing chickens with the attenuated H9N2 avian influenza virus vaccine of the present invention, a high level of hemagglutination inhibition antibodies can be induced, and there is no detoxification after the immunized chickens, which has high safety and no potential harm to the environment, and provides a new strategy for preventing and controlling H9N2 avian influenza. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0016] Figure 1 A schematic diagram of deletion modification of the gene encoding the intracellular domain of the M2 protein of the H9N2 avian influenza virus;

[0017] Figure 2 A schematic diagram of modifying the genes encoding the extracellular domain, transmembrane region and intracellular domain of the M2 protein of the H9N2 avian influenza virus by means of synonymous mutation, addition of stop codons and deletion mutation;

[0018] Figure 3 This is the growth curve of the attenuated strain of H9N2 avian influenza virus (candidate vaccine strain) on MDCK cells. DETAILED DESCRIPTION

[0019] The present invention provides an attenuated strain of H9N2 avian influenza virus obtained by modifying the M2 gene; the modification comprises performing a synonymous mutation on overlapping genes encoding M1 protein and M2 protein, replacing the adjacent gene after the synonymous mutation with a gene encoding a stop codon, and performing a deletion mutation on an intracellular domain gene encoding the M2 protein.

[0020] In the specific implementation of the present invention, the modification also includes deletion mutation of the transmembrane domain gene encoding the M2 protein.

[0021] The M2 protein is a transmembrane protein with ion channel activity on the influenza virus envelope. It consists of 97 amino acids, including the N-terminal extracellular domain (M2e), the transmembrane domain, and the C-terminal cytoplasmic tail. The M2 protein plays a key role in the invasion, assembly, and release of the virus. It participates in the budding process of the virus and is very important for the formation of viral particles. In addition, the top of the M2 protein also plays an important role in the effective replication of the virus. Changing the toxicity of the H9N2 avian influenza virus by modifying the M2 protein is of great significance for the development of the H9N2 avian influenza virus vaccine.

[0022] The attenuated strain of the H9N2 avian influenza virus of the present invention can be used as an active ingredient to prepare an attenuated vaccine of the H9N2 avian influenza virus. After chickens are immunized with the attenuated vaccine of the H9N2 avian influenza virus of the present invention, a high level of hemagglutination inhibition antibodies can be induced, and there is no toxin excretion after the immunized chickens, the vaccine has high safety, and has no potential harm to the environment, thus providing a new strategy for preventing and controlling the H9N2 avian influenza.

[0023] In the specific implementation of the present invention, the modification also includes ensuring the integrity and invariance of the amino acid sequence of M1.

[0024] In the specific implementation process of the present invention, after synonymous mutation, the M2 protein sequence changes, multiple unknown mutations or premature termination will be generated, resulting in impaired M2 function. Deleting part of the nucleotide sequence in the M2 gene may cause functional changes at the viral nucleic acid level, forming new growth characteristics. Synonymous mutations and / or deletion mutations of multiple nucleotide sequences are generally considered to be unlikely to undergo back mutations, so the stability of the strain is strong. The present invention performs synonymous mutations on the nucleic acid sequence shared by M1 and M2, or on this basis, deletes the M2 gene, causing functional changes at the viral nucleic acid level, forming new viral growth characteristics, achieving the purpose of weakening the H9N2 avian influenza virus, and can be used for the production of attenuated vaccines.

[0025] In the specific implementation of the present invention, the base number of the gene with deletion mutation includes 38bp or 48bp; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0026] In the specific implementation of the present invention, the base number of the gene with deletion mutation includes 58bp, 68bp or 88bp; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0027] In one embodiment of the present invention, the site of the synonymous mutation is bp 28 to 72 of the M2 protein coding region; the original nucleotide sequence before the synonymous mutation is as shown in SEQ ID NO.6, specifically: CCTACCAGAACCGGATGGGAGTGCAACTGCAGCGGTTCAAGTGAC; the nucleotide sequence after the synonymous mutation is as shown in SEQ ID NO.7, specifically: CGTATCAAAATAGGATGGGCGTACAGCTACAACGATTTAAATAAC.

[0028] In one embodiment of the present invention, the number of stop codons is 2; the site of the adjacent gene after the synonymous mutation is 73-78 bp of the M2 protein coding region; the original nucleotide sequence of the adjacent gene after the synonymous mutation is: CCACTC; the nucleotide sequence of the gene encoding the stop codon is: TGATGA.

[0029] In one embodiment of the present invention, the base number of the gene with the deletion mutation is 38bp; the site of the gene with the deletion mutation is 152-189bp of the M2 protein coding region; the nucleotide sequence of the gene with the deletion mutation is shown in SEQ ID NO.1, specifically: TTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCT.

[0030] In another embodiment of the present invention, the base number of the gene with the deletion mutation is 48bp; the site of the gene with the deletion mutation is 142-189bp of the M2 protein coding region; the nucleotide sequence of the gene with the deletion mutation is shown in SEQ ID NO.2, specifically: TTCAAATGCATTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCT.

[0031] In another embodiment of the present invention, the base number of the gene with deletion mutation is 58bp; the site of the gene with deletion mutation is 132-189bp of the M2 protein coding region; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.3, specifically: TCGTCTTTTCTTCAAATGCATTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCT.

[0032] In another embodiment of the present invention, the base number of the gene with deletion mutation is 68bp; the site of the gene with deletion mutation is 122-189bp of the M2 protein coding region; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.4, specifically: GGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCTTTAAATACGGTTTGAAAAGAG GGCCT.

[0033] In another embodiment of the present invention, the base number of the gene with the deletion mutation is 88bp; the site of the gene with the deletion mutation is 102-189bp of the M2 protein coding region; the nucleotide sequence of the gene with the deletion mutation is shown in SEQ ID NO.5, specifically: GATATTGCACCTGATATTGTGGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCTTTA AATACGGTTTGAAAAGAGGGCCT.

[0034] In the specific implementation process of the present invention, the background strain of the H9N2 avian influenza virus attenuated strain uses H9GD1 as the skeleton, and HA and NA are replaced by HA and NA of the S2 strain respectively on the basis of the skeleton, that is, the HA and NA of the background strain of the H9N2 avian influenza virus attenuated strain are the HA and NA of the S2 strain.

[0035] In the specific implementation of the present invention, the nucleotide sequence of the PB1 gene of H9GD1 is shown in SEQ ID NO.25, specifically:

[0036]

[0037] In the specific implementation of the present invention, the nucleotide sequence of the PB2 gene of H9GD1 is shown in SEQ ID NO.26, specifically:

[0038]

[0039] In the specific implementation of the present invention, the nucleotide sequence of the PA gene of H9GD1 is shown in SEQ ID NO.27, specifically:

[0040]

[0041] In the specific implementation of the present invention, the nucleotide sequence of the NP gene of H9GD1 is shown in SEQ ID NO.28, specifically:

[0042]

[0043] In the specific implementation process of the present invention, the nucleotide sequence of the NS gene of H9GD1 is shown in SEQ ID NO.29, specifically:

[0044] agcaaaagcagggtgacaaaGacataatggattccaaTactgtgtcaagcttccaggtagaCTGCTTTCTTTGGCATGTCCGCAAACGATTTGCAGACCAAGGAATGGGTGATGCCCCATTTCTAGACCGGCTTCGCCGAgatcaGAAGTCCCTGAGGGGAAGAAGCGGCACTCTTGGTCTAGACATCAGAACTGCCACGCGTGAAGGAAAGAATatagtggaaAGGATTTTAGAAGAAGAGTCAGATGAAGCATTTAAAATGAGTATTGCTTCAGTACCAGCTCCACGCTATCTAACTGATatgactcttgaagaaatgtcaagagattggttaatgctcattcccaaacaGAAAATAACAGGGTCCCTAtgcattagaatggaccaagcaaTAGTGGACAAAACCATCACATTGAAAGCAAATttcagtgtgattttcaatcgGCTTGAAGCCCTGatactacttagagcttttacGgaAgaaggagcaatagtgggcgaaatctcaccAttaccttctcttccaggacatactgaCAaggatgtcaaaaatgcAATTGAGAtcctcatcggaggatttgaatggaatgataacacagttcAagtctctgaaactCtacagagattcgcttggagaaGcagcgatgaggatgggagaTctccactctctAcaaagtagaaacgggaaatggagagaacaGttAAgccagaagttcgaagaGataagatggttgattgaagaagtacgacatagattaaaaaTtacGgaGaatagcttTgaGcaaataacTtttatgcaagccttacaactattgcttgaagtggagcaagagataagaactttctcgtttcagcttatttaa。

[0045] In the specific implementation of the present invention, the nucleotide sequence of the M gene of H9GD1 is shown in SEQ ID NO.30, specifically:

[0046]

[0047] In the specific implementation of the present invention, the nucleotide sequence of the HA gene of S2 is shown in SEQ ID NO.31, specifically:

[0048]

[0049] In the specific implementation of the present invention, the nucleotide sequence of the NA gene of S2 is shown in SEQ ID NO.32, specifically:

[0050]

[0051] It should be pointed out that the nucleic acid and amino acid sequences of the M2 protein of the H9N2 avian influenza virus are highly conserved among different strains and are universal. Therefore, the present invention does not specifically limit the background strain of the attenuated strain of the H9N2 avian influenza virus, and any conventional H9N2 avian influenza virus in the art can be used.

[0052] The present invention also provides a method for constructing the attenuated strain of H9N2 avian influenza virus described in the above scheme, comprising the following steps: constructing a plasmid containing the modified M2 gene; using a reverse genetics system, mixing a plasmid expressing an avian influenza gene fragment, a plasmid containing the modified M2 gene, and a plasmid expressing the full-length M2 protein, and then transfecting the mixture into cells, harvesting the virus, and obtaining the attenuated strain of H9N2 avian influenza virus;

[0053] In the specific implementation of the present invention, the primer sequences required for constructing the plasmid containing the modified M2 gene are shown in SEQ ID NOs. 8 to 22.

[0054] The present invention also provides the use of the attenuated H9N2 avian influenza virus strain described in the above scheme or the attenuated H9N2 avian influenza virus strain constructed by the construction method in the preparation of an attenuated H9N2 avian influenza virus vaccine.

[0055] The present invention also provides an attenuated H9N2 avian influenza virus vaccine, the active ingredients of which include the attenuated H9N2 avian influenza virus strain described in the above scheme or the attenuated H9N2 avian influenza virus strain constructed by the construction method.

[0056] In the specific implementation of the present invention, the dosage form of the H9N2 attenuated avian influenza virus vaccine includes nasal drops.

[0057] In the specific implementation process of the present invention, the attenuated strain of H9N2 avian influenza virus or the attenuated strain of H9N2 avian influenza virus constructed by the construction method is the only active ingredient of the attenuated vaccine of H9N2 avian influenza virus.

[0058] To further illustrate the present invention, an attenuated strain of H9N2 avian influenza virus and its preparation method and application provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0059] Example 1 Molecular construction of attenuated strains of H9N2 avian influenza virus M gene modified

[0060] The background strain of the attenuated strain constructed in this example uses H9GD1 as the skeleton, and replaces HA and NA with HA and NA of the S2 strain respectively on the basis of the skeleton. The nucleotide sequence of the PB1 gene of H9GD1 is shown in SEQ ID NO.25. The nucleotide sequence of the PB2 gene of H9GD1 is shown in SEQ ID NO.26. The nucleotide sequence of the PA gene of H9GD1 is shown in SEQ ID NO.27. The nucleotide sequence of the NP gene of H9GD1 is shown in SEQ ID NO.28. The nucleotide sequence of the NS gene of H9GD1 is shown in SEQ ID NO.29. The nucleotide sequence of the M gene of H9GD1 is shown in SEQ ID NO.30. The nucleotide sequence of the HA gene of S2 is shown in SEQ ID NO.31. The nucleotide sequence of the NA gene of S2 is shown in SEQ ID NO.32.

[0061] The types of molecular construction are shown in Table 1, which are mainly divided into two categories: ① Gene modification in the intracellular domain encoding the M2 protein. A series of deletion mutations of different lengths are made based on the deletion of 38 bases in the M2 gene, such as Figure 1 As shown; ② Gene modification was performed simultaneously on the extracellular domain, transmembrane region and intracellular domain encoding the M2 protein, and synonymous mutations were performed on the overlapping regions of M1 and M2, and the following two amino acids (6 bases) were mutated to stop codons, and a series of deletion mutations of different lengths were performed on the basis of the 38 base deletion of the M2 gene, such as Figure 2 shown.

[0062] Table 1 Molecular construction of attenuated strains of H9N2 avian influenza

[0063]

[0064]

[0065] Plasmid construction:

[0066] The plasmid expressing the H9GD1 avian influenza virus M gene was extracted and PCR amplified using a series of PCR primers (primer sequences are shown in Table 2). Among them, for each plasmid with partial gene deletion in the intracellular domain of the M2 protein, the complete M gene plasmid was used as a template, and PCR primers (SEQ ID NO.8-14) were used to construct each plasmid with deletion mutation of the M2 intracellular domain. For the plasmids with genetic modification of the extracellular domain, transmembrane region and intracellular domain of the M2 protein, PCR primers were first used to construct a plasmid with M1 synonymous mutation and 2 stop codon mutations, and this plasmid was used as a template to construct other plasmids with deletion mutations. After the PCR was completed, agarose gel electrophoresis was run for identification, and the correct band was selected according to the molecular weight of the band for gel recovery, and the recovered product was recombined at 50°C for 15min, and the recombinant product was transformed into Escherichia coli competent cells, colonies were picked and sequenced to verify correctness, and each series of modified plasmids were successfully prepared using an endotoxin-free mini-extraction medium kit.

[0067] Table 2 Amplification primer sequences

[0068]

[0069] Example 2 Virus rescue of attenuated strains of H9N2 avian influenza virus

[0070] HEK293T cells were uniformly inoculated in a 6-well cell culture plate and placed in a cell culture incubator for culture at 37°C and 5% CO2. When the cell density grew to 70% to 80%, transfection was performed. Plasmids expressing 7 avian influenza gene fragments (PA, PB1, PB2, NP, NS, HA, NA), plasmids for each M2 modification constructed in Example 1, and plasmids expressing the full length of the M2 protein were mixed together in a certain proportion and transfected with Lipofectamine TM LTX transfection kit was used for transfection. Fresh culture medium was replaced 6-8h after transfection. After 48h of transfection, the cell plate was repeatedly frozen and thawed three times, and the supernatant was taken by centrifugation. The harvested virus was co-transfected with the M2 expression plasmid to observe the cell lesions. The virus with lesions on the cells was then inoculated into chicken embryos for amplification. After 72h, the virus was harvested and the virus hemagglutination titer was detected with chicken red blood cells. RNA was extracted from the virus successfully harvested from the chicken embryo and reversely transcribed into cDNA, which was amplified with universal PCR primers and sequenced for identification. Universal PCR primers are as follows: F primer: CCGAAGTTGGGGGGGagcaaaagcaggtagatg (SEQ ID NO.23); R primer: CCGCCGGGTTATTAGtagaaacaaggtagttttttac (SEQ ID NO.24). The virus with correct sequence identification was considered to be successfully rescued. The results of virus rescue are shown in Table 3, and a total of 9 strains of virus were rescued.

[0071] Table 3 Virus rescue results

[0072] Virus Name Rescue Situation Chicken embryo passaging Hemagglutination titer H9-Mdel38 success F1 <![CDATA[2 6 ]]> H9-Mdel41 success F1 <![CDATA[2 4.5 ]]> H9-Mdel44 success F2 <![CDATA[2 5 ]]> H9-Mdel47 success F1 <![CDATA[2 6 ]]> H9-Mdel50 / / H9-Mdel53 / / H9-M2+38 success F1 <![CDATA[2 7 ]]> H9-M2+48 success F1 <![CDATA[2 6 ]]> H9-M2+58 success F1 <![CDATA[2 7 ]]> H9-M2+68 success F1 <![CDATA[2 7.5 ]]> H9-M2+88 success F1 <![CDATA[2 4.5 ]]>

[0073] Example 3 Verification of the attenuation efficacy of the attenuated strain of H9N2 avian influenza virus

[0074] The virus successfully rescued in Example 2 was inoculated into chicken embryos for amplification, and the amplified virus was used to immunize SPF chickens by nasal drops. The inoculation dose for each chicken was 100 μL, and the inoculated virus amount was 6 lgEID 50 . Chicken throat swabs were collected three days before immunization, and the collected throat swabs were dissolved in PBS, filtered with a 0.22μm filter membrane and inoculated into SPF chicken embryos. After 3 days, the hemagglutination of chicken embryos in each group was detected. The results are shown in Table 4. Except for H9-Mdel41, the other groups detected different degrees of virus titers for the genetic modification of the intracellular domain of the M2 protein. Although H9-Mdel41 does not excrete toxins, its titer of passage growth in chicken embryos is low and does not meet production requirements. For the genetically modified strains of the extracellular domain, transmembrane region and intracellular domain of the M2 protein, no virus titers were detected in all immunization groups, indicating that the attenuated strains produced by this genetic modification method have good attenuation effects.

[0075] Table 4 Virus excretion in animals immunized with attenuated strains of H9N2 avian influenza virus

[0076] Group 1d 2d 3d PBS 0 / 8 0 / 8 0 / 8 H9-Mdel38 2 / 8 0 / 8 0 / 8 H9-Mdel41 0 / 8 0 / 8 0 / 8 H9-Mdel44 5 / 8 6 / 8 1 / 8 H9-Mdel47 1 / 8 0 / 8 0 / 8 H9-M2+38 0 / 8 0 / 8 0 / 8 H9-M2+48 0 / 8 0 / 8 0 / 8 H9-M2+58 0 / 8 0 / 8 0 / 8 H9-M2+68 0 / 8 0 / 8 0 / 8 H9-M2+88 0 / 8 0 / 8 0 / 8

[0077] Example 4 Hemagglutination inhibition (HI) antibody levels after immunization with attenuated strains of H9N2 avian influenza virus

[0078] The chicken serum was collected on the 14th day after immunization with the strain with good attenuation effect in Example 3, including the H9-M2+38, H9-M2+48, H9-M2+58, H9-M2+68, and H9-M2+88 immunization groups, and the level of anti-H9N2 avian influenza virus antibodies in the serum was detected. The specific detection steps are as follows:

[0079] 1. According to the hemagglutination titer of the determined antigen, four units of antigen are prepared and verified;

[0080] 2. Serum dilution: Inactivate the serum to be tested at 56°C for 30 minutes in advance, add PBS to a 96-well hemagglutination plate, and then dilute the serum to be tested, standard negative serum and positive serum according to the 2-fold dilution method;

[0081] 3. Add antigen: Add an equal volume of four units of verified antigen solution to the diluted serum, and allow the antibodies in the serum to react with the antigen at room temperature for 30 minutes;

[0082] 4. Add red blood cells: Add an equal volume of 1% chicken red blood cells to each reaction well, let it stand at room temperature for 30 minutes, and observe the binding of red blood cells to unbound antigens.

[0083] 5. Result determination: Tilt the blood coagulation plate at 45°, read the number on the back, and take the hole where the red blood cells can flow completely as the HI titer of the serum. The premise is that the negative and positive serum must be established, that is, the negative serum well shows complete agglutination, and the positive serum titer is within 1 titer of the marked one.

[0084] The specific results of the hemagglutination inhibition antibody level are shown in Table 5. After the chickens were immunized with the attenuated strains in each group, a high hemagglutination inhibition antibody level was induced (HI hemagglutination titer>2 4 ), among which, the highest level of H9-M2+48HI antibody was 2 7.22 , indicating that these attenuated strains can stimulate higher antibody levels and have good immunogenicity.

[0085] Table 5 Hemagglutination inhibition antibody levels in animals immunized with attenuated strains of H9N2 avian influenza virus

[0086] Group Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Sample 7 Sample 8 Sample 9 average PBS 1 0 0 0 0 0 0 0 0 0.11 H9-M2+38 7 5 6 8 6 5 8 6 7 6.44 H9-M2+48 7 6 9 6 7 7 6 9 8 7.22 H9-M2+58 8 6 6 5 7 5 5 6 5 5.89 H9-M2+68 5 7 5 5 7 6 6 6 5 5.78 H9-M2+88 4 5 5 4 6 6 5 6 5 5.11

[0087] Example 5: Toxin excretion in various tissues and organs after immunization with attenuated strains of H9N2 avian influenza virus

[0088] H9-M2+38, H9-M2+48, H9-M2+58, H9-M2+68, H9-M2+88 immune groups were randomly selected in each group to collect their various tissues and organs, including respiratory tract, lung, heart, liver and digestive tract, and 0.1g of each tissue and organ was taken, 900μl of sterile PBS was added to grind, the grinding liquid was filtered with a 0.22μm filter membrane, inoculated with chicken embryos, and the chicken embryo hemagglutination was detected after 3 days. The results are shown in Table 6, and no virus replication was detected in each immune group in each tissue and organ. It shows that the strain produced by this weakening method will not cause potential harm to the environment due to body detoxification after immunizing animals.

[0089] Table 6 Virus titers in various tissues of animals immunized with attenuated strains of H9N2 avian influenza virus

[0090]

[0091]

[0092] Example 6 Genetic stability of attenuated strains of H9N2 avian influenza virus

[0093] After testing, the genetic stability test results of the attenuated strain of H9N2 avian influenza virus (candidate vaccine strain) are shown in Table 7. It can be seen from Table 7 that the candidate vaccine strain has good stability and the M2 sequence of the passaged strain is consistent with the constructed sequence.

[0094] Table 7 Genetic stability study results of candidate vaccine strains (M2 sequence and constructed sequence consistency)

[0095] F1 generation F3 generation F5 generation H9-M2+38 100％ 100％ 100％ H9-M2+48 100％ 100％ 100％ H9-M2+58 100％ 100％ 100％ H9-M2+68 100％ 100％ 100％ H9-M2+88 100％ 100％ 100％

[0096] Example 7 Growth characteristics of attenuated strains of H9N2 avian influenza virus on MDCK cells

[0097] In order to verify the intracellular replication dynamics of the attenuated strain of H9N2 avian influenza virus (candidate vaccine strain), a virus growth curve was established on MDCK cells.

[0098] The specific steps are as follows: Inoculate each attenuated virus strain into a 12-well cell plate with a MOI of 0.01, and culture at 33°C after infection. Repeat the freezing and thawing of the corresponding cell plate three times at 24, 48, 72, and 96 hours after infection to collect the virus solution. Store at -80°C. Dilute the virus solution at each time point 10-fold and inoculate it into a 96-well plate with MDCK cells. Calculate the virus TCID according to the Reed-Muench method. 50 The growth curves of the attenuated strains were plotted with time as the horizontal axis and virus titer as the vertical axis. The growth kinetics curves of the attenuated strains on MDCK cells are shown in Figure 3 As shown, it can be seen that compared with the unmodified wild-type strain of M2, the replication ability of each attenuated strain is greatly reduced.

[0099] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An attenuated strain of H9N2 avian influenza virus, characterized in that: The attenuated strain of the H9N2 avian influenza virus is obtained by modifying the M2 gene; the modification includes performing a synonymous mutation on the overlapping genes encoding the M1 protein and the M2 protein, replacing the adjacent gene after the synonymous mutation with a gene encoding a stop codon, and performing a deletion mutation on the intracellular domain gene encoding the M2 protein.

2. The attenuated strain of H9N2 avian influenza virus according to claim 1, characterized in that: The modification also includes deletion mutation of the transmembrane domain gene encoding the M2 protein.

3. The attenuated strain of H9N2 avian influenza virus according to claim 1, characterized in that: The modification also includes ensuring that the amino acid sequence of M1 is intact and unchanged.

4. The attenuated strain of H9N2 avian influenza virus according to claim 1, characterized in that: The base number of the gene with the deletion mutation includes 38 bp or 48 bp; the nucleotide sequence of the gene with the deletion mutation is shown as SEQ ID NO.1 or SEQ ID NO.

2.

5. The attenuated strain of H9N2 avian influenza virus according to claim 2, characterized in that: The base number of the gene with the deletion mutation includes 58bp, 68bp or 88bp; the nucleotide sequence of the gene with the deletion mutation is shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.

5.

6. The attenuated strain of H9N2 avian influenza virus according to claim 1, characterized in that: The HA and NA of the background strain of the attenuated strain of the H9N2 avian influenza virus are the HA and NA of the S2 strain; the nucleotide sequence of the HA of the S2 strain is shown in SEQ ID NO.31; and the nucleotide sequence of the NA of the S2 strain is shown in SEQ ID NO.

32.

7. The method for constructing an attenuated strain of H9N2 avian influenza virus according to any one of claims 1 to 6, characterized in that: The following steps are involved: Constructing a plasmid containing the modified M2 gene; Using a reverse genetics system, a plasmid expressing an avian influenza gene fragment, a plasmid containing the modified M2 gene, and a plasmid expressing the full-length M2 protein are mixed and then transfected into cells, and the virus is harvested to obtain an attenuated strain of the H9N2 avian influenza virus; 8. The construction method according to claim 7, characterized in that: The primer sequences required for constructing the plasmid containing the modified M2 gene are shown in SEQ ID NOs. 8 to 22.

9. Use of the attenuated H9N2 avian influenza virus strain according to any one of claims 1 to 6 or the attenuated H9N2 avian influenza virus strain constructed by the construction method according to claim 7 or 8 in the preparation of an attenuated H9N2 avian influenza virus vaccine.

10. An attenuated H9N2 avian influenza virus vaccine, characterized in that: The active ingredient comprises the attenuated strain of H9N2 avian influenza virus described in any one of claims 1 to 6 or the attenuated strain of H9N2 avian influenza virus constructed by the construction method described in claim 7 or 8.

Images