Primer for detecting PCDHGB7 methylation based on qPCR and application

Abstract

The invention discloses a primer for detecting PCDHGB7 methylation based on qPCR and application, and relates to the technical field of biological detection, the primer comprises a methylation primer and a non-methylation primer; the methylation primers are as shown in a sequence SEQ ID NO. 1 and a sequence SEQ ID NO. 2; the sequences of the non-methylated primers are as shown in SEQ ID NO. 3 and SEQ ID NO. 4. The invention further provides application of the primer for detecting PCDHGB7 methylation based on qPCR as a detection kit, the primer can be used for detecting PCDHGB7 methylation simply, conveniently, quickly and repeatedly, and the required sample size is small.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and specifically relates to a primer for detecting PCDHGB7 methylation based on qPCR and an application thereof. Background Art

[0002] Aberrant DNA methylation is involved in the development, progression, and recurrence of cancer, making it an ideal cancer biomarker. A research team led by Yu Wenqiang's group at the Fudan University Institute of Biomedical Sciences and the Shanghai Public Health Clinical Center discovered that PCDHGB7 is hypermethylated in 17 cancer types in the TCGA database. This was subsequently validated in 13 clinical tumor samples, further demonstrating that PCDHGB7 is a new pan-cancer biomarker.

[0003] DNA methylation detection methods generally utilize techniques based on bisulfite conversion, such as PCR, sequencing, and mass spectrometry. qPCR offers advantages such as high efficiency, rapidity, and ease of use. DNA methylation detection based on NGS platforms offers high throughput but is complex and costly. Nucleic acid mass spectrometry platforms offer a range of throughput, cost, and time between PCR and NGS.

[0004] The key point of the methylation-specific PCR (MSP) method is that the extracted DNA is treated with bisulfate, and the unmethylated C is converted to U, while the unmethylated C remains unchanged. If the primers can amplify the sequence after bisulfate treatment, it means that there is methylation, otherwise it means there is no methylation. However, the above primers are only designed for methylation and can only amplify methylated sequences, not unmethylated sequences, making it impossible to determine the relative methylation level of the methylation site. Shan M et al. [1] The MSP method was used to analyze the methylation levels of nine genes, including PCDHGB7, in breast cancer. High methylation frequencies were found in the promoter regions of these nine genes, which can be used as potential diagnostic markers for breast cancer. Primer sequence for PCDHGB7:

[0005] Forward primer 5′-3′: CGTTATTCGATTTCGGAGGAG,

[0006] Reverse primer 5′-3′: TTCACAAATAAATCCCCGCTCT,

[0007] Probe 5′-3′: TGGTTAAGGGTTCGGTGGT.

[0008] The target fragment amplified by this primer is located at NC_000005.10, GRCH38, chr5: 141417959-141418119. Lin Xie et al. [2] A MSP method for detecting methylation of the PCDHGB7 gene in cervical cancer was developed. Three primer / probe sets were designed for three regions of the PCDHGB7 gene coding region, and the amplification regions were NC_000005.10, GRCH38, chr5:141417833-141417910, chr5:141419537-141419609, and chr5:141419730-141419812, respectively.

[0009] The methylation-sensitive restriction endonuclease combined with real-time fluorescence quantitative PCR (MSRE-qPCR) method uses a methylation-sensitive restriction endonuclease that can recognize specific sites as a key step. The target genomic region of PCDHGB7 contains several cleavage sites. If the CpG dinucleotide within the restriction enzyme cleavage site is methylated, it cannot be digested. The undigested DNA sequence can be used as a template for PCR reaction; if it is not methylated, it can be digested, but it cannot be amplified and detected by subsequent qPCR. This method relies on methylation-sensitive nucleic acid endonucleases. Different methylation sites may require different restriction endonucleases. It can only detect the methylation status of a single specific site and has the problem of false positives caused by incomplete enzyme digestion. Dong S et al. [3] Methylation was detected by MSRE-qPCR, and PCDHGB7 was found to be hypermethylated in 10 cancer types. This identified hypermethylated PCDHGB7 as a new UCOM for early cancer screening and can also be used as an indicative marker for precancer staging and metastasis tracking. PCR primers were designed for chr5:141417814-141417692 of the PCDHGB7 gene:

[0010] Forward primer 5′-3′: TTCTCCAACTGGAAAAGC,

[0011] Reverse primer 5′-3′: AGCAGCAAAGGAAATAGTA,

[0012] Probe 5′-3′: CGAGAACCCGAGCGAACG.

[0013] Zhao Fanghui [4] A set of primers was designed for the PCDHGB7 gene chr5: 141417610-141417721 region:

[0014] Forward primer 5′-3′: AGTGCAGAGCAAGCGCTGACG,

[0015] Reverse primer 5′-3′: GCGCAGCCGGGAGCCTC,

[0016] Probe 5′-3′: CAGCCTCTAGCCTGGGATTCCCTGC.

[0017] Currently, the main methods for detecting PCDHGB7 methylation are PCR and sequencing. Since sequencing is complex and costly, this application provides a qPCR-based method for detecting PCDHGB7 methylation.

[0018] References:

[0019] [1]Shan M, Zhang L, Liu Y, et al.DNA Methylation Profiles andTheirDiagnostic Utility in BC[J].Disease markers,2019,2019:1-10.DOI:10.1155 / 2019 / 6328503.

[0020] [2] Lin Xie, Zhu Zhaokui, Tu Huolin, et al. Kit for detecting methylation in cervical cancer: 202410169447[P][2024-12-24].

[0021] [3] Dong S. Hypermethylated PCDHGB7 as a universal cancer only marker and its application in early cervical cancer screening[C] / / Proceedings of the 2022 CCTB China Tumor Marker Academic Conference, China Integrative Oncology Conference, the 16th Tumor Marker Young Scientists Forum, and China Tumor Marker Industry Innovation Conference. 2023.

[0022] [4] Zhao Fanghui, Dai Hongshuang, Zhao Xuelian, et al. Composition, kit and use for detecting cervical cancer and high-grade cervical lesions: 202411103291[P][2024-12-24]. Summary of the Invention

[0023] The purpose of the present invention is to overcome the shortcomings of the existing technology and provide a primer and application for detecting PCDHGB7 methylation based on qPCR. The primers in this application are used to detect PCDHGB7 methylation, which has the characteristics of being simple, rapid, repeatable, and requiring a small amount of sample.

[0024] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0025] A primer for detecting PCDHGB7 methylation based on qPCR, comprising a methylation primer and a non-methylation primer;

[0026] The methylation primers are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0027] The non-methylated primers are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0028] The present invention also provides the use of the above-mentioned primers for detecting PCDHGB7 methylation based on qPCR as a detection kit.

[0029] Furthermore, before using primers for amplification, the DNA in the sample is treated with bisulfite, and then primer-specific PCR is performed; the primers shown in sequences SEQ ID NO.1 and SEQ ID NO.2 amplify the methylated DNA chain, and the primers shown in sequences SEQ ID NO.3 and SEQ ID NO.4 amplify the unmethylated DNA chain; and the presence of methylation in the tested sample is determined based on the primer amplification CT value.

[0030] Furthermore, the PCR amplification system was as follows: 1× dye method qPCR reaction buffer, 0.4 μM upstream and downstream primers; 1× background calibration dye I, 1-10 ng template, and nuclease-free water to 20 μL.

[0031] Furthermore, the PCR amplification reaction conditions were: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.

[0032] Furthermore, the sample is fresh tissue or paraffin section or plasma free nucleic acid DNA.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] The present invention provides a primer for detecting PCDHGB7 methylation based on qPCR. The primer can be used to detect PCDHGB7 methylation simply, quickly and repeatedly, and requires a small amount of sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 is the methylation primer qPCR result;

[0036] Figure 2 The results are from qPCR using non-methylated primers. DETAILED DESCRIPTION

[0037] The present invention will be further described below with reference to the accompanying drawings and examples. The embodiments of the present invention include but are not limited to the following examples.

[0038] The present invention provides primers for detecting PCDHGB7 methylation based on qPCR. The primers comprise two pairs: a methylation primer and an unmethylation primer. The methylation primers are shown in SEQ ID NOs. 1 and 2, and the unmethylation primers are shown in SEQ ID NOs. 3 and 4. The target region is located in the PCDHGB7 promoter region, at sites NC_000005.10, GRCH38, chr5:141417591-141417692. Before using the primers for amplification, the DNA to be tested is treated with bisulfite to convert unmethylated cytosines to uracil, while methylated cytosines remain unchanged. Primer-specific PCR is then performed. Primers SEQ ID NOs. 1 and 2 can amplify methylated samples, while primers SEQ ID NOs. 3 and 4 can amplify unmethylated samples. The presence of methylation in the tested sample is determined based on the CT value of the primer-amplified methylated or unmethylated DNA strands after treatment.

[0039] The qPCR-based detection method for PCDHGB7 methylation is as follows:

[0040] (1) Suitable samples

[0041] Fresh tissue, paraffin sections, plasma free nucleic acid DNA, etc.

[0042] (2) Nucleic acid extraction

[0043] DNA can be extracted by purchasing commercially available or self-prepared fresh tissue genomic DNA extraction reagents, paraffin section tissue genomic DNA extraction reagents, or plasma free nucleic acid DNA extraction reagents.

[0044] In this example, the following method was used to extract plasma free nucleic acids:

[0045] a. Add 1 mL of plasma to a test tube, then add 40 μL of proteinase K and mix thoroughly (the plasma and proteinase K must be mixed thoroughly before adding the lysis buffer). Then add 80 μL of lysis buffer (proteinase K should not be added directly to the lysis buffer, otherwise it will cause the proteinase K to lose its activity and affect the extraction efficiency).

[0046] b. After adding all three components, vortex to mix for 5 seconds and incubate at 60°C for 20 minutes.

[0047] d. Divide the sample into two low-adsorption tubes and place them on a magnetic rack. Let them stand for 3-5 minutes. Once the liquid has clarified, carefully remove the supernatant.

[0048] e. Add 2 mL of Wash Buffer I to each low-absorption tube (distribute as evenly as possible), mix thoroughly, centrifuge briefly, and combine into one tube. Continue vortexing for 30 seconds, centrifuge briefly, and place on a magnetic rack. Wait for the solution to clarify and discard the supernatant.

[0049] f. Add 2 mL of Wash Buffer II to the low-absorption tube, vortex for 30 seconds, centrifuge, place on a magnetic stand, wait for the solution to clear, and discard the supernatant;

[0050] g. Briefly centrifuge, place on a magnetic stand, carefully remove the remaining supernatant, and air dry for 5-10 minutes until the surface of the magnetic beads is matte (the drying time can be adjusted according to the ambient humidity. Incomplete drying of the magnetic beads will affect downstream experiments, and cracking of the magnetic beads will affect DNA yield and quality);

[0051] h. After the magnetic beads have dried, add 25-50 μL of elution buffer and vortex to disperse the beads. Gently shake 1-2 times during this time to accelerate DNA dissolution.

[0052] i. Place on a magnetic rack and let it stand for 3 minutes. After the solution has clarified, carefully transfer the DNA solution to a new low-adsorption tube (a second tube transfer is required to remove any remaining magnetic beads).

[0053] j. Store at -20℃.

[0054] (3) Bisulfite treatment

[0055] The extracted DNA can be treated with a commercially available or self-prepared bisulfite treatment reagent.

[0056] In this embodiment, the following steps are used to treat bisulfite:

[0057] 3.1. Thaw the DNA for bisulfite conversion. Ensure that all reagents for bisulfite conversion are fully dissolved. If necessary, heat at 60°C and vortex until completely dissolved. This process takes up to 5 minutes.

[0058] 3.2. Prepare the bisulfite reaction in a 200 μL PCR tube. Add each component in the order listed in Table 1. Mix thoroughly after adding the sample according to Table 1. Transfer to a PCR instrument and perform the transformation according to the program in Table 2. This process should take 30 minutes.

[0059] Table 1

[0060]

[0061] Note: The total volume of the high-concentration sample DNA solution and RNase-free water must be 20 μl.

[0062] Note: The total volume of the low-concentration sample DNA solution and RNase-free water must be 40 μl.

[0063] Table 2

[0064] step time temperature transsexual 5min 95℃ Incubation 10min 60℃ transsexual 5min 95℃ Incubation 10min 60℃ Hold unlimited 20℃

[0065] 3.3. Purification of sulfite-converted DNA:

[0066] a. After bisulfite conversion is complete, briefly centrifuge the PCR tube containing the bisulfite reaction and transfer the entire bisulfite reaction (140 μL) to a clean 1.5 mL microcentrifuge tube.

[0067] b. Add 310 μL of freshly prepared Buffer BL, mix thoroughly, and centrifuge briefly. Note: When the starting DNA content is less than 100 ng, carrier RNA solution must be added to Buffer BL. When the starting DNA content is greater than 100 ng, Buffer BL can be used directly without the addition of carrier RNA solution. The ratios of carrier RNA solution and Buffer BL are shown in Table 3 below.

[0068] Table 3

[0069] Sample size 1 4 8 16 24 48 Buffer BL volume 350μL 1.4mL 2.8mL 5.6mL 8.4mL 16.8mL Carrier RNA solution volume 3.5 μL 14 μL 28μL 56μL 84μL 168μL

[0070] c. Add 250 μL of ethanol (96–100%), vortex mix for 15 seconds, and centrifuge briefly.

[0071] d. Transfer all the solution obtained in the previous step to the DNA purification column provided with the kit.

[0072] e. Centrifuge at maximum speed for 1 minute, discard the waste liquid, and return the purification column to the collection tube.

[0073] f. Add 500 μL of Buffer BW (wash buffer) to the purification column and centrifuge at maximum speed for 1 minute. Discard the waste liquid and return the purification column to the collection tube.

[0074] g. Add 500 μL of Buffer BD (desulfurization buffer) to the purification column, cover it (minimize exposure of Buffer BD to air), and let it stand at room temperature (15-25°C) for 15 minutes.

[0075] h. Centrifuge at maximum speed for 1 minute, discard the waste liquid, and return the purification column to the collection tube.

[0076] i. Add 500 μL of Buffer BW to the purification column and centrifuge at maximum speed for 1 minute. Discard the waste liquid and return the purification column to the collection tube.

[0077] j. Repeat the above steps.

[0078] k. Add 250 μL of ethanol (96–100%) to the purification column and centrifuge at maximum speed for 1 min.

[0079] Place the purification column into a new 2 mL collection tube and centrifuge the column at maximum speed for 1 minute to remove any residual liquid.

[0080] Optional: Place the purification column in a clean 1.5 mL microcentrifuge tube and incubate in a metal bath at 60°C for 5 minutes. This step will evaporate any remaining liquid.

[0081] m. Place the purification column in a clean 1.5 mL microcentrifuge tube. Add 15 μL of Buffer EB (elution buffer) directly to the center of each purification column membrane. Gently close the lid and let the purification column stand at room temperature for 1 minute.

[0082] n. Centrifuge at 15,000 x g (12,000 rpm) for 1 min to elute the DNA.

[0083] Note: If a higher DNA concentration is required, only 10 μL of Buffer EB can be used for elution, but the yield will be reduced by approximately 20%. Do not elute with less than 10 μL of Buffer EB as the purification column membrane will not be fully hydrated.

[0084] o. Quantitative.

[0085] Note: Purified DNA can be stored at 2-8°C for 24 hours. For storage beyond 24 hours, it is recommended to store at -15 to -30°C.

[0086] 3.4. Notes:

[0087] a. The kit is shipped at room temperature (15-25°C). Upon arrival, DNA purification columns, DNA Protect Buffer, and Buffer BD should be stored at 2-8°C. However, short-term storage (up to 4 weeks) at room temperature will not affect their performance. All other buffers and bisulfite mixtures should be stored at room temperature and are stable under these conditions for at least 6 months.

[0088] b. Lyophilized carrier RNA can be stored at room temperature for 1 year. Carrier RNA should only be dissolved in RNase-free water. Dissolved carrier RNA should be immediately added to Buffer BL, which should be freshly prepared and stable at 2-8°C for 48 hours. Unused carrier RNA dissolved in RNase-free water should be frozen in aliquots at -15°C to -30°C and can be stored for up to 1 year.

[0089] c. Due to the sensitivity of nucleic acid amplification technology, care should be taken to avoid cross-contamination between sample preparations when handling DNA purification columns.

[0090] (4) Primer design

[0091] To ensure relative quantification of methylation levels, primers were designed to cover a wider range of CpG sites without requiring enzymes. The promoter region DNA sequence of PCDHGB7 was selected. These gene promoter sequences can be found through the online methylation primer design software (http: / / www.urogene.org / methprimer). Primers were designed: one methylated primer and one unmethylated primer.

[0092] Methylation primers:

[0093] SEQ ID NO.1(PCDHGB7-Left M): TTGGGCGTCGTCGTC

[0094] SEQ ID NO.2(PCDHGB7-Right M):AATTTTCTTTCTATTATTAACTACG

[0095] Unmethylated primers:

[0096] SEQ ID NO.3(PCDHGB7-Left U):TTGGGTGTTGTTGTT

[0097] SEQ ID NO.4(PCDHGB7-Right U):AATTTTCTTTCTATTATTAACTACA

[0098] (5) qPCR amplification

[0099] The amplification reaction system consisted of 1× dye-based qPCR reaction buffer, 0.4 μM upstream and downstream primers (1:1 ratio); 1× background calibration dye I, 1–10 ng template, and nuclease-free water to a volume of 20 μL. The dye-based qPCR reaction buffer and background calibration dye I were purchased directly from commercial suppliers, and the template was the DNA of the sample to be tested.

[0100] Amplification reaction conditions: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.

[0101] (6) Result determination

[0102] The methylation status can be determined based on the CT value.

[0103] After the PCR reaction is completed, the Ct threshold is set within the exponential amplification range (in this experiment, the fluorescence intensity ΔRn is set to 1). Amplifications with a Ct value less than 40 are considered positive. The ΔRn value represents the amount of PCR product produced during the PCR process. A curve is plotted against the cycle number using the ΔRn value, and a fluorescence threshold is selected. The cycle number at which fluorescence reaches the threshold is called the threshold cycle number, also known as the CT value. The ΔRn value is automatically set by the software for optimal results, but can be manually adjusted based on experimental requirements. It is generally set in the middle or end of the exponential amplification range.

[0104]

[0105] When partial methylation occurs, relative quantitative judgment is performed using the following formula:

[0106]

[0107] in,

[0108] N m : Copy number after amplification using methylated primers;

[0109] N u : Copy number after amplification using non-methylated primers;

[0110] N m0 : initial methylation substrate copy number;

[0111] N uo : initial unmethylated substrate copy number;

[0112] e x : Amplification efficiency;

[0113] ct m : Ct value of methylation primer amplification;

[0114] ct u : Ct value of non-methylated primer amplification;

[0115]

[0116] The following is described with specific examples:

[0117] The methylation status of the PCDHGB7 gene promoter region can be determined based on the amplified CT value. In this example, plasma free nucleic acids from patients with advanced colorectal cancer, early colorectal cancer, and healthy subjects were used as samples for detection. The test results are as follows: Figure 1 and Figure 2 As shown. Figure 1This is the methylation primer qPCR test result. The CT value of methylation (late-stage colorectal cancer sample) is 28.8, and the CT value of partial methylation (early-stage colorectal cancer sample) is 34.5. Samples with no amplification curve in the test results are samples from healthy individuals. Figure 2 The CT value of the unmethylated primers (healthy samples) is 24.3, the CT value of the partially methylated primers (early colorectal cancer samples) is 33.8, and the samples without amplification curves are late colorectal cancer samples. Figure 1 、 Figure 2 The CT value of partial methylation is substituted into the formula for calculation (when ΔRn=1, the copy numbers of the two after amplification are equal, that is, N m =N u ), calculate N m0 / N m0 +N uo *100% = 56.6%. A higher percentage of partial methylation indicates a higher degree of methylation, generally indicating a higher risk of malignant transformation and providing more direct guidance for disease progression and prognosis.

[0118] The above embodiment is only one of the preferred implementation methods of the present invention and should not be used to limit the scope of protection of the present invention. Any changes or modifications that have no substantive meaning made to the main design concept and spirit of the present invention, as long as the technical problems solved are still consistent with the present invention, should be included in the scope of protection of the present invention.

Claims

1. A primer for detecting PCDHGB7 methylation based on qPCR, characterized in that: Includes methylated primers and non-methylated primers; The methylation primers are shown in SEQ ID NO.1 and SEQ ID NO.2; The non-methylated primers are shown in sequences SEQ ID NO.3 and SEQ ID NO.

4.

2. Use of the primers for detecting PCDHGB7 methylation based on qPCR as claimed in claim 1 as a detection kit.

3. The use of a primer for detecting PCDHGB7 methylation based on qPCR according to claim 2, characterized in that: Before using the primers for amplification, the DNA in the sample is treated with bisulfite, and then primer-specific PCR is performed; the primers shown in the sequences SEQ ID NO.1 and SEQ ID NO.2 amplify the methylated DNA chain, and the primers shown in the sequences SEQ ID NO.3 and SEQ ID NO.4 amplify the unmethylated DNA chain; The presence of methylation in the sample was determined based on the primer amplification CT value.

4. The use of a primer for detecting PCDHGB7 methylation based on qPCR according to claim 3, characterized in that: The PCR amplification system was: 1× dye method qPCR reaction buffer, 0.4 μM upstream and downstream primers; 1× background calibration dye I, 1-10 ng template, and nuclease-free water to 20 μL.

5. The use of a primer for detecting PCDHGB7 methylation based on qPCR according to claim 4, characterized in that: The PCR amplification reaction conditions were: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.

6. The use of primers for detecting PCDHGB7 methylation based on qPCR according to claim 5, characterized in that: The sample is fresh tissue or paraffin section or plasma free nucleic acid DNA.

Images