Tissue repair preparation as well as preparation method and application thereof

Abstract

The tissue repair preparation at least comprises ECM, exosome and degradable glue, the ECM is an acellular matrix such as SIS, SIM and UBM, is granular and is injectable micro powder, and the content of the ECM is 10-50 mg / ml; the exosome is a healing-promoting cell, and is obtained by induction, polarization culture, centrifugation, supernatant collection and concentration and purification. The degradable glue is a polysaccharide with viscoelasticity; the advantages of a conventional filling agent are reserved, exosomes can be slowly released and internalized by various tissue cells, the activity of fibroblasts can be stimulated, the effect is lasting, and generation of new collagen is promoted; the defects of short effect and non-lasting effect of the existing filling agent are overcome; the product provided by the invention can achieve the effects of promoting rapid regeneration of collagen and maintaining for a long time; the functions of filling, face-lifting, tissue repairing and the like are achieved; the effect is remarkable, stable and lasting; the composition has multiple functions of quick effect, obvious effect and slow release and long-acting effect.

Description

[0001] Technical field: The present invention belongs to the field of medical biomaterials, and specifically relates to a tissue repair preparation and its preparation method and use. Background Art

[0002] Human skin is composed of the epidermis and dermis; the outermost epidermis is composed of stratified squamous epithelial cells with an underlying basement membrane (BM). The epidermis does not contain capillaries, and nutrition is mainly obtained through diffusion of dermal capillaries; the main cell types that make up the epidermis are keratinocytes, and melanocytes and Langerhans cells are also present. This layer of epidermis is mainly responsible for maintaining water in the body and blocking harmful chemicals and pathogens. The dermis is located below the epidermis and contains many structures, including blood vessels, nerves, hair follicles, smooth muscles, glands, and lymphatic tissue. The dermis (dermis or corium) is usually about 3-5mm thick and is the main component of human skin. The dermis is composed of a network of connective tissue, mainly collagen fibers that provide support and elastic tissue that provides elasticity. The main cell types are fibroblasts, adipocytes (storing fat), and macrophages. Collagen and hyaluronic acid (HA) are important components of the dermal component and are the main components of the extracellular matrix.

[0003] Skin aging is caused by the combined effects of internal factors (age, physical weakness, disease, etc.) and external factors (sun exposure, poor air quality), as well as diet, tobacco and alcohol, which manifests itself in the increase and deepening of facial wrinkles and sagging of the skin. Essentially, significant changes have occurred inside the skin, namely, water loss in the skin, decreased cell vitality, reduction in the extracellular matrix of dermal cells, increased content of matrix metalloproteinase (MMP), and degradation and destruction of collagen; inherent changes in the skin, the effects of gravity, the effects of facial muscles on the skin (dynamic lines), loss or displacement of soft tissue, and loss of bone and tissue elasticity. When the epidermis begins to thin, the skin ages, causing the junction with the dermis to flatten. As the body ages, collagen decreases, and the collagen bundles (which fill the skin) become loose and lose strength. When the skin loses its elasticity, it is less able to withstand stretching. Combined with gravity, muscle tension and tissue changes, the skin begins to wrinkle. Water loss and the breakdown of bonds between cells also reduce the skin's barrier function, which can lead to an increase in the skin's pore size.

[0004] As economic conditions improve, the number of people undergoing plastic surgery is increasing every year, including light medical beauty or micro plastic surgery, non-surgical medical beauty, that is, injectable filler beauty; that is, injectable filler materials are directly injected into the local or specific parts of the human body to improve the appearance or shape, thereby enhancing the beauty of the face and / or improving function; the application scope of facial beauty / plastic surgery is relatively wide, including but not limited to the following contents, such as facial improvement or elimination of wrinkles, improvement of facial contours, filling of depressions, filling of depressed scars, deformity correction, correction of poor facial shape, etc.; it also includes rhinoplasty, temporal augmentation, lip augmentation, forehead augmentation, earlobe filling, etc.

[0005] Hyaluronic acid (HA) is a non-sulfated glycosaminoglycan widely distributed in the connective, epithelial and neural tissues throughout the human body. HA is a substance that occurs naturally in the human body, and these hyaluronic acid fillers are usually well tolerated and non-permanent. They are an extremely low-risk, currently recognized minimally invasive treatment method for improving skin aging, degeneration, deformation, and wrinkles, or a cosmetic facial reshaping measure.

[0006] In addition, there are also filler products based on pure collagen extracted from the market. Their disadvantages are as follows: First, the collagen in this type of product is usually processed by deep processing such as extraction and purification (including deep liquefaction treatment), and its natural three-dimensional spatial structure (i.e. natural ECM) has been destroyed, and its ability to induce and adhere to skin cells (including fibroblasts, etc.) has been greatly reduced. Second, this type of collagen product does not contain a variety of cytokines and other natural high-molecular effective ingredients (such as glycosaminoglycans GAG, etc.) that promote cell growth; it cannot properly and continuously activate, induce and promote the differentiation and maturation of skin fibroblasts, and cannot effectively promote fibroblasts to secrete collagen, elastin and other dermal extracellular matrix. Third, the stability of this type of product is relatively poor, and it is easier to be degraded by collagenase in the body; the shaping effect time required for beauty is short; some are processed by collagen cross-linking technology, the texture becomes harder, the degradation becomes slower, and the shaping can be maintained for a longer time, but there is also a concern about cross-linking agent residues. Fourth, ordinary collagen products are soft in texture, weak in adhesion, prone to displacement or even drift at the injection site of the human body, and cannot be effectively and stably fixed, making it difficult to achieve the expected cosmetic shaping effect, and even leading to cosmetic failure. Fifth, exogenous collagen has the risk of allergic reactions. In short, collagen filling has a general effect, poor cost-effectiveness, and is difficult to meet the high-quality needs of beauty-conscious customers in real life.

[0007] The above mainstream skin filling products are usually based on physical filling. They do have certain effects on tissue aging and damage repair, such as facial cosmetic surgery (including wrinkle removal, rhinoplasty, etc.), and the effects are fast. However, the effects disappear obviously with the degradation of the filler, and usually last for a short time, requiring multiple injections. Even for strongly cross-linked products, their effective maintenance time is difficult to satisfy consumers. As time goes by, the filler is decomposed, degraded, and lost, such as the decrease in skin plumpness and performance functions (such as skin elasticity, smoothness, and glossiness), which still require multiple fillings.

[0008] Although the above-mentioned fillers (hyaluronic acid, collagen, including some acellular matrix powder) have been used clinically for many years, there are still some side effects, including the following defects: most of them only play a physical filling role, and the feeling is mainly facial filling and shaping, with a mechanical beauty on the surface, lacking natural beauty from the inside out; usually this type of filler is purely an exogenous substance intervention, mainly plays a physical filling role, and will be gradually degraded by various digestive enzymes in the body, and the tissue repair effect of its use will gradually disappear with the passage of time. In addition, this type of single product cannot or is difficult to induce the regeneration / secretion of collagen, elastin and other functional skin components by its own skin fibroblasts; it will completely degrade and disappear after a period of use, and the original facial wrinkles or local collapse and other shortcomings will be exposed again; consumers need to re-inject multiple times, and usually the filling effect at the original site will decrease each time; thus increasing the trouble and economic burden on consumers; it is difficult to effectively and permanently induce the regeneration of autologous skin fibroblasts and promote the generation of new collagen; because the effect is not lasting, it needs to be repeatedly injected.

[0009] In order to prolong the effect of soft tissue fillers, there are literature reports that the decellularized matrix is ​​cross-linked; such as the invention name of CN202110938441.6, a decellularized matrix microparticle product for soft tissue filling and repair and its preparation method. It includes 2.0-10% decellularized matrix microparticles, 0.1-5.0% suspending agent, and the balance is water for injection; the decellularized matrix microparticles are composed of one or more of non-cross-linked decellularized matrix microparticles, low-cross-linked decellularized matrix microparticles, and high-cross-linked decellularized matrix microparticles. According to its preparation process, decellularized matrix microparticle products with different degradation gradients and different degradation times and spatial structures can be formed, which are suitable for filling and repairing soft tissues such as superficial dermis tissue, deep dermis tissue, and subdermal tissue. The disadvantage is that this method is not only more complicated, but also requires the use of multiple processes that are difficult to control and master, such as low cross-linking and high cross-linking, and there is also the risk of residual cross-linking agents (such as glutaraldehyde); at the same time, there is basically no ability to promote the regeneration of collagen in dermal fibroblasts (FB). Summary of the invention

[0010] The present invention refers to the following patent documents (part or all), and on this basis, can be optimized, supplemented, improved and perfected.

[0011] Patent documents include: D1: Invention patent 201610264770.6, an injectable skin filler and its preparation method and use.

[0012] D2: Invention patent 201310007824.7, a laser-activated medical skin injectable filler.

[0013] D3: Invention patent 201510969630.7, a preparation for improving skin and its preparation method D4: Invention patent 201610291712. Decellularized tissue matrix composite material and preparation method thereof.

[0014] The existing technologies have the following defects, including: some use digestive fluid to digest the decellularized matrix, which will cause more serious damage to the active factors therein, especially the crushed ECM particles, because the active factors are fully exposed and easy to be digested; secondly, the natural spatial structure of the ECM will be damaged and destroyed, which will directly affect the adhesion, positioning, proliferation of cells, and the repair and regeneration of tissues. Thirdly, the stability of the overall ECM is reduced, the product is sponge-like, and the degradation cycle is shortened. Fourthly: the content of active factors in the product is low or easy to degrade.

[0015] More importantly, the inventor believes that the active ingredients in ECM are easily inactivated, and their stability is poor and their half-life is short under heat, acid and other conditions. In order to solve the above defects of existing products and the relatively common problems that still exist, such as hyaluronic acid, collagen and decellularized matrix products are mainly physical filling, easy to decompose and degrade, with low retention rate, fast loss and disappearance, unable to actively induce and effectively promote the production of skin collagen, unable to truly achieve efficient, long-term and stable tissue filling, repair and plastic surgery effects, and need frequent injections. In response to the above practical problems, the inventive research team combined the company's original decellularized matrix and derivative products with the latest nano-scale cell exosomes at home and abroad, and invented a tissue repair preparation after repeated experiments and continuous attempts to optimize.

[0016] Specifically, a tissue repair preparation of the present invention includes a tissue repair preparation that can be in the form of an injectable gel or paste; and contains at least three main functional components, as follows: The first component (A), ECM (Extracellular Matrix) or extracellular matrix or decellularized matrix, is in the form of fine particles and powder; The second component (B), degradable gel (Gel) is a gel made of polysaccharide molecules or synthetic polymers such as polyurethane, polylactic acid or a combination thereof, such as medical-grade HA preparation.

[0017] The third component (C) is an extracellular vesicle; specifically, it is an exosome, and further, it is an exosome of a cell that has the function of promoting tissue repair and regeneration, including one of various types of extracellular vesicles or a combination thereof.

[0018] Furthermore, the ECM is derived from mammalian tissue, including one or a combination of pericardium, peritoneum, amnion, placenta, umbilical cord, SIS, UBM, ADM, and is treated by decellularization; the above-mentioned decellularization treatment adopts one or a combination of physical, chemical or bioenzymatic methods to decellularize.

[0019] Furthermore, the ECM is in the form of microparticles or granules with a particle size of 0.05-0.25 mm; and can be easily passed through G25 to G32 injection needles.

[0020] Further, the content of the ECM in the finished preparation is 1-5% (w / w), preferably 1-3% (w / w); Furthermore, the animal tissue contains at least dermis and / or SIS (the innovation lies in having a high content of type III collagen, at least 50% type III collagen; it has a baby skin-like effect after filling) from immature animals in late embryonic stage (before birth), postnatal stage or adolescence.

[0021] Other, aforementioned polysaccharide molecules include but are not limited to one or a combination of hyaluronic acid and its derivatives, agarose and its derivatives.

[0022] Furthermore, the degradable glue is cross-linked, and the cross-linking is processed by using a cross-linking agent, an optical cross-linking method, and a self (in situ) cross-linking method or a combination of methods; the cross-linked biological glue has a slow degradation and has an obvious sustained-release effect.

[0023] Furthermore, the degradable gel component is hyaluronic acid and its derivatives, and the molecular weight is preferably 300,000-1.5 million Daltons.

[0024] Furthermore, the aforementioned exosomes are exosomes of human macrophages; Furthermore, the exosomes of macrophages are M2 macrophage-exosomes, which are polarized to M2c by inducing human commercialized M2, and then cultured for 48-96 hours, and then the M2c macrophage exosomes are obtained by centrifugation and purification; Or further, polyethylene glycol or similar components can be used to modify M2c macrophage exosomes to make them have better viscosity.

[0025] Meanwhile, the tissue repair preparation of the present invention may also be supplemented with commonly used, auxiliary pharmaceutical grade adjuvants.

[0026] Furthermore, the auxiliary agent includes one or a combination of anesthetics, antioxidants, and exogenous drugs with other functions.

[0027] Furthermore, the antioxidant is a natural ingredient, such as flavonols; flavonoids; catechins; flavanones; anthocyanins; isoflavones; extracts from green tree leaves, milk thistle, soybeans, wine grapes and their seeds, coffee berries, wild chamomile, pomegranates, tropical ferns and turmeric; and any combination thereof.

[0028] A method for preparing a medical tissue or skin repair preparation comprises the following steps: Step 1, preparing ECM powder, taking at least one or a combination of young animal tissues, such as SIS, UBM, ADM, pericardium, peritoneum, amnion, placenta, umbilical cord, mildly decellularizing, and then performing corresponding physical operations according to the required physical state, and preparing corresponding dosage forms; the preferred physical operation is low temperature or ultra-low temperature pulverization; Step 2, preparing a degradable glue, using medical grade polymers, prepared in a suitable solvent (eg, obtained by swelling).

[0029] Step 3: Prepare exosomes by culturing corresponding cells, inducing polarization, centrifuging, and purifying.

[0030] The first three steps are independent of each other and can be interchanged in any order without affecting the results; Step 4, the ECM powder prepared in the previous step is mixed with the exosomes, and then mechanically mixed with the aforementioned degradable glue to obtain the final product of tissue repair or filling preparation.

[0031] The tissue repair preparation of the present invention comprises at least ECM, exosomes and degradable glue; The first purpose / principle of the present invention is: the combination of ECM, M2 macrophage exosomes and degradable glue, whose characteristics are that ECM membrane is micronized, M2 macrophage exosomes are liquid suspension (culture supernatant) concentration of cell culture products, and degradable glue is a gel semi-solid; the three phases (physical state, particle size are completely different) each have their own advantages and can work synergistically with each other.

[0032] First, it can achieve the effects of body shaping and anti-wrinkle, and the results are immediate (it takes effect immediately after injection); Second, the embedded exosomes can be slowly released as the gel degrades and continuously absorbed through internalization, such as being internalized by dermal cells, and then stimulate relevant signaling pathways (such as TGF-beta) of fibroblasts (and possibly endothelial cells) from the inside out, promoting the synthesis and secretion of new collagen; Thirdly, the degradation of ECM powder can effectively combine with MMP (metalloproteinase), reduce the destruction and degradation of existing collagen, maintain the integrity of the original collagen structure, and maintain the corresponding hydrophilicity as well as the corresponding texture and elasticity.

[0033] At the same time, in order to promote tissue regeneration and rejuvenation, such as extracellular matrix (ECM); the form can also be microspheres, fine powder, small particles, or paste, slurry; it can also be colloid or liquid; including active ECM and inert ECM; SIS powder is preferred, which is rich in bioactive factors.

[0034] The tissue repair or filling preparation of the present invention may also be added with exogenous additives, including but not limited to various flow aids; and also including but not limited to various functional proteins and their derivatives, amino acids, and antioxidants, including flavonoids, tea polyphenols and vitamin C, and anesthetics; It is particularly worth mentioning that the addition of natural Vit C (especially L-Vit C) helps various cells to synthesize collagen and then form bundles, which is beneficial to improving the texture and elasticity of collagen bundles.

[0035] On the other hand, which is also one of the innovations of the present invention, the selected ECM powder contains at least some ECM derived from young animal tissues, especially dermal ECM that can be selected from young animals, which is rich in type III collagen (the ratio of type III to type I collagen is at least 1:1, that is, type III is more than type I), and after skin filling injection, it shows more baby-soft skin tendency.

[0036] On the other hand, due to the different animal tissue sources, different ages, and different decellularization methods, the active ingredients in the ECM will be lost to varying degrees. The present invention prefers to use a gentle decellularization method, such as optimizing the concentration, temperature, intensity, time, etc.

[0037] The second purpose / principle of the present invention is: the three-dimensional combination of exosomes, ECM powder and degradable glue enhances the stability of the composite filler, slows down or delays the release rate of effective ingredients including exosomes and ECM powder, which is conducive to longer-term sustained release, while improving the retention rate in the target area, making the expected use effect more stable, more lasting and more significant.

[0038] The third purpose / principle of the present invention is that the multiphase combination of exosomes, ECM powder and degradable glue, these three degradable biomaterials with completely different physical properties, can be made into a conventional dosage form of a filling preparation with good physical properties (including elastic modulus, viscous modulus and excellent needle permeability) through scientific proportioning of multiple parameters.

[0039] The fourth purpose / principle of the present invention is: through the multi-phase combination of exosomes, ECM powder and degradable gel; on the one hand, the composite product / preparation is a heterogeneous and non-uniform product. From a microscopic point of view, the physical properties of exosomes, gel and ECM particles are completely different, and the degree of refraction and scattering of visible light is also completely different; on the other hand, the components in the heterogeneous composite product are also relatively diverse and complex, including monomers, polymers, complexes, natural conjugates, etc. From the perspective of molecular weight, they have various molecular weights of different orders of magnitude; therefore, this type of particle-gel combination skin filler can effectively overcome the common Tyndall phenomenon of a single component.

[0040] The fifth object of the present invention is: a filling preparation can be used to repair aging, degeneration and or defects of various tissues (including skin); Furthermore, the use can be used to repair tissue defects, repairs and fillers in the forehead, eyes, nose, oral soft tissue, gingival papilla atrophy (causing different degrees of black triangles to appear on the oral gums, directly affecting the beauty and health of oral teeth), neck, chest, nerves, dura mater, spinal dura mater, tendons, ligaments, urinary tract, bladder, ureter, inguinal hernia, hiatal hernia, abdominal wall hernia, breast or uterine mucosa, or a combination thereof.

[0041] That is, it also includes applications to various types of degenerative, diseased, or mechanically damaged tissues and organs of the human body; but not limited to various types of tissues, including intradermal or subcutaneous tissues, with at least one of the effects of filling, repairing, regenerating, plastic surgery, and cosmetic treatment, or a combination of the aforementioned medical effects.

[0042] In order to achieve the purpose of the present invention, the inventor's overall inventive concept or inventive content is as follows: A skin filling preparation, comprising at least an extracellular matrix (ECM) and a degradable glue.

[0043] In the further preparation, the ECM is one or a combination of SIS, UBM, ADM, pericardium, peritoneum, amnion, placenta, and umbilical cord of a mammal, obtained by decellularization.

[0044] Furthermore, decellularization refers to decellularization of the aforementioned tissue by one of physical, chemical or bioenzymatic methods or a combination thereof.

[0045] Furthermore, the aforementioned ECM is prepared by removing fat from animal tissues, removing cells, pathogens, and immunogens in a gentle manner; Furthermore, the aforementioned mild method refers to the use of neutral, non-ionic surfactants for decellularization.

[0046] Furthermore, the weight percentage of the aforementioned ECM content in the preparation is 1-5% (w / w), preferably 1%-3% (w / w).

[0047] Furthermore, the aforementioned ECM is in the form of microparticles, granules or powders, and is pulverized by a low-temperature physical method.

[0048] Furthermore, the aforementioned ECM is in microparticle form, with a particle size of 0.05-0.25 mm; it is easy to pass through an injection needle, preferably a G25 to G32 injection needle.

[0049] Furthermore, the aforementioned preparation also includes various medical adjuvants; further, the adjuvants include one or a combination of anesthetics, antioxidants, and drugs with secondary effects, exogenous active factors, fibroblasts, and stem cells.

[0050] On the other hand, in the aforementioned skin filling preparation, the gel-forming substance in the degradable gel is 1-3% (w / w), preferably 1.5-2.5% (w / w) in the preparation; Furthermore, the degradable glue is made of polysaccharide polymer or synthetic polymer polyurethane, polylactic acid or one or a combination thereof; the polysaccharide polymer includes but is not limited to one or a combination of hyaluronic acid and its derivatives, agarose and its derivatives.

[0051] Furthermore, the degradable glue is cross-linked, and the cross-linking is processed by using a cross-linking agent, an optical cross-linking method, and a self (in situ) cross-linking method or a combination of methods; the cross-linked biological glue has a slow degradation and has an obvious sustained-release effect.

[0052] Furthermore, the degradable gel component is hyaluronic acid and its derivatives, and the molecular weight is preferably 300,000-1.5 million Daltons.

[0053] A use of a tissue repair preparation, the use of the preparation includes being used to repair and treat skin damage caused by mechanical trauma, chemical injury, natural aging, degenerative tissue or damaged tissue or tissue defect repair and regeneration, that is, the use is equivalent to including application to intradermal or subcutaneous tissue, and having at least one of the effects of filling, repairing, regenerating, plastic surgery, and beauty, or a medical combination effect having the aforementioned similar effects.

[0054] The filling preparation of the present invention at least comprises granular biomaterials degradable in vivo, degradable glue and auxiliary agents.

[0055] Furthermore, the aforementioned degradable granular biomaterial is a granular mammalian-derived ECM (decellularized matrix).

[0056] Furthermore, the physical state of the aforementioned ECM is one of particles, paste, cream, liquid or a combination thereof, preferably a particle state.

[0057] Furthermore, the aforementioned ECM is one of the mammalian bladder mucosa (UBM), acellular dermal matrix (ADM), amniotic membrane, placenta, and umbilical cord. SIS (small intestinal submucosa) can be understood in an expanded or broad sense in this patent; in some cases, SIS can be substantially equivalent to SIM (small intestinal matrix), and in addition to the small intestinal submucosa, it at least includes one or all of the small intestinal mucosal dense layer Stratum compactum, the small intestinal lamina propria, and the basement membrane (basal layer).

[0058] For the specific preliminary preparation or manufacturing of SIM, please refer to US4902508.

[0059] Furthermore, the ECM is decellularized by physical, chemical or bioenzymatic methods or a combination thereof.

[0060] Further, the aforementioned ECM is prepared by removing fat from animal tissue and removing cells, pathogens and immunogens in a mild manner; the mild manner refers to removing cells under low temperature conditions using a neutral or non-ionic surfactant.

[0061] Furthermore, the aforementioned ECM physical state is one of particles, paste, cream, liquid or a combination thereof, preferably particles or granules.

[0062] Furthermore, the SIS or dermis is selected from the SIS or dermis of mammals such as pigs and cows.

[0063] Furthermore, the SIS or dermis is the SIS or dermis of selected frame pigs (weighing about 30-50 kg).

[0064] Further, it is preferred that the ECM originates from a mammal in a vigorous growth stage; preferably, a pig in a 30 kg body weight stage.

[0065] The (dry matter) concentration of the degradable glue in the above filling preparation is 1-3% (w / w), preferably 1.5-2.5% (w / w); Furthermore, the degradable gel is a natural, synthetic, or fermentation-derived polymer, including but not limited to hyaluronic acid and its derivatives, agarose and its derivatives.

[0066] Alternatively, the aforementioned degradable gel may also be a dual-phase gel formed by a mixture of cross-linked and uncross-linked hyaluronic acid.

[0067] Furthermore, the degradable gel is hyaluronic acid and its derivatives, with a molecular weight of 100,000 to 4 million Daltons, preferably 500,000 to 2 million Daltons.

[0068] Furthermore, the aforementioned auxiliary agent includes one or a combination of anesthetics, antioxidants, drugs with secondary effects, and exogenous active factors.

[0069] Furthermore, the particle size of the ECM in the filling preparation is 0.05-0.25 mm, so as to be easy to pass through an injection needle; preferably a G25 to G32 injection needle.

[0070] Compared with ordinary ECM, SIS is preferred; it has two unique technical features (which can be called small innovations).

[0071] 1. ECM powder is surrounded and / or wrapped by degradable adhesive material; the adhesive material has a good sustained-release effect to slowly release ECM particles; the decellularized matrix (ECM) powder contains not only a large amount of collagen (young animals contain more type III collagen), elastin and other extracellular reticular structure components.

[0072] 2. ECM particles or powders (less than 0.25mm) still have good natural three-dimensional spatial structural characteristics, as well as active ingredient characteristics composed of a variety of cell growth factors and a variety of effective ingredients (sGAG, etc.) distributed therein; these two characteristics, namely the natural microscopic three-dimensional structural characteristics and the unique active ingredient characteristics, together constitute a microenvironment that is conducive to inducing cell chemotaxis, attachment, colonization, differentiation and proliferation; for example, it is conducive to the chemotaxis, growth, and secretion of functional components (functional structural proteins such as type I and type III collagen, elastin, etc.) of fibroblasts and various stem cells, and promotes a more complete structure and more sound function of tissues (including the dermis).

[0073] The present invention is based on the existing fillers, and ECM powder and exosomes are prepared with degradable glue (filler) by physical methods; after use, they enter the body and can continuously and slowly release exosomes and ECM particles (primary release), and further release active factors and / or active ingredients in ECM (secondary release).

[0074] Furthermore, the tissue repair preparation of the present invention has the advantages of good filling and shaping effects and fast onset of glue (HA) products; it also has the functions of ECM powder and exosomes, dual sustained release, enhancing the vitality and proliferation / regeneration of tissue fibroblasts at the application site, and inducing cells to secrete new collagen; thus achieving a fast, good, and more lasting effect. It can not only fill exogenous colloidal preparations into specific parts, but also achieve good cosmetic shaping effects (fast effect) at the target site immediately; it can also play a role in promoting collagen regeneration in a progressive, endogenous, and spontaneous manner, that is, gradually and lastingly releasing ECM (including powder, paste, cream, liquid) and exosomes in an orderly manner, which can effectively promote the in situ cells or fibroblasts or stem cells at the application site to continuously secrete endogenous collagen structural proteins (types I and III) and / or elastin; it truly achieves this from the inside out, showing a good dermal matrix; such as plump and elastic skin, and the effect is long-lasting.

[0075] The tissue repair referred to in this patent refers to a broad sense, and also includes various micro-filling, micro-plastic surgery for various therapeutic and non-therapeutic purposes, as well as various surgical or non-surgical application methods such as filling and plastic surgery, in order to achieve the purpose of repairing, modifying or beautifying various tissues and organs of the human body.

[0076] Exosomes: are extracellular vesicles with a diameter of about 30-100nm, with double-layer phospholipid membranes, rich in proteins, lipids, DNA and RNA (microRNA, mRNA, lncRNA, circRNA) from the source cells. Exosomes carry these information substances and play a mediating role in intercellular communication. Due to the special membrane structure of exosomes, the RNA inside them can be protected from enzyme degradation. Therefore, the content of various types of RNA in exosomes is relatively stable.

[0077] MicroRNA - a small noncoding RNA, 17 to about 25 nucleotide bases in length, that regulates gene expression post-transcriptionally, usually by inhibiting translation of target mRNAs. miRNAs can function as negative regulators, such that greater amounts of a particular miRNA are associated with lower levels of target gene expression.

[0078] There are three forms of miRNA, primary miRNA (pri-miRNA), pre-miRNA (pre-miRNA) and mature miRNA.

[0079] Primary miRNA (pri-miRNA) is expressed as a transcript of a stem-loop structure of about a few hundred bases to more than 1 kb. The pri-miRNA transcript is cleaved in the nucleus by an RNase II endonuclease called Drosha, which cleaves the two strands of the stem near the base of the stem-loop. Drosha uses staggered cleavage to cleave RNA multiplexes, leaving 5' phosphates and 2 nucleotides hanging at the 3' end. The cleavage product, pre-mature miRNA (pre-miRNA), is about 60 to about 110 nucleotides in length and has a hairpin structure formed in a backward folding manner. Pre-miRNA is transported from the nucleus to the cytoplasm by Ran-GTP and Exportin-5. Pre-miRNA is further processed in the cytoplasm by another RNase II endonuclease called Dicer. Dicer recognizes 5' phosphates and 3' overhangs and cuts off the loop at the stem-loop junction to form a miRNA multiplex. miRNA multiplex binds to the RNA-induced silencing complex (RISC), where the antisense strand is preferentially degraded and the sense strand mature miRNA guides RISC to its target site. Mature miRNA is the biologically active form of miRNA, with a length of about 17 to about 25 nucleotides.

[0080] Mechanism of action of exosomes: Under the stimulation of different microenvironments, cells can actively secrete exosomes into the interstitial tissue, so that they are absorbed and fused by other receptor cells through endocytosis and endocytosis. The various biological activities contained in the exosomes are used as a medium to transmit regulatory information to the receptor cells, interfere with gene transcription expression and the activation of related signal pathways, and thus affect the proliferation, migration, differentiation, secretion, apoptosis and other biological functions of the receptor cells. Exosomes can simulate the function of source cells to regulate the microenvironment. Studies have found that macrophage-derived exosomes play a complex and diverse role in pathological and physiological processes such as inflammatory conditioning, tissue repair and tumorigenesis. By secreting exosomes, active substances such as non-coding RNA are delivered to cells, thereby interfering with cell metabolism and activity.

[0081] Macrophages: Originated from monocytes, they can be divided into classically activated macrophages (M1 macrophages) and alternatively activated macrophages (M2 macrophages) according to their induced polarization. M1 and M2 macrophages play pro-inflammatory and anti-inflammatory roles in the four stages of inflammation, and their different subtypes secrete different cytokines to regulate the differentiation of the corresponding cells.

[0082] Typical activated M1 macrophages: M1 macrophages play a role in Th1 cell recruitment, pathogen resistance, and tumor control mainly through innate and adaptive immune responses; they are usually activated by pathogens, LPS, granulocyte macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor α (TNF-α), and type I helper T (Th1) cytokine interferon γ (IFN-γ). Many signaling pathways can promote macrophage polarization to M1, including IRF / STAT, LPS / TLR4, and NF-κB / PI-3 kinase pathways. Characteristically, M1 macrophages have strong antigen presentation activity and secrete more proinflammatory cytokines, such as interleukin 1 (IL-1), IL-6, TNF-α, nitric oxide (NO), and reactive oxygen species (ROS). In addition, they downregulate the expression of IL-12, IL-23, and IL-10. Stimulation of M1 macrophages leads to increased secretion levels of IL-1b, TNF-α, IL-12, IL-18, and IL-23. In addition, the M1 macrophage phenotype expresses high levels of major histocompatibility complex class II (MHC II), CD68, CD80, and CD86, as well as chemokines for Th1 cells, including CXCL9 and CXCL12.

[0083] Alternative activation of M2 macrophages: M2 macrophages can be activated by parasitic or fungal infection, immune complexes, apoptotic cells, macrophage colony stimulating factor (M-CSF), IL-13, TGF-β, and type 2 helper T cell factors (Th2) IL-4, IL-33, and IL-25 through Th2 cell alternative activation. Potential signals that promote macrophages to enter the M2 state include STAT6, IRF4, PPARδ, and PPARγ.

[0084] In contrast to the classically activated subtype, the alternatively activated subtype expresses the opposite expression profile: downregulation of IL-12 and IL-23, and upregulation of IL-10 and IL-1RA. In addition, M2 macrophages express lower levels of the inflammatory cytokines IL-1, IL-6, and TNF-α. M2 macrophages play a role in pathogen clearance, anti-inflammatory responses and metabolism, as well as wound healing, tissue remodeling, immune regulation, tumor progression, and malignancy.

[0085] The M2 macrophage phenotype is characterized by the expression of CD206, CD163, CD209, FIZZ1, and Ym1 / 2. In general, this subtype efficiently expresses receptors required for phagocytosis and clearance of mannose and galactose, as well as increased production of ornithine and polyamino acids through the arginase pathway. Chemokines expressed by this type of macrophage include CCL1, CCL17, CCL18, CCL22, and CCL24.

[0086] M2 macrophage subtype In response to different stimuli of macrophages, four M2 subtypes are known: M2a, M2b, M2c, and M2d. These subtypes differ in their cell surface markers, secreted cytokines, and biological functions. However, all M2 macrophage subtypes express IL-10.

[0087] M2a macrophages: activated by IL-4 or IL-13. IL-4 in turn promotes the expression of mannose receptor (CD206). Further upregulation of IL-10, TGF-b, CCL17, CCL18, and CCL22 has been shown to promote cell growth, tissue repair, and endocytosis.

[0088] M2b macrophages: Activated by immune complexes, Toll-like receptor (TLR) ligands, and IL-1b. Upon activation, this subtype releases pro-inflammatory and anti-inflammatory cytokines TNF-α, IL-1b, IL-6, and IL-10. M2b macrophages play a role in the regulation of immune responses and inflammation.

[0089] M2c macrophages: activated by glucocorticoids, IL-10, and TGF-b (and inactivated macrophages). This subtype is characterized by the high expression of anti-inflammatory IL-10, pro-fibrotic factors TGF-b, CCL16, CCL18, and Mer receptor tyrosine kinase (MerTK), of which MerTK can promote the phagocytosis of apoptotic cells.

[0090] M2d macrophages: activated by TLR antagonists, IL-6, and adenosine. Adenosine promotes the expression of IL-10 and vascular endothelial growth factor (VEGF), a process that can exacerbate angiogenesis and tumor progression.

[0091] Exosome particle detection: The main nanoparticle tracking analysis technology (NTA) in the present invention is a detection method that uses the characteristics of light scattering and Brownian motion to obtain the sample particle size distribution in a liquid suspension. It can track the movement of individual particles in the liquid, calculate the exosome particle size by analyzing the Brownian motion of the particles, and determine its concentration by counting. This is a commonly used exosome research method that can detect all particles with a particle size within the detection range, and can perform all-round characterization of particles with a wide particle size distribution range in the suspension. It has the advantages of high resolution, fast detection speed, and high accuracy.

[0092] DSPE-PEG: Distearoyl-sn-Glycero-3-Phosphoethanolamine (DSPE)-Polyethylene glycol (PEG), stearoyl phosphatidylethanolamine-polyethylene glycol; that is, conjugated polyethylene glycol is a combination of phospholipids and polyethylene glycol, which has both hydrophilicity and hydrophobicity. It is a functionalized polyethylene glycol preparation and a high-quality material that can significantly improve stability. These materials can also be used for targeted treatment by modifying the target surface ligands.

[0093] Compared with existing technologies, the specific advantages of tissue repair preparations (three-in-one) are as follows: 1) The skin filling preparation of the present invention not only retains the basic advantages of traditional filling gel products such as good biocompatibility, but also can serve as a scaffold for dermal fibroblasts, promote the loss of dermal related tissues, the repair of damaged parts and the regeneration and rehabilitation of original vitality; and the M2c macrophage exosomes have the functions of anti-inflammatory, anti-inflammatory and promoting tissue healing, activating the TGF-beta signaling pathway, promoting the secretion of collagen and the deposition of matrix; the optimized combination and synergistic effect of the two types of components, acellular matrix powder and M2c macrophage exosomes, together constitute a microenvironment that is conducive to the regeneration and regeneration of skin fibroblasts and related cells; this good microenvironment is conducive to the vitality and activity of dermal cells, and is conducive to the repair of skin tissue, and is also more comprehensively consolidated and strengthened in terms of skin texture, skin structure and function.

[0094] 2) It can induce or stimulate the chemotaxis, attachment and growth of skin fibroblasts for a longer period of time; at the same time, it can better promote the secretion of collagen, elastin and other extracellular matrix by skin dermal fibroblasts; thus, it is beneficial to restore the original elasticity and fullness of the skin; and essentially, it can maintain the skin matrix for a longer period of time from the inside out. It can avoid repeated injections of skin fillers, which can greatly reduce the trouble and pain of consumers, and save unnecessary expenses.

[0095] In addition, in terms of safety: the medical-grade filling gel and decellularized matrix powder used are both approved and mature tissue regeneration materials, and their safety has been generally recognized; and the source of human M2c macrophage exosomes is controllable and generally considered safe by peers.

[0096] 3) The exosomes of the present invention are modified with polyethylene glycol on one hand, have adhesion properties, and are not easily lost and degraded; on the other hand, the exosomes are mixed in a degradable gel (such as cross-linked HA), and will be slowly released step by step as the cross-linked HA degrades, so that a small dose can be achieved, but the effect of sustained slow release can be achieved; that is, the effect of small dosage and high efficacy can be achieved.

[0097] 4) In terms of ease of use, the three-in-one injectable product of the present invention has the same appearance and color as conventional filling products, and the method of use is no different from conventional products.

[0098] 5) Product stability: On the one hand, the effective concentrations of the degradable gel, acellular matrix and M2 macrophage exosomes in this three-in-one compound product are relatively low; on the other hand, there is no known adverse reaction between these three biological components, and they have excellent compatibility with each other, so the tissue repair preparation has good stability.

[0099] 6) In addition, the raw materials or materials used in tissue repair preparations are all natural biological materials that can be self-degraded in the body; they are degradable, absorbable, and usable without any residue; there is no foreign body left in the body and no secondary surgery is required to remove them.

[0100] In order to achieve the purpose of the present invention, the technical solution for preparing a three-in-one tissue (especially skin) repair preparation must include at least the following three important raw materials.

[0101] Part I: Preparation of decellularized matrix powder (A).

[0102] Furthermore, the decellularization is performed using a mild reagent and / or a mild method.

[0103] Furthermore, the acellular matrix can also be prepared by chemical cross-linking (including plant polyphenols, such as tannins), biological enzyme (TG enzyme) cross-linking, light cross-linking, thermal cross-linking, etc. (the cross-linking process can be selected or not according to actual needs) to obtain a more stable and less degradable microscopic three-dimensional structure.

[0104] Furthermore, the acellular matrix is ​​formed by gentle decellularization processing; Furthermore, the decellularized matrix is ​​a powder, which is obtained by grinding and pulverizing the decellularized matrix in an ultra-low temperature environment (liquid nitrogen).

[0105] Furthermore, the grinding is performed using an ultra-low temperature freezing grinder.

[0106] Furthermore, the acellular matrix powder has a particle size of 0.05 to 0.2 mm.

[0107] Furthermore, the decellularized matrix is ​​obtained by removing fat, cells, pathogens and immunogens from the submucosal layer of the porcine small intestine and adjacent tissues (including at least one of the dense layer and the basal layer in the small intestinal mucosal layer, defined as SIS or SIM in this patent, which are essentially equivalent).

[0108] Furthermore, the SIS contains basic fibroblast growth factor (bFGF) and sulfated glycosaminoglycan (sulfatedGAG).

[0109] Further, the SIS has a biological activity that significantly promotes cell proliferation; Further, the SIS has a biological activity that significantly promotes fibroblast proliferation; Part 2: Preparation of degradable glue, also known as degradable sustained-release material (B).

[0110] Take an appropriate amount of gelatinous material (dry matter), add water or other solvents, stir, and cross-link by chemical reagents, physical methods or biological methods or a combination thereof to prepare a suitable concentration such as 1-3% (w / w), and make it into a gel.

[0111] Furthermore, the preferred gel-forming substances are various natural, synthetic or fermented hyaluronic acids; Furthermore, the hyaluronic acid is selected from commercial medical or quasi-medical preparations derived from natural extraction, bacterial fermentation or yeast fermentation.

[0112] Further, the molecular weight of the selected hyaluronic acid is 100,000-4,000,000 Daltons. Further, the preferred hyaluronic acid has a molecular weight between 500,000-2,000,000 Daltons.

[0113] Furthermore, the elastic modulus of hyaluronic acid gel is 100-600 Pa, and the viscous modulus is 80-200 Pa. Alternatively, in the present invention, commercial products such as biphasic HA products may be directly used, where biphasic refers to mixing cross-linked and non-cross-linked HA together.

[0114] "Phase" actually refers to gas, liquid, and solid (gas phase, liquid phase, solid phase); biphasic refers to HA that contains both solid (semi-solid) and liquid; HA brands in the medical beauty field include Restylane 2 (a registered trademark abroad), YVOIRE (a registered trademark abroad), etc., which are all biphasic HA.

[0115] Part III: Preparation and modification of exosomes (C) Take the corresponding cultured cells and induce them in vitro to promote the secretion and collection of exosomes; Alternatively, purification and identification can be performed simultaneously during the process.

[0116] Further, such as culturing stem cells, mesenchymal stem cells, macrophages, and adipocytes, Furthermore, commercial human macrophages were cultured. Furthermore, IL-10 is used to induce / polarize the above macrophages into M2c macrophages, and samples can be taken and identified; and the culture is continued for 48-96 hours to promote the secretion of exosomes. Furthermore, lipid-modified polyethylene glycol (lipid-PEG) is used to effectively modify the surface to improve the properties of the exosomes, making them have a certain degree of adhesion and not easy to be lost.

[0117] Specifically, M2 cells were directly seeded into CCM (complete culture medium) containing 10 ng / ml of IL; after 24 h of culture, the medium in all culture vessels was discarded and replaced with fresh medium. Within 3-4 days, the cells reached 80% confluence, and the conditioned medium was then collected from each vessel.

[0118] Before isolating exosomes, the media from all containers were combined. To isolate exosomes, the media was centrifuged at 400×g, followed by 2000×g to remove cell debris and apoptotic bodies, respectively. The pellet was discarded after each centrifugation, and the supernatant was used. The supernatant was then filtered using a 220nm vacuum filter for further purification and stored at 4°C until ultracentrifugation; finally, the supernatant was ultracentrifuged at 120,000×g to precipitate the exosomes. The pellet was resuspended in PBS for washing, centrifuged again at the same speed, and the resulting pellet was resuspended in PBS and stored at -80°C; all centrifugations were performed at 4°C.

[0119] According to the literature PEGylated liposomes (Li and Huang et al., 2009), PEGylated exosomes were prepared.

[0120] Furthermore, the preparation method of the raw material (A) acellular matrix powder is briefly described as follows: (1) Pretreatment: Take the corresponding animal tissue or organ (optional tissues include dermis, bladder matrix, pericardium, amnion, and preferably small intestinal submucosa), rinse it repeatedly with water until it is completely clean, soak it in acetic acid solution, and use physical scraping to remove other tissues; for example, the serosal layer of the small intestine and jejunum, lymph nodes and other unnecessary tissues; and further process it to separate the relatively pure required SIS / SIM tissue, and then rinse it with purified water to obtain the raw material of the decellularized matrix.

[0121] (2) Virus inactivation: Use a mixed aqueous solution containing peracetic acid and ethanol to soak the raw materials of the decellularized matrix under ultrasonic conditions and room temperature to inactivate the virus; then use purified water to ultrasonically clean it for at least 1 hour.

[0122] (3) Degreasing: Soak the raw material obtained in the previous step in a solvent such as alcohol under ultrasonic conditions at room temperature; then clean it with water ultrasonic waves at least.

[0123] (4) Decellularization, DNA removal, and α-Gal antigen removal Soak the cells in one or a combination of surfactant, enzyme and EDTA solution at 37°C under ultrasonic conditions; then wash with PBS.

[0124] Use a solution containing DNA enzyme, soak at 37℃ under ultrasound, then use PBS for ultrasonic cleaning. Use a solution containing α-galactosidase, soak at 30℃ under ultrasound, then use PBS for ultrasonic cleaning. Use 20mM NaOH solution, soak at room temperature under ultrasound conditions, then use PBS for ultrasonic cleaning until neutral.

[0125] (5) Drying, shaping, crushing and sterilization The processed sheet-like decellularized matrix is ​​fixed on a mold, dried, and then ground using an ultra-low temperature freezing grinder to achieve a particle size of 100um-1000um. It is then packaged and sterilized to obtain raw material A.

[0126] Furthermore, the preparation method of the raw material (B) degradable glue is briefly described as follows: The method for preparing the degradable glue of the present invention comprises the following steps: (1) The gel-forming material (natural polymer polysaccharide, such as hyaluronic acid) is dissolved in water and swelled at low temperature for 1-5 days to obtain hyaluronic acid gel solution.

[0127] (2) Adding alkali, such as sodium hydroxide solution, potassium hydroxide or sodium carbonate solution, to adjust the hyaluronic acid gel solution to alkaline, then adding a crosslinking agent (BDDE) or other biological reagents (such as natural oxidant vitamin C and its derivatives) to carry out a crosslinking reaction to obtain a crosslinked hyaluronic acid gel.

[0128] (3) After fully washing the residual cross-linking agent in the hyaluronic acid gel, raw material B (degradable gel) is obtained.

[0129] The cross-linked HA derivative can be prepared by cross-linking the HA itself or its salt using a cross-linking agent. The cross-linking can be performed using a cross-linking agent in an alkaline aqueous solution. The alkaline aqueous solution includes NaOH, KOH, preferably NaOH aqueous solution, but is not limited thereto.

[0130] Then, under NaOH solution, the cross-linked HA contained in the tissue repair preparation of the present invention particularly exhibits high viscoelasticity even when a low concentration and a small amount of cross-linking agent are used. The cross-linking agent concentration may be 1 to 10 mol% relative to 1 mol of N-acetyl-D-glucosamine and D-glucuronic acid as units in HA or its salt.

[0131] The crosslinking agent is a compound containing two or more epoxy functional groups and it can vary, and as preferred examples, it includes butanediol diglycidyl ether (1,4-butanediol diglycidyl ether: BDDE), ethylene glycol diglycidyl ether (EGDGE), pentaerythritol polyglycidyl ether and sorbitol polyglycidyl ether, etc., among which, diepoxide-based 1,4-butanediol glycidyl ether is particularly preferred in terms of low toxicity.

[0132] In addition, the tissue repair preparation of the present invention, in addition to the three components of ECM, HA and exosomes, may also contain water, anesthetics or other adjuvants, including suspending agents, antioxidants or a combination thereof.

[0133] The anesthetic comprises one or more anesthetics known in the art, preferably a local anesthetic, for example, in the form of lidocaine hydrochloride; the anesthetic concentration is about 0.1-1.0% (w / w).

[0134] The tissue repair preparation of the present invention may further contain an isotonic agent, such as sodium chloride, with a content of 0.7-0.9%.

[0135] The tissue repair preparation of the present invention preferably uses a buffer solution containing sodium chloride, sodium monohydrogen phosphate and sodium dihydrogen phosphate in water for injection. As an additional aspect, in addition to the above components, the tissue repair preparation of the present invention may also contain other pharmaceutically acceptable components.

[0136] In addition, the degradable glue of the present invention is characterized in that the residual cross-linking agent is almost not contained, and the residual amount is preferably below the detection limit of 0.5 ppm.

[0137] The three-in-one tissue repair preparation of the present invention has physical filling, cell activation, matrix deposition, tissue regeneration, stimulates dermal cell vitality, and promotes dermal matrix regeneration; it can be effectively used for beauty and plastic surgery, cosmetic surgery, local repair or micro-treatment, light medical beauty and other beauty and plastic surgery purposes. The skin filling preparation of the present invention can be used to fill biological tissues, anti-wrinkle by filling wrinkles, reshape the face, or as a biomaterial for soft tissue augmentation to repair or increase the volume of soft tissues such as lips, nose, buttocks, cheeks or breasts. The medical skin filling preparation of the present invention is injectable, heterogeneous, and degradable; it can also be prepared according to the appropriate corresponding use or targeted or adaptive use method; the preferred dosage form is an injection.

[0138] Furthermore, the preparation method of the repair preparation also includes the following steps: The first major component (ECM powder) and the third major component (exosome suspension) are first mixed together by physical means.

[0139] The mixture obtained above is then fully mixed with the degradable glue (such as biphasic HA), including mixing by stirring, vibrating, external pressure fitting, etc., or a combination of these methods.

[0140] The content of ECM powder in the final product is 1-5% (W / W), and the content of the effective components of the degradable glue (such as HA) in the final product is 1-3% (W / W). BRIEF DESCRIPTION OF THE DRAWINGS

[0141] Figure 1 : 3T3 cell test results Figure 2 :Collagen mRNA expression level Figure 3 : Experimental group F2 at week 8, Masson staining Figure 4 :Control group at week 8, Masson staining Figure 5 :Comparison of thickness between the experimental group and the control group Implementation

[0142] In order to make the technical scheme of the present invention more accurately described, the technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, it should be noted that the following detailed descriptions are all illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those generally understood by those of ordinary skill in the art to which the present application belongs.

[0143] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application.

[0144] As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof. In the following specific embodiments, if the experimental methods of specific conditions are not indicated, they are usually based on conventional methods and conditions of biology within the art, and such techniques and conditions are fully explained in the literature.

[0145] The present invention is further described with reference to specific examples, which are only for explaining the present invention and do not limit its contents.

[0146] If the specific experimental conditions or methods are not specified in the examples, they are usually carried out according to conventional conditions or methods; or according to the conditions recommended by the sales company; the materials, reagents, etc. used in the examples, unless otherwise specified, can be purchased through commercial channels.

[0147] The present invention is further explained by the following examples, but it does not constitute a limitation of the present invention. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. All other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present invention.

[0148] Example 1: Preparation of decellularized matrix powder or suspension (derived from nursery pig SIS), namely, raw material A (ECM powder or liquid).

[0149] Pretreatment of tissue raw materials: Take the fresh small intestine of ordinary commercial-grade nursery pigs (less than 3 months old, weighing about 30 kg of three-way hybrid pigs), rinse it repeatedly with water, soak it in acetic acid solution, and then scrape off unnecessary tissues mechanically to obtain SIS tissue raw materials.

[0150] (1) Remove the small intestinal mucosal layer, muscular layer, serosa layer, lymph nodes, etc. to separate the small intestinal submucosa.

[0151] Then, the SIS is repeatedly rinsed with purified water to obtain the preliminary raw material SIS of the matrix to be decellularized; (2) Virus inactivation: Use a mixed aqueous solution containing peracetic acid and ethanol to soak the decellularized matrix material under ultrasonic conditions and room temperature to inactivate the virus; then use purified water to ultrasonically clean it for at least 1 hour.

[0152] (3) Degreasing: Use ethanol and soak at room temperature under ultrasonic conditions; then use water ultrasonic cleaning for at least one cleaning step.

[0153] (4) Decellularization, DNA removal, and α-Gal antigen removal: Use mild reagents, 0.5% (w / w) non-ionic surfactant and EDTA solution, soak at 10°C, ultrasonically clean with PBS, and repeat three times.

[0154] Note: Use a solution containing DNA enzyme, soak at 37℃ under ultrasonic conditions, and then use PBS for ultrasonic cleaning. Use a solution containing α-galactosidase, soak at 30℃ under ultrasonic conditions, and then use PBS for ultrasonic cleaning. Use 20mM NaOH solution, soak at room temperature under ultrasonic conditions, and then use PBS for ultrasonic cleaning until neutral.

[0155] (5) Drying, processing, shaping, and sterilization: The decellularized matrix treated in the above four steps is fixed on a mold and dried; it is then ground using an ultra-low temperature freezing grinder, and ground multiple times until more than 95% (w / w) of the particles are smaller than about 250um, 150um, 200um, and 250um; physical methods are used to remove particles that are significantly larger than 250um; or physiological saline can be added to make it a suspension with a concentration of 1%, 2%, 3%, 4%, 5%, or 10% (w / w).

[0156] Example 2: Preparation of degradable gel (B), i.e., preparation of buffer gel system Step 1: Take pharmaceutical grade hyaluronic acid from fermentation source with molecular weight of 200,000 (LMW) Dalton and 1.5 million (HMW) Dalton, respectively, and dissolve them in double distilled water. The hyaluronic acid raw material is fully swollen in water and placed at 4-10°C for 3 days to obtain a homogeneous colloid without white spots and / or fibers when observed with the naked eye after the hyaluronic acid is fully swollen. The concentrations of hyaluronic acid colloids are 16, 18, 20, 22, 24, and 26 mg / ml, respectively; 20 mg / ml is taken as the standard value.

[0157] Step 2: Adjust the hyaluronic acid glue to be alkaline. The amount of sodium hydroxide solution used should reach 0.2M (calculated based on the total volume of the glue), and stir evenly. Then leave it at room temperature for 3 hours to make the hyaluronic acid glue more evenly alkaline. At this time, measure the pH value and adjust it so that the pH value of the hyaluronic acid glue reaches 11.

[0158] Step 3: Cross-linking treatment to improve the elastic modulus and viscosity modulus of the hyaluronic acid preparation.

[0159] The crosslinking agent selected is 1,4-butanediol diglycidyl ether (BDDE), and the added amount is 1 / 1000 of the volume of the alkaline hyaluronic acid gel. After adding the crosslinking agent and stirring evenly, the gel mixed with the crosslinking agent is poured into the reaction mold for crosslinking reaction. The crosslinking reaction condition is a reaction temperature of 37°C. When the hyaluronic acid gel mixed with the crosslinking agent is poured into the reaction mold, the thickness of the gel can be controlled to 1-3mm. The result of the crosslinking reaction in the mold is the formation of a thin layer of crosslinked hyaluronic acid gel. The crosslinking reaction time is 6 hours; the reaction mold is rectangular.

[0160] Step 4: washing and dialyzing the gel; The dialysis gel blocks are frozen into gel ice cubes, crushed by a micronizer, and then passed through a series of sieves with different apertures to collect gel ice particles of different particle size ranges; the gel ice particles of different particle size ranges are swollen in a weakly alkaline hyaluronic acid solution to seal the remaining free ends of the cross-linking agent, and then an acidic solution is added to obtain a gel with a pH value within a physiologically acceptable range.

[0161] Step 5: Determination of residual content of crosslinking agent 1,4-Butanediol diglycidyl ether (BDDE), cross-linking agent content is an important indicator for sodium hyaluronate detection. Excessive content may cause certain safety issues. In order to detect and evaluate the safety of the product, please refer to YY / T 0962-2021 "Cross-linked Sodium Hyaluronate Gel for Plastic Surgery". The cross-linking agent content is determined by gas phase method and microplate reader detection method as recommended in the standard. The gas phase method is simple and quick to operate, and the microplate reader detection method has higher specificity.

[0162] Weigh an appropriate amount of cross-linked HA gel, place it in a physiological equilibrium solution containing 1000U / ml hyaluronidase in a 3°C constant temperature box until the cross-linked hyaluronic acid gel is completely degraded, use gas chromatography to detect the cross-linking agent content in the degradation solution, and then calculate the cross-linking agent content in the gel.

[0163] Step six: directly or in proportion, mix the two types of cross-linked colloids, LMW and HMW, to obtain cross-linked HA.

[0164] Step 7: Prepare and mix the cross-linked HA and the non-cross-linked HA in an equal weight and volume ratio (based on the w / w ratio of the active ingredients) to obtain a 20 mg / ml gel (two-phase).

[0165] Example 3: Preparation of exosomes (such as M2c macrophages) After 3 days of primary culture of human macrophages, the culture medium was discarded and the cells were washed twice with sterile PBS buffer, followed by replacement with M2c macrophage polarization induction medium. After two days of induction culture, the morphology of polarized macrophages was observed under an optical microscope. The cells were round or oval, with small nuclei and strong light shielding, and the cell bodies extended irregular pseudopodia, indicating that the macrophages were more active.

[0166] The present invention uses cytokine IL-10 (20ng / ml) to stimulate macrophages to polarize toward M2c. In order to verify the polarization of macrophages toward M2c, the membrane surface markers CD68 (macrophages) and CD163 (specific markers of M2c polarization) are selected as targets, and the induced macrophages are stained and analyzed by flow cytometry. Compared with non-induced M0 macrophages, the fluorescence intensity of CD68 in induced macrophages has no significant difference, but the fluorescence intensity of CD163 is significantly increased.

[0167] Note: M2c macrophage polarization induction medium: contains 10% fetal bovine serum-DMEM / F-12+IL-10 (20ng / ml)+1% penicillin / streptomycin double antibody.

[0168] After macrophage polarization induction, the supernatant of M2c macrophages was collected and centrifuged at 2000g for 30 minutes at 4°C using an ultracentrifuge, the supernatant was collected, and the bottom precipitate was discarded; the supernatant was filtered using a filter membrane with a pore size of 0.22um, and then ultracentrifuged at 120,000g for 2 hours at 4°C; the supernatant after centrifugation was gently aspirated to avoid stirring the bottom precipitate; the bottom precipitate was then resuspended with the same volume of pre-cooled PBS buffer, and the suspension was centrifuged again at 120,000g for 2 hours at 4°C, the supernatant was carefully collected, and placed in a -80°C refrigerator for long-term storage.

[0169] Transmission electron microscopy observation of exosomes and NTA particle size analysis: collect the exosome suspension and drop it on the pre-fixed carbon mesh; then carefully use filter paper to absorb the excess liquid; drop phosphotungstic acid on the carbon mesh and let it stand; use filter paper again to absorb the excess phosphotungstic acid liquid, then place the carbon mesh in a glass dish, observe and take pictures on the machine. The diameter distribution of M2c macrophage exosomes was detected using the ZetaView PMX particle size analyzer: first, use polystyrene microspheres (110nm) to calibrate the instrument; then use PBS buffer to wash the sample pool; finally, use PBS buffer to dilute the M2c macrophage exosomes, and inject the sample into the machine for detection; the exosome concentration was measured to be 2×10 8 The particle size ranged from 54 nm to 150 nm, and the average particle size was 68 nm.

[0170] Polarized M2c macrophages were identified by flow cytometry using CD68 as a macrophage marker and CD163 as a M2c macrophage polarization marker.

[0171] Exosomes were validated by Western Blot using antibodies against exosomal markers tetraspanins, CD9, CD63, and CD81 (located on the surface of exosomes) as probes.

[0172] Modification of exosomes after isolation: The final volume of exosome suspension (final concentration of 2 mg PEG per mL of exosomes) was prepared by mixing concentrated M2c macrophage exosomes with PBS and DSPE-PEG aqueous solution (10 mg / ml) in a certain ratio. The sample was then incubated and vortexed to prevent aggregation of PEG molecules or exosomes. After incubation, the sample was suspended in more PBS and finally ultracentrifuged at 120,000g to wash away unbound PEG molecules; the exosome pellet was then resuspended in PBS and diluted accordingly to the desired target particle concentration and stored at -80°C for later use.

[0173] Example 4: In vitro test of fibroblast (3T3) internalization of exosomes and the effect of exosomes on cell proliferation (I) To prove that the exosomes obtained in Example 3 can affect the tissue repair process by stimulating cell proliferation. Exosomes can be internalized and absorbed by cells and affect cell behavior; 3T3 and DiI-labeled exosomes were co-incubated for 12 hours, 24 hours, 48 ​​hours and 72 hours. Using fluorescence microscopy images, it was observed that the exosomes were gradually internalized by 3T3 from 8 hours to 24 hours. After 48 hours of incubation, a large number of exosomes were internalized and distributed in the perinuclear region. The fluorescence intensity reached a peak at 72 hours, indicating that exosomes can be transported to receptor cells to regulate cell behavior in the early stage of tissue repair.

[0174] The proliferation of fibroblasts was measured by CCK-8 to evaluate the effect of adding M2c macrophage-derived exosomes. The proliferation test results of the treated fibroblasts at different times within 96 hours showed that the OD value of the exosome-treated group was significantly higher than that of the ECM group and the vesicle control group, indicating that M2c macrophage-derived exosomes can promote the proliferation of 3T3 cells. For details, see the attached Figure 1 .

[0175] (II) M2c macrophage exosomes activate the PI3K / Akt signaling pathway To further clarify the molecular mechanism of the effect of M2c macrophage-Exosome on dermal cells; for example, Exosomes secreted by M2c macrophages can activate multiple targeted signaling pathways (including Akt, Erk1 / 2 and STAT3) of dermal cells (such as fibroblasts), and increase their collagen secretion and matrix deposition.

[0176] To observe whether Exosomes exert their functions through the PI3K / Akt pathway, the levels of Akt and phosphorylated AKT (p-Akt) were detected by WB and IF assays.

[0177] The level of the experimental group (three-in-one group) was much higher than that of the ECM group (SIS) and the blank group.

[0178] The experimental group showed the highest level of phosphorylated AKT (p-Akt), indicating that a large number of exosomes were captured.

[0179] These results indicate that Exosomes activated the PI3K / Akt signaling pathway in dermal fibroblasts and exerted its function by phosphorylating AKT (p-Akt).

[0180] Exosomes contact dermal fibroblasts and are actually internalized by the cells, which in turn causes the fibroblasts to secrete more collagen, at least in part due to the activation of the PI3K / Akt signaling pathway.

[0181] Example 5: Preparation of composite filling product (three-in-one) The ECM powder (A) and exosome (C) suspension prepared in Examples 1 and 3 were mixed as needed, connected through a Luer tube, and mixed with the degradable glue prepared or purchased in Example 2 at a ratio of 1:1 (V / V); to obtain the corresponding effective concentration in the following preparation (F).

[0182] The composition and related physical parameters of F (three-in-one) tissue repair preparation are as follows in Table 1:

[0183] Example 6: Animal test of tissue repair preparation (F2) (I) The composite filling product (F2) prepared in Example 5 was used as the test group, and ECM+HA was used as the control group. The test was performed as follows: The experiment was divided into two groups, each with 6 SD rats (about 250 grams): F2 test group and ECM+HA control group. 0.5 ml was injected subcutaneously with a 27G needle. (1) In vivo and in vitro (Ex Vivo) test: After 4 weeks, three SD rats injected were selected from each group. The skin tissue containing the graft was removed under sterile operation and cut into 1 mm 2 The left and right pieces were divided into 3 equal parts and placed in a 6-well culture plate containing 10% fetal bovine serum-DMEM / F-12+1% penicillin / streptomycin double antibody and 5% CO237 o C for 96 hours, discard the tissue pieces, wash three times with PBS, extract total RNA from adherent fibroblasts according to the Qiagen mini RNAeasy kit instructions, and then reverse transcribe to synthesize cDNA with Transcript II reverse transcriptase. SYBR Green qPCR method was used to determine the expression of COL1A1 and COL3A1 mRNA. The reaction conditions were as follows: 95 o Denature at C for 2 minutes, then at 95 o C 5 seconds, 60 o C 30 seconds 95 o C 15 seconds cycle 40 times.

[0184] qPCR primers are as follows: COL1A1 Forward Primer GGAGAGAGCATGACCGATGG, Reverse PrimerAAGTTCCGTGTGACTCGTG; The experimental results showed that the expression levels of COL1A and COL3A1 mRNA in the F2 test group were significantly higher than those in the ECM+HA control group, which were 4.3 and 3.5 times higher than those in the ECM+HA control group, respectively. Figure 2 .

[0185] (2) Masson staining and thickness measurement of skin tissue after transplantation: 8 weeks after injection, the corresponding skin tissue of the transplant was obtained and fixed with 10% formalin for more than 16 hours. The tissue was removed from the fixative and trimmed with a scalpel in a fume hood to make the target tissue flat. The trimmed tissue and the corresponding label were placed in a dehydration box. The dehydration box was placed in a hanging basket and dehydrated in a dehydrator with gradient alcohol. 75% alcohol in thermostat at 40℃ for 4h) → 85% alcohol in thermostat at 40℃ for 2h → 90% alcohol in thermostat at 40℃ for 2h → 95% alcohol in thermostat at 40℃ for 1h → Anhydrous ethanol I in thermostat at 40℃ for 30 minutes → Anhydrous ethanol II in thermostat at 40℃ for 30 minutes → Xylene I in thermostat at 40℃ for 20 minutes → Xylene II in thermostat at 40℃ for 20 minutes → Paraffin I melted at 65℃ for 30 minutes → Paraffin II melted at 65℃ for 30 minutes → Paraffin III melted at 65℃ for 30 minutes and above.

[0186] Embed the wax-soaked tissue in an embedding machine. First, put the melted wax into the embedding frame. Before the wax solidifies, take the tissue out of the dehydration box and put it into the embedding frame according to the requirements of the embedding surface and affix the corresponding label. Cool in a -20℃ freezer. After the wax solidifies, take the wax block out of the embedding frame and trim the wax block. Place the trimmed wax block on a paraffin slicer and slice it to a thickness of 5μm. Float the slices on the 40℃ warm water of the spreader to flatten the tissue, pick up the tissue with a slide, bake the slices in a 70℃ oven (30 minutes or more), bake the wax dry in water, take it out and stain it with Masson, and use Image J to evaluate the thickness. The results showed that the average thickness of the F2 test group was 1008.5µm, which was significantly better than the ECM+HA control group, whose average thickness was 668.2µm, and the thickness increased by 51%. TTest showed p<0.01, which was statistically significantly different. Measurement examples and comparisons are attached Figure 3 ,4,5.

[0187] Example 7: Animal test of composite filling product (F) (II) The composite filling product (F2) prepared in Example 5 was used as the test group, and the preparation prepared by mixing Examples 1 and 2 was used as the control group, with 3 animals in each group, for a total of 42 animals; the test was as follows: Step 1: Inject 0.5 ml of the sample to be tested subcutaneously behind the neck of 10-month-old BABL / c mice; each sample is injected into multiple sites.

[0188] Step 2: Result analysis: At 0, 4, 8, 16, 24, 36, and 48 weeks after the injection of the test sample, three animals were taken from each group and euthanized; the skin tissue at the injection site was taken and the subcutaneous fat was discarded; the remaining volume of the graft and the percentage of the implanted volume were measured and calculated. The volume percentages of the control group (B) and the test group (F2) at different stages after injection are shown in Table 2 below: .

[0189] It can be seen that the skin filling preparation prepared in Example 5 has a good effect, especially after the 8th week, the difference between the test group (F2) and the control group is significant; and it lasts until the 48th week. At the same time, after comparing with the control group (ECM+HA), a simple analysis shows that the three-in-one preparation of the present invention not only has a good physical filling effect, but also has a good and long-lasting function of promoting the secretion of new collagen, that is, it can promote the activity of skin cells for a longer time, and is also beneficial to the regeneration of various cells (including stem cells); it has a significant and long-lasting effect.

[0190] The skin filling preparation prepared by the present invention contains ECM powder and exosomes, especially M2c macrophage exosomes (regulating dermal cell vitality and promoting healing function), which not only retains the original physical filling, buffering and shaping effects of degradable glue and or ECM powder (powder is dissolved in vitro before injection, and then enters the body in a gelatinous state), but also can slowly release M2 macrophage exosomes. Different components have different targets and different working principles; but they can cooperate with each other and continuously endogenously stimulate the vitality of the implanted part, especially dermal cells, and promote their proliferation; or can stimulate fibroblasts to secrete collagen, elastin, etc., which is conducive to better maintaining and promoting the structure and function of tissues. For the skin, it presents lasting fullness, delays aging, and looks younger.

[0191] The content of the present invention is not limited to the content listed in the above embodiments, and the embodiments are only used as typical representatives and illustrations of the inventive concept. Ordinary technicians can obtain the same inventive ideas and direct inspiration by reading the specification of the present invention. Without creative thinking, they just use simple equivalent substitutions for the technical scheme of the present invention, such as simply replacing it with other animal tissue sources or other types of natural extracellular matrix powders, or on this basis, repeatedly adding various exogenous cell growth promoting factors. Such simple replacement or transformation should be within the scope of protection of the claims of the present invention. The inventive idea can also be simply extended to the field of filling materials used for other skin micro-beauty or whole-body cosmetic surgery; that is, it only needs to make a simple adjustment to the ratio of degradable glue and active decellularized matrix powder, and it can be applied to other implant filling or tissue regeneration fields.

Claims

1. A tissue repair preparation, characterized in that: The preparation comprises at least three components: decellularized matrix (ECM), exosomes and degradable glue.

2. The ECM according to claim 1, characterized in that The ECM is derived from mammalian tissue, including pericardium, peritoneum, amnion, placenta, umbilical cord, SIS, UBM, ADM or a combination thereof, and is treated by a decellularization method; the decellularization method is to use one of physical, chemical or bioenzymatic methods or a combination thereof to decellularize.

3. The ECM according to claim 1, characterized in that The ECM is in the form of microparticles or granules with a particle size of 0.05-0.25 mm; the content of the ECM is 1-5% (w / w), preferably 1-3% (w / w).

4. The ECM according to claim 1, characterized in that The animal tissue at least includes dermis or SIS derived from an immature animal in late embryonic, infant or adolescent stage.

5. The exosome according to claim 1, characterized in that The exosomes are exosomes secreted by cells that promote tissue healing.

6. The exosome according to claim 5, characterized in that The exosomes are human commercial M2 macrophages, which are cultured in vitro, polarized and induced into M2c macrophages, and then cultured for 48-96 hours and purified by centrifugation to obtain M2c macrophage exosomes.

7. The exosome according to claim 1, characterized in that The exosomes are at least modified with polyethylene glycol.

8. The composite formulation according to claim 1, characterized in that The auxiliary agent includes one or a combination of anesthetics, antioxidants, and exogenous drugs that play a secondary role, or other cytokines derived from fibroblasts and / or stem cells.

9. A method for preparing a tissue repair preparation, characterized in that , including the following steps: The first step is to prepare ECM, taking at least one or a combination of SIS, UBM, ADM, pericardium, peritoneum, amnion, placenta, and umbilical cord containing some young animals, decellularizing them in a gentle manner, and then performing corresponding physical operations according to the required physical state to prepare corresponding dosage forms; the preferred physical operation is low-temperature or ultra-low-temperature crushing; the second step is to prepare exosomes, taking human commercial cells, culturing them in vitro, directing induction, continuing to culture for 2-4 days, and collecting the supernatant; centrifugation, purification or re-modification; the third step is to prepare degradable glue; polysaccharides are made into gels at the required concentration; further, they can be made into single-phase glue without cross-linking, or cross-linked and non-cross-linked blends can be made into two-phase glue; the first three steps are independent of each other, and the order can be interchanged in any way; the fourth step is to mix the ECM powder and exosomes prepared in the previous step, and then fully mechanically mix them with the obtained degradable glue to obtain the final tissue repair preparation.

10. Use of a tissue repair preparation, the repair preparation being any one of claims 1 to 8, characterized in that , can be used to repair tissue defects, repairs and fillings in the forehead, eyes, nose, oral soft tissue, gingival papilla, neck, chest, nerves, dura mater, spinal dura mater, tendons, ligaments, urinary tract, bladder, ureter, inguinal hernia, hiatal hernia, abdominal wall hernia, breast or uterine mucosa or a combination thereof.

Images