SNP (Single Nucleotide Polymorphism) molecular marker related to pear fruit peel color and application

Abstract

The invention belongs to the technical field of molecular biology, and discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pear fruit peel color and application. The locus of the SNP molecular marker is located at the 23.789257Mb position of the No.8 chromosome of the 20-century pear PPYr1.0 genome, and the nucleotide at the SNP locus is T in green-peel pears and C in brown-peel pears. The molecular marker disclosed by the invention is closely related to the color character of the pear fruit peel; by detecting the SNP marker, early prediction and rapid screening of the pear fruit peel color can be realized, the breeding process of pear variety improvement is accelerated, and the SNP marker has important scientific value and economic value.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker related to the peel color of a pear fruit and an application thereof. Background Art

[0002] Pear (Pyrus L.) belongs to the genus Pyrus in the Rosaceae family. It is one of the most important deciduous fruit trees in the world and is widely planted worldwide. The cultivated types of pears are rich and diverse. According to their native distribution, they can be divided into two major categories: Western pears and Oriental pears. The pear industry has become an important industry in my country's agricultural economic structure, and the important factor affecting the industry's benefits is fruit quality. Fruit quality includes fruit appearance quality, internal quality, storage quality and processing quality. Appearance quality is an important condition for the commercial value of fruits, among which the smoothness of the fruit surface and the color of the fruit skin are important factors affecting the appearance quality.

[0003] The characteristics of pear peel are mainly composed of factors such as skin color, fruit spot size and density, fruit surface wax, and skin rust. Consistent skin color and no fruit rust are important indicators of high-quality commercial pears. Among them, green-skinned fruits have beautiful appearance and are very popular in the international market. Fruit color is mainly determined by the content and proportion of three major types of plant pigments: chlorophyll, carotenoids, and phenolic pigments. Among many pear cultivars, brown peel is the unique fruit peel color of sand pear. Brown peel not only affects the appearance quality of the fruit, but also affects the internal quality. Many sand pear varieties, although most of the fruit surface is yellow-green (or green), often have brown rust spots distributed irregularly. Studies have shown that the formation of pear brown skin is not the result of pigment accumulation, but is essentially caused by the accumulation of cork layer in the peel after damage to the cuticle and epidermal cells. This makes the formation of pear brown not only different from other pears in terms of fruit color, but also different from other fruit color formation in terms of formation mechanism. However, the genetic law of fruit skin brown is not yet fully understood.

[0004] In the breeding process, the fruit color is still mostly determined by the appearance of the fruit when it is ripe, which is time-consuming. Conducting in-depth research on the color traits of pear fruit peel and developing molecular markers that are closely linked to the color traits of pear fruit peel can greatly shorten the breeding process and improve the accuracy of selection. Summary of the invention

[0005] One of the purposes of the present invention is to provide a SNP site associated with the peel color of pear fruit and a SNP molecular marker developed based on the site.

[0006] The second object of the present invention is to provide the above-mentioned SNP site and the application of the SNP molecular marker based on the site in pear molecular breeding.

[0007] The third object of the present invention is to provide a method for identifying the variety / genotype of pear fruit peel color brown or green.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] A SNP molecular marker associated with the skin color of pear fruit, wherein the SNP locus of the SNP molecular marker is located in the PPY r1.0 genome at chromosome 8, base 23789257; the polymorphism at the SNP site is T / C. The material of the T genotype exhibits the trait that the fruit peel is green, and the material of the C genotype exhibits the trait that the fruit peel is brown. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The polymorphic site of the SNP molecular marker is located at the 150th position of the sequence shown in SEQ ID NO.1, and the polymorphism is a base mutation of T→C.

[0010] The present invention also provides a primer pair for detecting the SNP molecular marker, comprising a forward primer F having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer R having a nucleotide sequence as shown in SEQ ID NO.3.

[0011] SEQ ID NO.2: CAAGCTTGGCCAGCACGAT;

[0012] SEQ ID NO. 3: ACATTGTACGTGGTCTCTTTAGCA.

[0013] Furthermore, the primer pair is used to perform PCR amplification on the pear genomic DNA and the amplification product is subjected to Sanger sequencing. If the 150th base of the cloned product is T, the peel color of the pear fruit material to be tested is green; if the 150th base of the amplified product is C, the peel color of the pear fruit material to be tested is brown.

[0014] The present invention also provides the use of the primer pair in pear breeding, more specifically, for identifying or assisting in identifying the color trait / genotype / variety of the peel of pear fruit.

[0015] The present invention also provides a kit for detecting the above molecular markers, wherein the kit comprises the above primer pair.

[0016] The present invention also provides the use of the kit in pear breeding, which is mainly used for identifying or assisting in identifying the pear fruit peel color trait / genotype / variety.

[0017] The present invention also provides a method for detecting the color trait of pear fruit peel using the molecular marker, the method comprising the following steps:

[0018] (1) Extract DNA from pear tissue;

[0019] (2) PCR amplification: using a primer pair with an upstream primer sequence of the SNP molecular marker as shown in SEQ ID NO.2 and a downstream primer sequence as shown in SEQ ID NO.3, PCR amplification is performed on the sample extracted in step (1) to obtain an amplified product;

[0020] The reaction system of the PCR amplification is: DNA template 0.5 μL, forward primer F 0.5 μL, reverse primer R 0.5 μL, 2× Es Taq Mastermix 5 μL, RNase Free water 3.5 μL, total volume 10 μL. PCR amplification conditions are: 95.0°C, 5 min; 95.0°C, 30 s, 56.0°C, 30 s, 72.0°C, 30 s, 35 cycles; 72.0°C, 5 min; 12.0°C storage.

[0021] (3) Perform Sanger sequencing on the amplified product;

[0022] (4) Make a judgment based on the result of step (3), and the specific criteria are:

[0023] If the 150th base of the cloning product is T, the peel color of the pear fruit material to be tested is green; if the 150th base of the amplification product is C, the peel color of the pear fruit material to be tested is brown.

[0024] Therefore, according to the Sanger sequencing results, the genotype corresponding to the site can be quickly known, and then the peel color of the pear fruit material to be tested can be quickly determined. Wherein, the genotype of the polymorphic site of the SNP molecular marker is TT, corresponding to the green trait, and the genotype is CC or CT, corresponding to the brown trait.

[0025] More specifically, when the genotype is TT, the pear material is a homozygous green peel material, when the genotype is CC, the pear material is a homozygous brown peel material, and when the genotype is TC, the pear material is a heterozygous brown peel material.

[0026] Compared with the prior art, the SNP molecular marker related to the peel color of pear fruit provided by the present invention has the following advantages:

[0027] The present invention uses a whole genome association analysis method to screen a SNP site related to the peel color of pear fruit on chromosome 8 of pear, wherein the genotype T of the SNP site is green peel, and the genotype C is brown peel. This is used as an auxiliary selection marker for the peel color trait in the pear breeding process, and the required plants can be identified in the early stage, which not only reduces the floor space in the breeding process, but also reduces the manpower and material resources required for identification after the plants grow up, greatly improves the breeding efficiency, and shortens the selection period. Therefore, the SNP molecular marker provided by the present invention has good application value in the breeding of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The phenotypes of 108 pear materials used for genome-wide association analysis are shown in Figure 2.

[0029] Figure 2 Manhattan plot of genome-wide association analysis of pear fruit skin color traits;

[0030] Figure 3 The bar graph A and pie chart B show the genotypes of the significantly associated SNP loci corresponding to the pear fruit skin color;

[0031] Figure 4 This is the partial sequence alignment result of green-skin pear materials and brown-skin pear materials in the pear fruit peel color-related region. DETAILED DESCRIPTION

[0032] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0033] Example 1 Identification of SNP loci for pear fruit peel color

[0034] The phenotypes of 108 pear materials (all materials are from germplasm resource banks, and the germplasm bank number of each material is shown in the figure) are as follows Figure 1 As shown in the figure, the fruit peel color showed two phenotypes, one of which was green and the other was brown. The leaf tissues were collected and sent to Biomark for whole genome resequencing. The SNP loci genotype data were analyzed by using the general linear model GLM+PCA of TASSEL5.0 software to mine the SNP loci related to the pear fruit peel color. When the P value of the detected variant site was less than 5.46×10 -12 In this study, a locus located at PPY The SNP site at the 23789257th base on chromosome 8 of the r1.0 genome, the difference in T / C of the SNP site is ( Figure 2 ).

[0035] like Figure 3 As shown, when the genotype of the SNP site is T, the fruit peel shows a green trait; and when the genotype of the SNP site mutates from T to C, the fruit peel shows a brown trait.

[0036] Example 2 Verification of SNP loci for pear fruit peel color

[0037] (1) Test materials

[0038] Ten germplasm materials were randomly selected, and the genotypes corresponding to their fruit peel color and SNP loci are shown in Table 1.

[0039] Table 1 Fruit peel color and genotypes corresponding to SNP loci in 110 germplasm materials

[0040] Germplasm name Peel color genotype W084 green T / T W122 green T / T W145 green T / T W152 green T / T W189 green T / T W067 brown T / C W127 brown T / C W134 brown C / C W244 brown T / C W255 brown T / C

[0041] SEQ ID NO.1: CAAGCTTGGCCAGCACGATGGCCCTTGGCCATGTTTTGCCTTTGTGTGCTCCAATGATTATTAGCCCACCTTTCAGCTGAAGAGGAGTTTTGTCTAAATCAGGCCATATTTTGGCACTTTAATCTTTTGGCTCTTTACTGGAGA TGGTCTTAGTAACACCCCGTGACTTAAGAAACAAATTTTTCTTACGGAAAATCACGATTGTGATAACATAACTTCGAGTGTTTCGTTGGTTTAACTTCCAAGCATGCATTTTGGTTTCATTAAAAAAATGCTAAAGAGACCACGTACAATGT

[0042] The molecular markers shown in SEQ ID NO.1 were used to detect the 10 pear materials. The specific detection steps are as follows:

[0043] 1. Extract pear genomic DNA from the above 10 samples;

[0044] 2. Design forward primer F and reverse primer R;

[0045] The nucleotide sequence of the forward primer F is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.3;

[0046] SEQ ID NO.2: CAAGCTTGGCCAGCACGAT;

[0047] SEQ ID NO.3: ACATTGTACGTGGTCTCTTTAGCA;

[0048] 3. PCR amplification

[0049] PCR amplification was performed on all pear genomic DNA samples to be tested using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3.

[0050] The amplification system was as follows: DNA template 0.5 μL, forward primer F 0.5 μL, reverse primer R 0.5 μL, 2×Es TaqMastermix 5 μL, RNase Free water 0.5 μL;

[0051] The amplification program was: 95.0°C, 5 min; 95.0°C, 30 s, 56.0°C, 30 s, 72.0°C, 30 s, 35 cycles; 72.0°C, 5 min; 12.0°C, storage.

[0052] 4. Result judgment

[0053] After the reaction, the reaction product was sent to Sangon Biotech Co., Ltd. for first generation sequencing and genotyping identification. The Sanger sequencing results of the genotype of the SNP loci related to the peel color of the pear fruit material are as follows: Figure 4 Combining Table 1 and Figure 4 , it can be seen that the detected genotype results are completely consistent with the actual phenotype.

[0054] It can be seen that the SNP loci obtained by GWAS can accurately identify the peel color of pear fruit materials in another independent verification. The results show that the molecular markers screened by the present invention can be applied to the molecular marker-assisted selection of the peel color trait of pear fruit materials to improve the accuracy of selection and shorten the years.

[0055] It should be noted that, in order to avoid redundancy, the preferred embodiments of the present invention are described, but once those skilled in the art know the basic creative concept, they can make other changes and modifications to these embodiments. Therefore, the attached claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0056] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A SNP molecular marker associated with the color of pear fruit peel, characterized in that: The polymorphic site of the SNP molecular marker is located at the 23.789257Mb position of chromosome 8 of the PPYr1.0 genome of the twentieth century pear; the nucleotide at this site is T or C.

2. The SNP molecular marker according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the polymorphic site is located at the 150th position of the SEQ ID NO.1 sequence.

3. The molecular marker according to claim 2, characterized in that The nucleotide sequence of the forward primer F of the primer pair for amplifying the SNP molecular marker is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.

3.

4. Use of the SNP molecular marker according to any one of claims 1 to 3 in molecular marker-assisted breeding related to the peel color of pear fruits.

5. The use according to claim 4, characterized in that: The SNP molecular marker is used to identify or assist in identifying the pear fruit skin color trait / genotype / variety.

6. A method for determining the color properties of pear fruit peel, characterized in that: The method comprises the following steps: (1) extracting genomic DNA of pear samples to be tested; (2) using the genomic DNA extracted in step (1) as a template and the primer pair of the SNP molecular marker described in claim 3, performing PCR amplification on the sample extracted in step (1) to obtain an amplified product; (3) Perform Sanger sequencing on the amplified product; (4) Determine according to the sequencing results of step (3), the specific criteria are: If the 150th base of the cloning product is T, the peel color of the pear fruit material to be tested is green; if the 150th base of the amplification product is C, the peel color of the pear fruit material to be tested is brown.

7. The method according to claim 6, characterized in that The reaction system of the PCR amplification is: 0.5 μL of DNA template, 0.5 μL of forward primer F, 0.5 μL of reverse primer R, 5 μL of 2×Es Taq Mastermix, 3.5 μL of RNase Free water, and a total volume of 10 μL; the PCR amplification conditions are: 95.0°C, 5 min; 95.0°C, 30 s, 56.0°C, 30 s, 72.0°C, 30 s, 35 cycles; 72.0°C, 5 min; and stored at 12.0°C.

8. A kit for detecting the molecular marker according to claim 1 or 2, characterized in that: The kit comprises a primer pair for the SNP molecular marker according to claim 3.

9. Use of the kit according to claim 8 in identifying the peel color trait / genotype of pear fruit.

10. The use according to claim 9, characterized in that: The genotype of the polymorphic site of the SNP molecular marker is T / T, corresponding to the green trait, and the genotype is C / C or C / T, corresponding to the brown trait.

Images