High-temperature-resistant beta-mannase mutant and preparation method thereof

Abstract

The invention discloses a high temperature resistant beta-mannase mutant and a preparation method thereof, wild type beta-mannase comes from Coprinus cinerea, the wild type beta-mannase is modified by using a directed evolution means to obtain the high temperature resistant beta-mannase mutant, and the mutation of the mutant comprises at least one of N381K, R123Y and M439L. The beta-mannase mutant has good thermal stability under the alkaline condition and longer heating time, the enzyme activity of the mutant is improved by 107.0% compared with that of an original enzyme when the beta-mannase mutant is treated for 2 h at the high temperature of 90 DEG C in a buffer solution with the pH value of 10, the capacity of catalyzing beta-mannase hydrolysis by the enzyme mutant is obviously improved, and the beta-mannase mutant has wide application prospects.

Description

Technical Field

[0001] The invention relates to a beta-mannanase mutant and a preparation method thereof, in particular to a high temperature resistant beta-mannanase mutant and a preparation method thereof, belonging to the technical field of enzyme engineering and gene engineering. Background Art

[0002] β-Mannanase (EC3.2.1.78) is a hydrolase that specifically hydrolyzes β-1,4-mannan and belongs to the glycoside hydrolase family. Mannan is the second largest complex in hemicellulose after xylan and is also one of the common carbohydrates in plant cell walls. It is connected by β-1,4-glycosidic bonds to form the basic skeleton of the main chain. β-Mannanase can cut the β-1,4-glycosidic bonds in mannan molecules and decompose complex polysaccharides into simple oligosaccharides or even monosaccharide mannose. Therefore, it is widely used in industry, such as improving food texture, increasing the digestibility and absorption rate of animal feed, reducing the use of chemicals in the papermaking process, and improving the efficiency of cellulosic ethanol production. However, the existing β-mannanase has poor heat resistance and cannot maintain stable biological activity during production, transportation and application, which seriously limits the application of this enzyme.

[0003] Patent application CN115044634A discloses an application of a mannanase from Coprinus cinereus. The gene encoding mature mannanase from Coprinus cinereus was introduced into Pichia pastoris by genetic engineering and fermented to obtain mannanase. The enzyme was applied to the fine structure identification of β-galactomannan and the preparation of mannobiose in the hydrolysis of β-galactomannan. However, the technology did not improve the heat resistance of mannanase. Patent application CN107400665A discloses a site-directed mutagenesis mannanase and its application. The site-directed mutagenesis of the β-mannanase MAN47 gene from Pseudomonas aeruginosa was performed, and the isoleucine at position 197 was replaced by leucine, the lysine at position 280 was replaced by asparagine, and the valine at position 380 was replaced by alanine. The obtained β-mannanase MAN47 mutant has the advantages of high temperature resistance, wide pH stability, and improved tolerance to trypsin. However, the thermal stability test of this mutant was carried out under incubation conditions of pH 5.0 for 30 minutes, so its thermal stability under alkaline conditions and longer heating times is not clear. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a β-mannanase mutant having good thermal stability under alkaline conditions and longer heating time, and to provide related nucleotide sequences, recombinant vectors, recombinant cells and preparation methods.

[0005] Technical solution: The thermostable β-mannanase mutant of the present invention is obtained by amino acid substitution of the sequence shown in SEQ ID NO.1, wherein the substitution is at least one of N381K, R123Y and M439L.

[0006] The present invention uses the β-mannanase of Coprinopsis cinerea as the original enzyme (wild type), the amino acid sequence of which is SEQ ID NO.1, and the gene sequence encoding the enzyme is SEQ ID NO.2. At least one amino acid in the 381st, 123rd and 439th positions of the enzyme is replaced to obtain the thermostable β-mannanase mutant, wherein the replacement is specifically: the 381st asparagine is replaced by lysine; the 123rd arginine is replaced by tyrosine; the 439th methionine is replaced by leucine. The obtained thermostable β-mannanase mutant has good thermal stability under alkaline conditions and longer heating time.

[0007] The present invention uses the standard single-letter code for amino acids, for example: N381K means that the asparagine (N) at position 381 of the N-terminus is changed to lysine (K); N381K-R123Y means that the asparagine (N) at position 381 of the N-terminus is changed to lysine (K), and the arginine (R) at position 123 of the N-terminus is mutated to tyrosine (Y).

[0008] The present invention also provides a nucleotide sequence encoding the β-mannanase mutant. The nucleotide sequence can be obtained by base mutation of the sequence shown in SEQ ID NO.2.

[0009] The present invention also provides a recombinant vector comprising the nucleotide sequence. The recombinant vector may be a plasmid or a virus, and can maintain replication ability, amplify or express the nucleotide sequence in a host cell.

[0010] Preferably, the recombinant vector includes a cloning vector or an expression vector.

[0011] The present invention also provides a recombinant cell, comprising the recombinant vector. The recombinant cell can be E. coli DH5α.

[0012] The present invention also provides a method for preparing the β-mannanase mutant, comprising the following steps:

[0013] (1) Using the β-mannanase gene as a template, a PCR reaction was performed using point mutation primers to obtain a mutant gene;

[0014] (2) inserting the mutant gene into an expression vector and transferring it into a host cell to obtain a recombinant cell;

[0015] (3) culturing the recombinant cells and inducing expression of the β-mannanase mutant.

[0016] Preferably, in step (1), the base sequence of the β-mannanase gene is as shown in SEQ ID NO.2.

[0017] Preferably, in step (2), the mutant gene is inserted into an expression vector using a DNA homologous recombination method.

[0018] Preferably, in step (3), after expression is completed, the cells are collected; or the cells are broken and the crude enzyme solution of the original enzyme is collected; or the cells are broken and the crude enzyme solution of the β-mannanase mutant is collected.

[0019] Preferably, in step (1), the primers are designed by modeling and predicting the 3D model of the original enzyme:

[0020] Primer name Sequence (5'-3') N381K-F CGTGACCACCAAAAAAACCGGCGGTGTATAC N381K-R GCCGGTTTTTTGGTGGTCACGCCATATTCTTC R123Y-F CTGAGCGGCCATAGCTATGATAACATGAACCGC R123Y-R CATGTTATCATAGCTATGGCCGCTCAGGCCC M439L-F GCCGCGCTCAAAGCGCGCGGCCTCGAG M439L-R CCGCGCGCTTTGAGCGCGGCCGCATG

[0021] Preferably, in step (1), the PCR reaction system is:

[0022]

[0023] Preferably, in step (1), the conditions of the PCR reaction are:

[0024]

[0025] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: the β-mannanase mutant has good thermal stability under alkaline conditions and longer heating time. In a pH 10 buffer, after high-temperature treatment at 90°C for 2h, the enzyme activity of the mutant is increased by 89% compared with the original enzyme. The ability of the enzyme mutant to catalyze the hydrolysis of β-mannanase is significantly improved, and it has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the protein structure of the original β-mannanase;

[0027] Figure 2 Standard curve for colorimetric determination of glucose -540nm;

[0028] Figure 3 Schematic diagram of the specific enzyme activity of the original β-mannanase under different pH conditions;

[0029] Figure 4 Schematic diagram of the relative enzyme activities of the original β-mannanase and enzyme mutants under different temperature conditions. DETAILED DESCRIPTION

[0030] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0031] Sources or ingredients of materials used in the examples:

[0032] 1. Strains and plasmids

[0033] The synthesis of pET-22b(+) plasmid carrying the original Coprinopsis cinerea β-mannanase gene, the synthesis of mutation primers and plasmid construction primers, and the sequencing of gene sequences in the plasmid were completed by Genewise (Suzhou). The pET-22b(+) plasmid expressing the β-mannanase mutant was constructed by the applicant.

[0034] The strain E. coli DH5α was used for plasmid construction (purchased from Shenzhen Kangti Life Science Technology Co., Ltd.), and the strain E. coli BL21 (DE3) was used for foreign protein expression (purchased from Shenzhen Kangti Life Science Technology Co., Ltd.).

[0035] 2. Experimental reagents and culture medium

[0036] The main experimental reagents include: the enzymes and buffer components used in PCR are from MutUFO Fast Mutagenesis Kit (Nanjing Jujiang Biotechnology), plasmid extraction kit (Shanghai Bioengineering), DNA Marker (Shanghai Bioengineering), endonuclease DpnI (Adamas). Other conventional reagents are domestic analytical grade.

[0037] LB liquid medium: 5g / L yeast powder, 10g / L tryptone, 5g / L NaCl. If using LB solid medium, add 15g / L agar powder.

[0038] TB liquid culture medium: yeast powder 12 g / L, trypsin 12 g / L, glycerol 4 ml / L, dipotassium hydrogen phosphate 12.5 g / L, potassium dihydrogen phosphate 2.3 g / L.

[0039] Comparison of specific enzyme activity of original β-mannanase under different pH conditions:

[0040] The original β-mannanase was treated with 0.1M glycine-sodium hydroxide buffer at pH 7.0, 8.0, 9.0, 10.0, and 11.0, and the residual enzyme activity was determined by the DNS method. The DNS method is one of the commonly used methods for determining enzyme activity, which is based on the coloring reaction between the reducing sugar produced by the enzyme-catalyzed reaction and dithiobarbituric acid (DNS) under alkaline conditions.

[0041] The specific method is as follows:

[0042] Take 30 μL of crude enzyme solution and add it to 120 μL of 1% carob bean gum solution and blow it evenly. After reacting at 65°C for 30 minutes, add 150 μL of DNS solution. Treat the mixed solution in a boiling water bath for 10 minutes, immediately cool it to room temperature in an ice bath, and measure its absorbance at 540 nm. In the negative control experiment, the crude enzyme solution was replaced with buffer solution, and the rest of the operations were the same. Prepare 0.7000, 0.5000, 0.2500, 0.1250, and 0.1000 mg / mL glucose standard solutions, take 150 μL and use the above treatment method to obtain the glucose-540nm standard curve, as shown in the figure. Figure 2 As shown. Definition of crude enzyme activity: Under enzymatic reaction conditions, the amount of enzyme required to catalyze the hydrolysis of carob bean gum to produce 1 nmol of glucose per 1 min is one enzyme activity unit (U). Specific enzyme activity is the catalytic ability of the enzyme per unit volume of crude enzyme solution (U / mL); the specific enzyme activity of crude enzyme solution is calculated based on the absorbance value at 540nm and the standard curve. The results are shown in Figure 3 As shown: compared with buffers of other pH values, the original β-mannanase still maintains a higher enzyme activity in a buffer of pH 10.0, so the original enzyme has good alkali resistance, and the subsequent heat-resistant reactions are all carried out in a buffer of pH 10.0.

[0043] Example 1: A thermostable β-mannanase mutant N381K

[0044] In this example, the β-mannanase of Coprinopsis cinerea was used as the original enzyme, and the asparagine at position 381 of the N-terminal of its amino acid sequence was mutated to lysine. The preparation method is as follows: (1) preparing a mutant gene and constructing a recombinant plasmid; (2) constructing a recombinant cell to express the β-mannanase mutant. The details are as follows:

[0045] (1) Preparation of mutant genes and construction of recombinant plasmids

[0046] The primers for the N381K mutation site are shown in Table 1. PCR was performed using the pET-22b(+) plasmid carrying the original β-mannanase gene as a template. The PCR system is shown in Table 2, and the PCR reaction conditions are shown in Table 3.

[0047] Table 1 Primers for point mutation and plasmid construction

[0048] Primer name Sequence (5'-3') N381K-F CGTGACCACCAAAAAAACCGGCGGTGTATAC N381K-R GCCGGTTTTTTGGTGGTCACGCCATATTCTTC

[0049] Note: The underlined part in the primers indicates the mutation site, “F” represents the upstream primer and “R” represents the downstream primer.

[0050] Table 2 PCR reaction system

[0051]

[0052]

[0053] Table 3 PCR reaction conditions

[0054]

[0055] After the PCR product was verified by nucleic acid electrophoresis, the template was digested with endonuclease DpnI. The reaction system was prepared as shown in Table 4 and digested at 37°C for 1-2h.

[0056] Table 4 Template digestion system

[0057] Composition content DpI 1μl PCR products 0.06pmol

[0058] After template digestion, the product was subjected to DNA homologous recombination. The reaction system was prepared as shown in Table 5, and the reaction was carried out at 37°C for 30 minutes for one-step cloning to construct the expression plasmid of the mutant enzyme.

[0059] Table 5 Homologous recombination system

[0060] Composition content DpnI digest 0.06pmol 5×UFOBuffer 4μl UvsXase 2μl ddH2O to20μl

[0061] The obtained plasmid was transformed into the engineering bacterium E. coli DH5α for amplification, and the recombinant plasmid was extracted and sequenced for verification.

[0062] (2) Construction of recombinant cells expressing β-mannanase mutants

[0063] Transfer the recombinant plasmid into the expression host E.coli BL21 (DE3), and spread it on an LB plate containing 100 ng / mL ampicillin for screening. Inoculate the transformant into 5 mL of LB liquid medium containing 100 ng / mL ampicillin, and culture it overnight at 37°C and 140 rpm in a shaker. Take 2.5 mL of the bacterial solution and inoculate it into 50 mL of TB liquid medium containing 100 ng / mL ampicillin, and culture it at 37°C and 140 rpm in a shaker for 6 hours. Add the filtered and sterilized IPTG to the fermentation broth to a final concentration of 0.4 mM, and continue to culture it at 22°C and 140 rpm for 22 hours.

[0064] The fermentation broth of the recombinant bacteria was transferred to a centrifuge tube and centrifuged at 11,000 rpm to collect the cells. The cells were resuspended in 20 mL of pH 10.0 buffer, and the cells were broken by ultrasonication for 10 min. The cells were centrifuged again at 12,000 rpm to remove the cell debris. The resulting supernatant was the crude enzyme solution containing the β-mannanase mutant.

[0065] Example 2: A thermostable β-mannanase mutant R123Y

[0066] This example uses the same original enzyme as in Example 1, and mutates the arginine at position 123 of the N-terminal amino acid sequence to tyrosine. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 6:

[0067] Table 6 Point mutation primers and plasmid construction primers

[0068] Primer name Sequence (5'-3') R123Y-F CTGAGCGGCCATAGCTATGATAACATGAACCGC R123Y-R CATGTTATCATAGCTATGGCCGCTCAGGCCC

[0069] Example 3: A thermostable β-mannanase mutant M439L

[0070] This example uses the same original enzyme as in Example 1, and mutates the methionine at position 439 of the N-terminal amino acid sequence to leucine. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 7:

[0071] Table 7 Point mutation primers and plasmid construction primers

[0072] Primer name Sequence (5'-3') M439L-F GCCGCGCTCAAAGCGCGCGGCCTCGAG M439L-R CCGCGCGCTTTGAGCGCGGCCGCATG

[0073] Example 4: A thermostable β-mannanase mutant N381K-R123Y

[0074] This example uses the same original enzyme as in Example 1, and mutates the asparagine at position 381 of the N-terminal amino acid sequence to lysine, and mutates the arginine at position 123 to tyrosine. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 8:

[0075] Table 8 Point mutation primers and plasmid construction primers

[0076] Primer name Sequence (5'-3') N381K-F CGTGACCACCAAAAAAACCGGCGGTGTATAC N381K-R GCCGGTTTTTTGGTGGTCACGCCATATTCTTC R123Y-F CTGAGCGGCCATAGCTATGATAACATGAACCGC R123Y-R CATGTTATCATAGCTATGGCCGCTCAGGCCC

[0077] Example 5: A thermostable β-mannanase mutant N381K-R123Y-M439L

[0078] This example uses the same original enzyme as in Example 1, and mutates the asparagine at position 381 of the N-terminal amino acid sequence to lysine, the arginine at position 123 to tyrosine, and the methionine at position 439 to leucine. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 9:

[0079] Table 9 Point mutation primers and plasmid construction primers

[0080] Primer name Sequence (5'-3') N381K-F CGTGACCACCAAAAAAACCGGCGGTGTATAC N381K-R GCCGGTTTTTTGGTGGTCACGCCATATTCTTC R123Y-F CTGAGCGGCCATAGCTATGATAACATGAACCGC R123Y-R CATGTTATCATAGCTATGGCCGCTCAGGCCC M439L-F GCCGCGCTCAAAGCGCGCGGCCTCGAG M439L-R CCGCGCGCTTTGAGCGCGGCCGCATG

[0081] Performance test: Testing enzyme activity at different temperatures

[0082] The original β-mannanase crude enzyme solution and the β-mannanase mutant prepared in Example 1-5 were treated with 0.1M glycine-sodium hydroxide buffer at pH 10.0 at 70°C, 80°C, and 90°C for 2 hours, and the residual enzyme activity was determined by the DNS method. The test results are shown in Figure 4 As shown in Table 10.

[0083] Table 10 Enzyme activity of β-mannanase at different temperatures at pH 10.0

[0084] strain Relative activity at 70℃ Relative activity at 80℃ Relative activity at 90℃ WT 100％ 52％ 43％ N381K 141％ 117％ 69％ R123Y 138％ 102％ 64％ M439L 125％ 96％ 61％ N381K-R123Y 164％ 131％ 75％ N381K-R123Y-M439L 182％ 145％ 89％

[0085] Depend on Figure 4 It can be seen that in a buffer solution with a pH of 10.0, after high temperature treatment at 90°C for 2h, the mutants all had higher enzyme activity than the original β-mannanase. Among them, the mutant enzyme N381K-R123Y-M439L had the best enzyme activity, which was increased by 107.0% relative to the original enzyme activity.

Claims

1. A thermostable β-mannanase mutant, characterized in that: It is obtained by amino acid substitution of the sequence shown in SEQ ID NO.1, and the substitution is at least one of N381K, R123Y, and M439L.

2. A nucleotide sequence, characterized in that Encoding the β-mannanase mutant according to claim 1.

3. A recombinant vector, characterized in that: Comprising the nucleotide sequence of claim 2.

4. The recombinant vector according to claim 3, characterized in that This includes cloning vectors or expression vectors.

5. A recombinant cell, characterized in that Comprising the recombinant vector according to claim 3.

6. A method for preparing the β-mannanase mutant according to claim 1, characterized in that: The steps include: (1) Using the β-mannanase gene as a template, a PCR reaction was performed using point mutation primers to obtain a mutant gene; (2) inserting the mutant gene into an expression vector and transferring it into a host cell to obtain a recombinant cell; (3) culturing the recombinant cells and inducing expression of the β-mannanase mutant.

7. The preparation method according to claim 6, characterized in that: In step (1), the base sequence of the β-mannanase gene is shown as SEQ ID NO.

2.

8. The preparation method according to claim 6, characterized in that: In step (2), the mutant gene is inserted into an expression vector using a DNA homologous recombination method.

9. The preparation method according to claim 6, characterized in that: In step (3), after the expression is completed, the cells are collected; or the cells are broken and the crude enzyme solution is collected; or the cells are broken and the separated and purified β-mannanase mutant is collected.

10. The preparation method according to claim 6, characterized in that: In step (1), the primer is: 。

Images