Ornithine decarboxylase mutant, genetically engineered bacterium for expressing ornithine decarboxylase mutant and application of ornithine decarboxylase mutant

Abstract

The invention belongs to the technical field of gene engineering and enzyme engineering, and particularly relates to an ornithine decarboxylase mutant as well as a coding gene, an expression vector, a recombinant strain and application thereof. The ornithine decarboxylase mutant is obtained by mutating wild ornithine decarboxylase ODC10 of which the amino acid sequence is shown as SEQ ID NO.1, the catalytic activity of the obtained mutant is improved, and the biosynthesis efficiency of 1, 4-butanediamine is favorably improved. The recombinant strain for expressing the ornithine decarboxylase mutant constructed by the invention can efficiently synthesize 1, 4-butanediamine, and the molar conversion rate of ornithine is remarkably improved, so that the production benefit is improved, and the production cost is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and enzyme engineering, and specifically relates to an ornithine decarboxylase mutant and its encoding gene, expression vector, recombinant strain and application. Background Art

[0002] 1,4-Butanediamine, also known as putrescine, is widely used and has important value in medicine, agriculture, and industry. It can also be used in the fields of pharmaceuticals, surfactants, and crops. In addition, 1,4-Butanediamine can be condensed with adipic acid to synthesize nylon-46. Nylon-46 has the advantages of high temperature resistance, high mechanical strength, and wear resistance, and is widely used in the production of electronic and electrical components, automotive heat dissipation, gears and other components, and synthetic polyamide fibers. The current market demand for 1,4-Butanediamine is about 10,000 tons per year, and the price per ton in Europe exceeds 2,500 euros, and it is likely to continue to grow.

[0003] The large-scale industrial production of 1,4-butanediamine mainly relies on chemical synthesis based on petrochemicals, but the reaction conditions are harsh and have certain damage to the human body and the environment. Microbial fermentation can convert renewable raw materials into 1,4-butanediamine, which has many advantages such as green environmental protection and sustainable development. It is an inevitable trend for the green production of 1,4-butanediamine.

[0004] One of the keys to efficiently accumulate 1,4-butanediamine by microbial fermentation is to improve the catalytic activity of key enzymes in the biosynthetic pathway. Ornithine decarboxylase (ODC) uses pyridoxal phosphate as a cofactor to catalyze the decarboxylation of ornithine to produce 1,4-butanediamine, and is the key rate-limiting enzyme in the biosynthetic metabolic pathway of 1,4-butanediamine. Ornithine decarboxylase exists in large quantities in microorganisms, and researchers have isolated and cloned ornithine decarboxylase genes from a variety of microorganisms such as Escherichia coli and lactic acid bacteria. However, the catalytic activity of natural ornithine decarboxylase is low, resulting in a decrease in the biosynthesis efficiency of 1,4-butanediamine, so it is very necessary to improve the catalytic activity of ornithine decarboxylase. Summary of the invention

[0005] In view of the above problems, the present invention provides an ornithine decarboxylase mutant and its encoding gene, expression vector, recombinant strain and application. The ornithine decarboxylase mutant has high catalytic activity and can improve the biosynthesis efficiency of 1,4-butanediamine. The recombinant strain expressing the ornithine decarboxylase mutant can efficiently catalyze the production of 1,4-butanediamine by the whole cell method, and the molar conversion rate of ornithine is greatly improved, which has important positive significance for improving the utilization rate of ornithine and the efficiency of producing 1,4-butanediamine.

[0006] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical scheme: The first aspect of the present invention provides an ornithine decarboxylase mutant, which is obtained by mutating the wild-type ornithine decarboxylase ODC10 whose amino acid sequence is shown in SEQ ID NO.1, wherein the mutation includes mutating the threonine (Thr, T) at position 209 to alanine (Ala, A), cysteine ​​(Cys, C), serine (Ser, S) or valine (Val, V).

[0007] Ornithine decarboxylase ODC10 (Gene ID: 58090974) was isolated from Staphylococcus lugdunensis ( Staphylococcus lugdunensis ) screened out an ornithine decarboxylase with high catalytic activity, and its efficiency in catalyzing the synthesis of 1,4-butanediamine is 23.55 times that of the ornithine decarboxylase from Escherichia coli. The present invention further improves its catalytic activity by performing the above mutation, which is conducive to the efficient catalytic synthesis of 1,4-butanediamine.

[0008] After the ornithine decarboxylase mutant provided by the present invention is transformed into a host bacterium through an expression vector, a recombinant strain expressing the mutant can be obtained, and the obtained recombinant strain can be used to catalyze the production of 1,4-butanediamine using a whole cell method with ornithine as a substrate. Compared with the recombinant strain expressing ornithine decarboxylase ODC10, the recombinant strain expressing the mutant can significantly improve the biosynthesis efficiency of 1,4-butanediamine.

[0009] In the present invention, the mutant identification adopts the method of "original amino acid + position + replaced amino acid" to indicate the mutated amino acid in the ornithine decarboxylase mutant. For example, T209A means that the amino acid at position 209 is replaced by alanine from the threonine of the parent ornithine decarboxylase, and the position number corresponds to the amino acid sequence number in SEQ ID NO.1.

[0010] Preferably, the amino acid sequence of the ornithine decarboxylase mutant is shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6.

[0011] Preferably, the mutation comprises mutating the threonine at position 209 to alanine, cysteine ​​or valine. Compared with the ornithine decarboxylase mutant T209S and the wild-type ornithine decarboxylase ODC10, the ornithine decarboxylase mutants T209A, T209C and T209V have good temperature stability and pH stability.

[0012] Further preferably, the amino acid sequence of the ornithine decarboxylase mutant is shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.6.

[0013] Preferably, the mutation includes mutating the threonine at position 209 to alanine or cysteine. The temperature stability and pH stability of the ornithine decarboxylase mutants T209A and T209C are higher than those of the ornithine decarboxylase mutant T209V, and the enzyme activity is higher. The yield of 1,4-butanediamine and the molar conversion rate of ornithine in the fermentation broth catalyzed by the whole cell method to synthesize 1,4-butanediamine using the recombinant strain expressing T209A or T209C are higher.

[0014] Further preferably, the amino acid sequence of the ornithine decarboxylase mutant is shown as SEQ ID NO.3 or SEQ ID NO.4.

[0015] Preferably, the mutation includes mutating the threonine at position 209 to alanine. Compared with the ornithine decarboxylase mutants T209C and T209V, the ornithine decarboxylase mutant T209A has better temperature stability and better pH stability in the pH range of 6.5 to 7.5, and the enzyme activity of the mutant is higher.

[0016] Further preferably, the amino acid sequence of the ornithine decarboxylase mutant is as shown in SEQ ID NO.3.

[0017] Preferably, the mutation comprises mutating threonine at position 209 to cysteine. Compared with ornithine decarboxylase mutants T209A and T209V, the yield of 1,4-butanediamine and the molar conversion rate of ornithine in the fermentation broth catalyzed by the whole cell method to synthesize 1,4-butanediamine using the recombinant strain expressing T209C are higher.

[0018] Further preferably, the amino acid sequence of the ornithine decarboxylase mutant is as shown in SEQ ID NO.4.

[0019] The second aspect of the present invention provides a gene encoding the above-mentioned ornithine decarboxylase mutant.

[0020] Those skilled in the art can obtain the desired nucleotide sequence by codon optimization according to actual needs. The present invention does not limit the nucleotide sequence of the gene encoding the above-mentioned ornithine decarboxylase mutant, and all genes that can encode the above-mentioned ornithine decarboxylase mutant are within the protection scope of the present invention.

[0021] The third aspect of the present invention provides a recombinant plasmid comprising the above gene.

[0022] The present invention has no special requirements for the type of expression vector, and a common vector that can be expressed in strains such as Escherichia coli, Corynebacterium glutamicum or yeast can be selected, and its construction method can adopt the commonly used method in the art, such as connecting the target gene to the vector after enzyme digestion. Exemplarily, the recombinant plasmid is selected from pET series plasmids, pTRC99A plasmids, pWB600 plasmids, pXMJ19 plasmids, pHT1 plasmids, etc., and can also be a plasmid of a fungal expression system such as pJ912, pPIC9, pPIC9K, pPIC3.5K, pPICZalphaA, B, C, pYES2, pAUR123, pRS303TEF, pRS304, pRS305, pUG6, pSH47, pUC110, pPZP-HYG2, pPZP201, pFW22.1, pFC330, etc.

[0023] More preferably, the recombinant plasmid is pET22b plasmid.

[0024] The fourth aspect of the present invention provides a recombinant strain expressing the above-mentioned ornithine decarboxylase mutant.

[0025] Preferably, the host cells used by the recombinant strain include Escherichia coli, Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens, Corynebacterium glutamicum, Saccharomyces cerevisiae, Pichia pastoris, Yarrowia lipolytica and Hansenula spp.

[0026] The fifth aspect of the present invention provides the use of one of the above-mentioned ornithine decarboxylase mutants or its encoding gene, or its encoding gene expression vector, or its recombinant strain expressing the same in the preparation of 1,4-butanediamine.

[0027] The sixth aspect of the present invention provides a method for producing 1,4-butanediamine using an ornithine decarboxylase mutant as a catalyzer, which specifically comprises the following operations: adding ornithine hydrochloride and the ornithine decarboxylase mutant to a buffer solution containing pyridoxal phosphate, reacting at 32-42°C, inactivating the enzyme after the reaction, and obtaining the 1,4-butanediamine in the resulting reaction solution.

[0028] Preferably, the components of the buffer containing pyridoxal phosphate are: 1 mM ethylenediaminetetraacetic acid (EDTA), 25 mM dithiothreitol (DTT), 1 mM pyridoxal phosphate (PLP), 1% Tween-80, and the solvent is 10 mM Tris-HCl at pH=7.5.

[0029] The seventh aspect of the present invention provides a method for whole cell catalytic production of 1,4-butanediamine, which specifically comprises the following operations: The above recombinant strain is cultured and activated and then inoculated into a fermentation medium containing pyridoxal phosphate. When the OD value is 0.7-0.9, isopropyl-β-D-thiogalactoside (IPTG) is added to induce expression, and then ornithine hydrochloride is added for fermentation, and the 1,4-butanediamine is obtained in the resulting fermentation broth.

[0030] This method has no particular limitation on the culture medium for culturing the activated recombinant strain, and the culture medium conventionally used in the art can be used.

[0031] Preferably, the final concentration of the isopropyl-β-D-thiogalactoside added to the fermentation medium is 0.1 mmol / L; the conditions for inducing expression are: inducing culture at 37±1°C for 6±1 h.

[0032] Preferably, the final concentration of the ornithine hydrochloride added to the fermentation medium is 10 g / L.

[0033] Preferably, the fermentation temperature is 37 ± 1°C.

[0034] Preferably, the fermentation medium comprises: 8 g / L ammonium sulfate ((NH4)2SO4), 2 g / L potassium dihydrogen phosphate (KH2PO4), 2 g / L magnesium sulfate heptahydrate (MgSO4·7H2O), 2.5 g / L yeast extract, 0.02 mg / L vitamin B 12 (VB 12 ), 40 g / L 3-morpholinepropanesulfonic acid (MOPS), 2 mg / L pyridoxal phosphate and 5 mL / L trace element mixture.

[0035] The beneficial effect of the present invention is that the present invention obtains an ornithine decarboxylase mutant with further improved catalytic activity by mutating an ornithine decarboxylase ODC10 with high catalytic activity from Staphylococcus lugdunensis. Compared with the wild-type ornithine decarboxylase ODC10, the ornithine decarboxylase mutants T209A, T209C, T209V and T209S provided by the present invention have specific activities increased by 37.39%, 19.92%, 0.91% and 2.04% respectively, and can efficiently catalyze the production of 1,4-butanediamine. The ornithine decarboxylase mutant is transferred into a host cell through an expression plasmid to obtain a recombinant strain expressing the ornithine decarboxylase mutant. Compared with the strain expressing the wild-type ornithine decarboxylase ODC10, the recombinant strains expressing the ornithine decarboxylase mutants T209A, T209C, T209V and T209S increased the yield of 1,4-butanediamine in the fermentation broth produced by whole-cell catalysis using ornithine hydrochloride as substrate by 146.39%, 167.41%, 109.62% and 54.39%, respectively, and the molar conversion rates reached 91.21%, 97.3%, 90.98% and 90.03%, respectively, which has important positive significance for improving the utilization of ornithine and the efficiency of producing 1,4-butanediamine. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the HPLC detection chart of 1,4-butanediamine standard in the embodiment of the present invention; Figure 2 This is a HPLC test chart of ornithine hydrochloride standard in the embodiment of the present invention; Figure 3 is the yield of 1,4-butanediamine in the fermentation broth of the recombinant strain expressing different ornithine decarboxylase mutants in Example 2 of the present invention; Figure 4 The SDS-PAGE analysis of the wild-type ornithine decarboxylase and its mutants in Example 3 of the present invention; Figure 5 is the optimum temperature of the wild-type ornithine decarboxylase and its mutants in Example 5 of the present invention; Figure 6 The temperature stability of the wild-type ornithine decarboxylase and its mutants in Example 5 of the present invention; Figure 7 is the optimum pH value of the wild-type ornithine decarboxylase and its mutants in Example 6 of the present invention; Figure 8 The pH stability of the wild-type ornithine decarboxylase and its mutants in Example 6 of the present invention; Fig. 9 The shake flask fermentation results of Example 7 of the present invention for bioconversion of 1,4-butanediamine by the recombinant strain expressing wild-type ornithine decarboxylase and its mutants. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work fall within the scope of protection of the present invention.

[0038] At present, the catalytic activity of ornithine decarboxylase is low when producing 1,4-butanediamine by microbial fermentation, which leads to high production costs and low strain performance.

[0039] In view of this problem, the embodiment of the present invention obtains ornithine decarboxylase mutants T209A, T209C, T209S and T209V by random mutation and saturation mutation of ornithine decarboxylase ODC10 with high catalytic activity screened from Staphylococcus lugdunensis. Compared with the wild-type ornithine decarboxylase ODC10, the catalytic activity of the above mutants is significantly improved, and a higher yield can be obtained by producing 1,4-butanediamine by whole cell catalysis using recombinant strains expressing the above mutants. In addition, T209A, T209C and T209V in the above mutants have good temperature stability and pH stability, among which T209A and T209C have better temperature stability and pH stability, and higher enzyme activity, and T209A has the best temperature stability, pH stability and enzyme activity.

[0040] The embodiments of the present invention also provide genes encoding the above mutants.

[0041] The embodiment of the present invention also provides a recombinant plasmid containing the above gene and a construction method thereof.

[0042] The embodiments of the present invention also provide a recombinant strain expressing the mutant and a construction method thereof.

[0043] The embodiment of the present invention also provides a method for producing 1,4-butanediamine by catalysis using an ornithine decarboxylase mutant.

[0044] The embodiment of the present invention also provides the use of the above recombinant strain in whole cell catalytic production of 1,4-butanediamine.

[0045] The scheme of the present invention is described below through specific embodiments.

[0046] In the following examples, the mutants are identified by "original amino acid + position + replaced amino acid" to indicate the mutated amino acid in the ornithine decarboxylase mutant. For example, T209A means that the amino acid at position 209 is replaced by alanine Ala from threonine Thr of the parent ornithine decarboxylase, and the position number corresponds to the amino acid sequence number of ornithine decarboxylase in SEQ ID NO: 1.

[0047] The following example analyzes the concentration of 1,4-butanediamine in the product and substrate in the reaction solution by high performance liquid chromatography (HPLC). The HPLC analysis method is as follows: chromatographic column model: Agilent AAA, mobile phase A: 10 mM Na2B4O7 and 10 mMNa2HPO4 (PH = 8.2), mobile phase B: methanol: acetonitrile: water = 45:45:10, detection wavelength: 338 nm, flow rate: 1.0 mL / min, column temperature: 40°C. The peaks of the product (1,4-butanediamine standard) and substrate (ornithine standard) are as follows: Figure 1 and Figure 2 shown.

[0048] ODC-PLP storage solution: contains 1 mM EDTA, 25 mM DTT, 1 mM PLP, 1% Tween-80, and the solvent is 10 mM Tris-HCl, pH=7.5.

[0049] Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the materials, reagents, etc. used in the following examples can be obtained from commercial sources. Escherichia coli BL21 strain and pET22b plasmid are both commercial plasmids.

[0050] Example 1 This example provides a recombinant strain expressing the ornithine decarboxylase mutant T209A and the process for obtaining the same.

[0051] The gene of wild-type ornithine decarboxylase ODC10 whose nucleotide sequence is shown in SEQ ID NO.2 was amplified from plasmid pET22b-ODC10 by error-prone PCR using primers SF (sequence as shown in SEQ ID NO.7) and SR (sequence as shown in SEQ ID NO.8), and 2 μL of 25 mM MnCl2 was added to the total 50 μL reaction system to obtain the ODC10 target gene fragment containing the mutation site.

[0052] SF: AGAAGGAGATATACATATGAAATTTCTGAAAGTTGCAAGCAG; SR: TGGTGGTGGTGGTGCTCGAGGCTCTCCAGAACATAAC.

[0053] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C at a rate of 2 kb / min for 30 cycles; then extension at 72°C for 10 min. After purification, the PCR product was cloned into the NdeI and XhoI sites of pET22b using seamless cloning technology and transformed into BL21 competent cells to construct a random library of ornithine decarboxylase mutants. The random mutant library was preliminarily screened in a 96-well plate using the DSMI-CB6 method. DSMI is a fluorescent dye, and an appropriate amount of the fluorescent dye DSMI can bind to the macrocyclic receptor cucurbituril (CB6) to produce a fluorescent signal. During the reaction, putrescine, the product of the ODC enzymatic reaction, has a higher affinity with CB6, so it competitively displaces DSMI bound to CB6, causing a decrease in the fluorescent signal. The strains with significantly reduced fluorescence signals obtained in the initial screening were inoculated into shake flasks for rescreening, and the yield of 1,4-butanediamine in the fermentation broth was detected. The recombinant strain ODC10-① with improved 1,4-butanediamine yield was screened out, and its 1,4-butanediamine yield was increased by 146.39%. The ornithine decarboxylase mutant T209A in the recombinant strain is a wild-type ornithine decarboxylase with an amino acid sequence as shown in SEQ ID NO.1 with the threonine at position 209 mutated to alanine. The amino acid sequence of the ornithine decarboxylase mutant T209A is shown in SEQ ID NO.3.

[0054] Example 2 This example provides recombinant strains expressing ornithine decarboxylase mutants T209C, T209V and T209S and the process for obtaining the same.

[0055] The mutation site of the ornithine decarboxylase mutant T209A obtained in Example 1 was subjected to site-directed saturation mutation by overlapping PCR, and primers F1 (sequence as shown in SEQ ID NO.9), F2 (sequence as shown in SEQ ID NO.10), R1 (sequence as shown in SEQ ID NO.11), and R2 (sequence as shown in SEQ ID NO.12) were designed; the gene of the ornithine decarboxylase mutant T209A was used as a template, and the upstream fragment of the target gene was amplified using F1 and R2 as primers, and the downstream fragment was amplified using R1 and F2 as primers; the mutant gene fragment was amplified in large quantities using the above downstream fragments as templates and F1 and F2 as primers. The purified mutant gene fragment was connected to the pET22b vector cut by XhoI and NdeI using seamless cloning enzyme to form the expression vector pET22b-ODC10-②~pET22b-ODC10-⑲ of the mutant gene, and the accuracy of the mutant was verified by sequencing. The above expression vector was transformed into Escherichia coli BL21 strain to obtain 18 different ornithine decarboxylase mutant recombinant strains: ODC10-②~ODC10-⑲. The mutants expressed by each recombinant strain are shown in Table 1.

[0056] Table 1 Mutant identifiers corresponding to mutants ODC10-①~ODC10-⑲

[0057] The single colonies of wild-type ornithine decarboxylase ODC10 and all constructed ornithine decarboxylase mutant recombinant strains were inoculated into 5 mL LB liquid medium and cultured overnight at 37°C and 220 r / min to prepare seed solution. Then, 500 μL of seed solution was transferred to a 250 mL flask containing 25 mL LB medium at an inoculation ratio of 2%, and shake flask fermentation was performed at 37°C and 220 r / min. The yield of 1,4-butanediamine in the 24 h shake flask fermentation broth of the recombinant strains ODC10-② to ODC10-⑲ was as follows: Figure 3 As shown, compared with the strain expressing the wild-type ornithine decarboxylase ODC10, the production of 1,4-butanediamine in the fermentation broth of the recombinant strains ODC10-②~ODC10-④ expressing the ornithine decarboxylase mutants T209C, T209V and T209S was significantly increased by 53.76%, 26.28% and 28.9%, respectively.

[0058] F1: AGAAGGAGATATACATATGAAATTTCTGAAAGTTGCAAGCAG; R2: AATTGCGCTGGTAATAATAATATTATTGCTGGT; R1: ACCAGCAATAATATTATTATTACCAGCGCAATT; F2: TGGTGGTGGTGGTGCTCGAGGCTCTCCAGAACATAAC.

[0059] Example 3 This example provides a method for expressing and purifying ornithine decarboxylase and its mutants.

[0060] The strain ODC10 expressing wild-type ornithine decarboxylase ODC10 and the recombinant strains ODC10-①~ODC10-④ expressing ornithine decarboxylase mutants T209A, T209C, T209V and T209S were inoculated in liquid LB medium and induced at 37℃ for 12 hours. After the culture, the fermentation broth was poured into a centrifuge cup, centrifuged at 4000 r / min for 10 min, the supernatant was discarded, and the bacteria were collected. The bacteria were washed twice with 20-25 mL lysis buffer (pH=7.5) and resuspended, and then ultrasonically disrupted: ultrasonic for 2 s, interval for 3 s, and disruption for 30 min. After that, centrifuged at 4℃ and 4000 r / min for 30 min to obtain the supernatant, which is the crude enzyme solution containing ornithine decarboxylase mutants. The supernatant, Ni ion resin and rotor were placed in a beaker, and the cup was covered with plastic wrap, and combined on a magnetic stirrer at 4℃ for 1 h. Transfer all the bound samples to the gravity column in a 4°C chromatography cabinet, and wash the gravity column three times with 5 mL of wash buffer containing 20 mM imidazole to elute the impurities. Wash three times with 5 mL of elution buffer containing 200 mM imidazole to obtain the target protein eluate. Collect the purified enzyme solution in an ultrafiltration tube with a membrane pore diameter of 10 kDa, and replace it with lysis buffer until 1 mL of liquid remains. Use sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) to analyze the purity of the target protein. The target protein reaches electrophoretic purity, such as Figure 4 As shown ( Figure 4 In the figure, 1 is the wild-type ornithine decarboxylase ODC10, 2 is the mutant T209A, 3 is the mutant T209S, 4 is the mutant T209V, 5 is the mutant T209C, and M is Protein Marker).

[0061] The concentration of the target protein was determined using an ultra-micro spectrophotometer NanoDrop 2000. The enzyme concentrations of the wild-type ornithine decarboxylase ODC10 and the ornithine decarboxylase mutants T209A, T209C, T209V, and T209S were 1.0 mg / mL, 1.5 mg / mL, 3.2 mg / mL, 2 mg / mL, and 1.2 mg / mL, respectively.

[0062] Example 4 This example determines the specific activity of wild-type ornithine decarboxylase ODC10 and its mutants.

[0063] Since ornithine decarboxylase is a pyridoxal phosphate-dependent decarboxylase, it is necessary to prepare a specific reaction buffer for it: ODC-PLP storage solution. On ice, add 800 µL of ODC-PLP (pH=7.5) storage solution to a 1.5 mL EP tube, and add 50 µL of ornithine hydrochloride solution to make the final concentration 2 g / L. Take 50 µL of the ultrafiltered enzyme solution (obtained in Example 3) and add it to the above reaction system. The reaction mixture was placed in a 37°C water bath for 60 min, and immediately boiled for 5 min after the reaction. All data were set in triplicate. Subsequently, the solution was centrifuged at 13000 r / min for 5 min, and the supernatant was collected for derivatization, and the content of 1,4-butanediamine was detected by HPLC.

[0064] Definition of enzyme activity: The amount of enzyme required to produce 1 μmol of 1,4-butanediamine per minute at 37°C and pH=7.5 is defined as one activity unit (U). According to the measured enzyme activity, divided by the mass of the enzyme, the specific activity of various ornithine decarboxylases was obtained. The specific activity unit is U / mg protein, and the results are shown in Table 2. The specific activity of wild-type ornithine decarboxylase ODC10 is 464.75 U / mg, the specific activity of ornithine decarboxylase mutant T209A is 638.50 U / mg, the specific activity of ornithine decarboxylase mutant T209C is 557.34 U / mg, the specific activity of ornithine decarboxylase mutant T209V is 468.96 U / mg, and the specific activity of ornithine decarboxylase mutant T209S is 474.25 U / mg. The ornithine decarboxylase mutant T209A had the highest specific activity, which was 37.39% higher than that of the wild-type ornithine decarboxylase ODC10.

[0065] Table 2 Specific activities of wild-type ornithine decarboxylase and its mutants

[0066] Example 5 This example determines the optimal temperature and temperature stability of wild-type ornithine decarboxylase ODC10 and its mutants.

[0067] 50 μL of ultrafiltered enzyme solution (obtained in Example 3) was added to the ODC-PLP storage solution at pH=7.5, and the reaction Ep tubes were placed at different temperatures (22, 27, 32, 37, 42°C) for 10 min, and 50 μL of ornithine hydrochloride solution (final concentration 2 g / L) was added to start the reaction, and the reaction lasted for 60 min. After the reaction, the solution was immediately boiled for 5 min. The content of 1,4-butanediamine was detected by HPLC, and the specific activity of ornithine decarboxylase and its mutants was calculated to obtain the optimal temperature of ornithine decarboxylase and its mutants. The results are shown in Figure 5 shown.

[0068] Take 50 µL of the ultrafiltered enzyme solution (obtained in Example 3), place it in a water bath at different temperatures (27, 32, 37, 42°C), and keep warm for 8 hours (take out the sample and place it on ice immediately after the reaction time). Under the optimal reaction temperature of 37°C and the optimal reaction pH = 7.5, add ornithine hydrochloride solution and ODC-PLP storage solution (pH = 7.5) and react for 60 minutes, then detect the ornithine decarboxylase activity of all samples. The highest enzyme activity is defined as 100%, and the enzyme activities measured under different conditions are compared with it to calculate the relative enzyme activity. The temperature stability of ornithine decarboxylase and its mutants can be obtained by plotting. The results are shown in Figure 6 shown.

[0069] The detection of the optimal temperature and temperature stability showed that the optimal reaction temperature of the recombinant strains expressing the ornithine decarboxylase mutants T209A, T209C, T209V and T209S was 37°C, and these mutants had good temperature stability. After being placed at 27℃ for 8 h, the enzyme activity of T209S decreased to about 95%, while the enzyme activities of the other mutants were maintained above 97%; after being placed at 32℃ for 8 h, the enzyme activities of the wild-type ornithine decarboxylase ODC10 and the mutants were maintained above 92%; after being placed at 37℃ for 8 h, the enzyme activity of T209S decreased to 88%, which was lower than the enzyme activity of the wild-type ornithine decarboxylase, while the enzyme activities of the other mutants were maintained above 90%, and higher than the enzyme activity of the wild-type ornithine decarboxylase ODC10; after being placed at 42℃ for 8 h, the enzyme activity of T209S decreased to 83%, and the enzyme activities of the other mutants decreased to about 90%, but were significantly higher than the enzyme activity of the wild-type ornithine decarboxylase ODC10. From the above results, it can be seen that under the temperature conditions of 37°C and 42°C, the mutant T209S is not as stable as the wild-type ornithine decarboxylase ODC10, while the mutants T209A, T209C, and T209V have higher temperature stability than the wild-type ornithine decarboxylase ODC10.

[0070] Example 6 This example determines the optimal pH and pH stability of wild-type ornithine decarboxylase and its mutants.

[0071] Prepare 10 mM Tris-HCl with different pH values ​​(6.5, 7.0, 7.5, 8.0, 8.5), and then use it to prepare ODC-PLP storage solutions with different pH values. Take 50 μL of the ultrafiltered enzyme solution (obtained in Example 3), add it to the ODC-PLP storage solutions with different pH values ​​(6.5, 7.0, 7.5, 8.0, 8.5), and add 50 μL of ornithine hydrochloride solution (final concentration 2 g / L) to start the reaction. Place the mixture in a 37°C water bath for 60 min, boil it immediately for 5 min after the reaction, detect the 1,4-butanediamine content by HPLC, calculate the specific activity of ornithine decarboxylase and its mutants, and obtain the optimal pH value of ornithine decarboxylase and its mutants. The results are shown in Figure 7 shown.

[0072] The ultrafiltered enzyme solution (obtained in Example 3) was diluted to an appropriate concentration using lysis buffers of different pH values ​​(6.5, 7, 7.5, and 8), and dispensed into 1.5EP tubes, which were placed in a 37°C water bath for 8 h (the samples were immediately taken out and placed on ice after the reaction time). Under the optimum reaction temperature of 37°C and the optimum reaction pH of 7.5, ornithine hydrochloride solution and ODC-PLP storage solution (pH = 7.5) were added to react for 60 min, and the ornithine decarboxylase activity of all samples was detected. The results are shown in Figure 2. Figure 8 shown.

[0073] The detection of the optimal pH and pH stability showed that the optimal reaction pH of each recombinant strain was 7.5. After being placed at pH = 6.5 for 8 h, the enzyme activity of mutant T209S decreased to 80%, while the enzyme activities of mutants T209A and T209C were maintained at about 90%. h later, except for mutant T209S, the enzyme activities of wild-type ornithine decarboxylase ODC10 and other mutants were maintained above 85%, and mutants T209A and T209C had the highest enzyme activities; after being placed under pH=7.5 for 8 h, the enzyme activity of mutant T209S decreased to about 90%, and the enzyme activity of mutant T209A was the highest; after being placed under pH=8.0 for 8 h, the enzyme activities of mutants T209S and mutant T209V decreased to about 75%, the enzyme activities of wild-type ornithine decarboxylase ODC10 and mutant T209A decreased to about 80%, and T209C had the highest enzyme activity. From the above results, it can be seen that in the pH range of 6.5-7.5, the wild-type ornithine decarboxylase ODC10 and mutants T209V and T209S have more than 80% enzyme activity, and mutants T209A and T209C have more than 87% enzyme activity, indicating that the mutants and wild-type ornithine decarboxylase ODC10 have high pH stability.

[0074] Example 7 This example determines the conversion rate of ornithine to 1,4-butanediamine catalyzed by the recombinant strain expressing wild-type ornithine decarboxylase and its mutants.

[0075] After activating the strain expressing wild-type ornithine decarboxylase ODC10 and the recombinant strain expressing mutants T209A, T209C, T209V and T209S, a single colony was inoculated into 5 ml liquid LB medium containing 100 μg / mL ampicillin resistance, and cultured in a shaking incubator at 220 r / min and 37°C for 12-16 h (reaching the logarithmic growth phase) to obtain seed liquid. The seed liquid was inoculated at a 2% inoculum into a fresh liquid fermentation medium containing the same concentration of resistance (the fermentation medium contained: 8 g / L (NH4)2SO4, 2 g / L KH2PO4, 2 g / L MgSO4·7H2O, 2.5 g / L yeast extract, 0.02 mg / L VB 12 , 40g / L MOPS, 2 mg / L PLP and 5 mL of trace element mixture, ammonia water adjusted to pH 7.0). When the OD value was about 0.8, IPTG (isopropyl-β-D-thiogalactoside) was added to a final concentration of 0.1 mmol / L. After 6 hours of induction culture at 37 ° C, ornithine hydrochloride with a final concentration of 10 g / L was added as a substrate. After continuing to culture for 24 hours, 1 mL of fermentation broth was taken into a 1.5 mL EP tube, centrifuged at 12000 rpm for 5 min, and the supernatant was collected. After diluting a certain multiple, the content of 1,4-butanediamine in the fermentation broth was detected by HPLC. The results are as follows Fig. 9 As shown, the yield of 1,4-butanediamine in the fermentation broth of the strain expressing wild-type ornithine decarboxylase ODC10 was 2090.50 mg / mL, and the yield of 1,4-butanediamine in the fermentation broth of the recombinant strains expressing mutants T209A, T209C, T209V and T209S was 5150.79 mg / mL, 5590.20 mg / mL, 4382.06 mg / mL, 3227.52 mg / mL, compared with the strain expressing the wild-type ornithine decarboxylase ODC10, the yields of 1,4-butanediamine increased by 146.39%, 167.41%, 109.62% and 54.39%, respectively, and the molar conversion rates reached 91.21%, 97.3%, 90.98% and 90.03%, respectively, which were 90%, 102.7%, 89.5% and 87.6% higher than the molar conversion rate of ornithine of 48% in the strain expressing ODC10.

[0076] Molar conversion rate = moles of product / moles of substrate × 100%.

[0077] Example 8 This example provides an ornithine decarboxylase mutant T209A, whose amino acid sequence is shown in SEQ ID NO.3.

[0078] The ornithine decarboxylase mutant T209A provided in this example is directly synthesized by a biosynthetic method.

[0079] Example 9 This example provides an ornithine decarboxylase mutant T209C, whose amino acid sequence is shown in SEQ ID NO.4.

[0080] The ornithine decarboxylase mutant T209C provided in this example is directly synthesized by a biosynthetic method.

[0081] Example 10 This example provides an ornithine decarboxylase mutant T209S, whose amino acid sequence is shown in SEQ ID NO.5.

[0082] The ornithine decarboxylase mutant T209S provided in this example is directly synthesized by a biosynthetic method.

[0083] Embodiment 11 This example provides an ornithine decarboxylase mutant T209V, whose amino acid sequence is shown in SEQ ID NO.6.

[0084] The ornithine decarboxylase mutant T209V provided in this example is directly synthesized by a biosynthetic method.

[0085] Example 12 This example provides a recombinant plasmid containing a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO. 3 and a method for constructing the same, as well as a recombinant strain expressing the ornithine decarboxylase mutant T209A and a method for constructing the same.

[0086] 1. Construction of recombinant plasmid pET22b-ODC10-T209A The nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 3 was directly synthesized by synthetic biology. The nucleotide sequence was ligated to the pET22b vector cut with XhoI and NdeI using seamless cloning enzyme to obtain the recombinant plasmid pET22b-ODC10-T209A.

[0087] 2. Construction of a recombinant strain expressing ornithine decarboxylase mutant T209A The correctly sequenced pET22b-ODC10-T209A plasmid solution was added to the competent E. coli BL21, ice bathed for 10 min, then placed in a constant temperature water bath at 42°C for 90 s, and then immediately ice bathed for 2 min, then added to the LB non-antibiotic medium, and cultured at 37°C, 220 rpm shaking for 1 h. After the culture was completed, centrifuged at 4°C, 4800 rpm for 5 min, the supernatant was removed, the resuspended bacteria were spread on the LB solid plate containing Amp resistance, and inverted at 37°C constant temperature incubator for 12 h. After identification, the recombinant strain expressing the ornithine decarboxylase mutant T209A was obtained.

[0088] According to the construction method of this embodiment, recombinant plasmids containing nucleotide sequences encoding amino acid sequences shown in SEQ ID NO.4, SEQ ID NO.5, and SEQID NO.6, as well as recombinant strains expressing ornithine decarboxylase mutants T209C, T209S, and T209V can also be obtained.

[0089] Example 13 This example provides the use of the recombinant strain in Example 12 in the whole-cell catalytic production of 1,4-butanediamine.

[0090] After activating the recombinant strain expressing mutants T209A, T209C, T209V or T209S in Example 12, a single colony was inoculated into 5 ml of liquid LB medium containing 100 μg / mL ampicillin resistance and cultured in a shaking incubator at 220 r / min and 37°C for 12-16 h to obtain seed liquid. The seed liquid was inoculated at an inoculum of 2% into a fresh liquid fermentation medium containing the same concentration of resistance (each liter of fermentation medium contained: 8 g (NH4)2SO4, 2 g KH2PO4, 2 g MgSO4·7H2O, 2.5 g yeast extract, 0.02 mg VB 12 , 40g MOPS, 2mg PLP and 5mL trace element mixture, ammonia water adjusted to pH 7.0). When the OD value was about 0.8, IPTG was added to a final concentration of 0.1 mmol / L. After induction culture at 37℃ for 6 hours, ornithine hydrochloride with a final concentration of 10 g / L was added as a substrate to catalyze the production of 1,4-butanediamine.

[0091] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. An ornithine decarboxylase mutant, characterized in that: The mutant is obtained by mutating the wild-type ornithine decarboxylase ODC10 whose amino acid sequence is shown in SEQ ID NO.1, wherein the mutation includes mutating the threonine at position 209 to alanine, cysteine, serine or valine.

2. The ornithine decarboxylase mutant according to claim 1, characterized in that The amino acid sequence of the ornithine decarboxylase mutant is shown in SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO.

6.

3. The ornithine decarboxylase mutant according to claim 1 or 2, characterized in that The mutation includes mutating the threonine at position 209 to alanine, cysteine ​​or valine.

4. The ornithine decarboxylase mutant according to claim 3, characterized in that The mutation includes mutating the threonine at position 209 to alanine or cysteine.

5. A gene encoding the ornithine decarboxylase mutant according to any one of claims 1 to 4.

6. A recombinant plasmid containing the gene according to claim 5.

7. A recombinant strain expressing the ornithine decarboxylase mutant according to claim 1.

8. Use of the ornithine decarboxylase mutant or its encoding gene according to claim 1, or an expression vector of its encoding gene, or a recombinant strain expressing the same in the preparation of 1,4-butanediamine.

9. A method for producing 1,4-butanediamine by catalysis using an ornithine decarboxylase mutant, characterized in that: Specifically, the process comprises the following steps: adding ornithine hydrochloride and the ornithine decarboxylase mutant of claim 1 to a buffer solution containing pyridoxal phosphate, reacting at 32-42° C., inactivating the enzyme after the reaction, and obtaining the 1,4-butanediamine in the resulting reaction solution.

10. A method for producing 1,4-butanediamine by whole cell catalysis, characterized in that: The specific operations include: The recombinant strain of claim 7 is cultured and activated and then inoculated into a fermentation medium containing pyridoxal phosphate, isopropyl-β-D-thiogalactoside is added to induce expression when the OD value is 0.7-0.9, and then ornithine hydrochloride is added for fermentation, and the 1,4-butanediamine is obtained in the resulting fermentation broth.

Images