Transfection enhancement method for improving transient transfection efficiency of plasmids

Abstract

The invention belongs to the technical field of gene transfection, and discloses a transfection enhancement method for improving transient transfection efficiency of plasmids, which comprises the following steps: step 1, plasmid extraction: extracting plasmids by using an endotoxin-removing plasmid extraction kit; 2, preparing cells before transfection; and the cells are recovered and cultured, so that the density of the cells reaches 70-90% during transfection. Step 3, transfection: 1) adding a proper amount of the serum-free culture medium into one centrifugal tube under a sterile condition, then adding a transfection reagent, and fully and uniformly mixing; 2) adding the serum-free culture medium and a reinforcing agent into the other centrifugal tube, fully and uniformly mixing, and then adding plasmids. According to the scheme, the transient transfection efficiency and effect of plasmids are comprehensively improved from plasmid extraction, cell preparation, transfection compound formation to subsequent treatment through a series of optimization steps. Meanwhile, cytotoxicity and stress reaction are reduced, and the cell survival rate and the target protein expression quantity are improved, so that the transfection method becomes an efficient and reliable transfection method.

Description

Technical Field

[0001] The invention relates to the technical field of gene transfection, in particular to a transfection enhancement method for improving the efficiency of plasmid transient transfection. Background Art

[0002] The cell membrane is a barrier that prevents extracellular substances from freely entering the cell. It blocks many biomacromolecules from entering the cell and limits the transfection efficiency in non-viral gene delivery. Therefore, how to improve the ability of exogenous genes to penetrate the cell membrane and enter the cell, thereby improving the efficiency of transient transfection, is a problem that needs to be solved.

[0003] Gene transfection methods include chemical reagent transfection, physical transfection, and virus-mediated transfection. Transfection requires a certain transfection reagent to deliver the vector carrying the target gene into the host cell. Currently, the commonly used cationic liposome transfection reagent combines the positively charged liposome with the phosphate group of the nucleic acid through electrostatic action to form a stable DNA-liposome complex. These complexes are then adsorbed by the negatively charged cell membrane on the surface and enter the cell through membrane fusion or cell endocytosis. Although this method has a high efficiency in gene transfection, it also has some disadvantages:

[0004] 1. Cytotoxicity;

[0005] 2. Transfection efficiency depends on cell type and culture conditions, so the transfection conditions and transfection reagents need to be optimized for each cell type;

[0006] 3. Serum sensitivity: The presence of serum will affect its transfection efficiency;

[0007] 4. Limited application scope: Although it is applicable to a variety of cell types, the transfection efficiency of cationic liposomes is not ideal for some difficult-to-transfect cell types and large molecular fragments of plasmid DNA. Summary of the invention

[0008] The purpose of the present invention is to solve the shortcomings of the prior art and to propose a transfection enhancement method for improving the efficiency of plasmid transient transfection.

[0009] To solve the above problems, the present invention adopts the following technical solutions:

[0010] A transfection enhancement method for improving the efficiency of plasmid transient transfection comprises the following steps:

[0011] Step 1: Plasmid extraction: Use the endotoxin-free plasmid extraction kit to extract the plasmid.

[0012] Step 2: Cell preparation before transfection: revive and culture the cells to a density of 70-90% at the time of transfection.

[0013] Step 3: Transfection:

[0014] 1) Under sterile conditions, add an appropriate amount of serum-free culture medium to a centrifuge tube, then add the transfection reagent and mix thoroughly;

[0015] 2) In another centrifuge tube, add serum-free medium and enhancer, mix thoroughly and then add plasmid;

[0016] 3) Add the solution in 1) to 2), mix well and incubate for 15 minutes;

[0017] 4) 5 min before the end of incubation, gently wash the cells with PBS buffer and then replace with serum-free medium;

[0018] 5) Add the solution mixed in 3) to the cells in 4) and gently shake the culture medium to make it uniform. Place it in a cell culture incubator for transfection for 4-5 hours;

[0019] 6) The culture medium was replaced with serum-free medium containing lithium acetate and placed in an incubator for 4-6 hours;

[0020] 7) Discard the culture medium from the previous step and replace it with a serum-containing culture medium. After culturing for 48 hours, detect the protein expression and activity.

[0021] As a further solution of the present invention: the cells are HEK293T cells, and the amount of the plasmid is 25 μg / T75 cell culture flask.

[0022] As a further embodiment of the present invention: the serum-free culture medium is DMEM.

[0023] As a further solution of the present invention: the transfection reagent in step 1) is Lipofectamine TM 3000, the amount of the transfection reagent is 25 μl.

[0024] As a further solution of the present invention: the enhancer is P3000 TM , the dosage of the enhancer is 50 μl.

[0025] As a further solution of the present invention: the serum-free medium containing lithium acetate is 6 ml of serum-free medium containing 3 mM lithium acetate.

[0026] Compared with the prior art, the advantages of the present invention are:

[0027] This protocol improves the efficiency and effect of plasmid transient transfection through a series of optimized steps, from plasmid extraction, cell preparation, transfection complex formation to subsequent processing. At the same time, it reduces cytotoxicity and stress response, improves cell survival rate and target protein expression, making it an efficient and reliable transfection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The electrophoresis images of MATE2-K protein obtained under different conditions;

[0029] Figure 2 The LC-MS / MS detection results of MATE2-K transport activity under different conditions. DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention; it is obvious that the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments, and all other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making creative work are within the scope of protection of the present invention.

[0031] The application of lithium acetate (LiAc) in yeast is mainly reflected in improving the transformation efficiency of yeast cells. In molecular biology and genetics research, transformation refers to the process of introducing exogenous DNA into cells, which is crucial for studying gene function, producing recombinant proteins, and developing biotechnology products. As a chemical reagent, lithium acetate is usually used together with single-stranded carrier DNA (ssDNA) and polyethylene glycol (PEG) to form the so-called LiAc / ssDNA / PEG transformation method. This method can effectively promote the entry of exogenous DNA into yeast cells. In this process, the role of lithium acetate may be related to changing the permeability of the cell wall, allowing DNA to enter the cell more easily.

[0032] The application of lithium acetate (LiAc) in plasmid transient transfection is not as widespread and routine as it is in yeast transformation. However, there are some studies and experiments that suggest that lithium acetate may help improve the efficiency of plasmid transient transfection in some cases. The following are the potential roles and mechanisms of lithium acetate in plasmid transient transfection:

[0033] 1. Change the permeability of cell membrane: Lithium acetate may change the permeability of cell membrane, making it easier for plasmid DNA to enter cells. Similar to yeast transformation, lithium acetate may change the structure of cell membrane or cell wall and increase the internalization efficiency of plasmid DNA.

[0034] 2. Regulation of cell signaling pathways: Lithium acetate is known to affect a variety of cell signaling pathways, such as the Wnt / β-catenin signaling pathway. By regulating these signaling pathways, lithium acetate may indirectly affect the cell's uptake and expression of exogenous DNA.

[0035] 3. Cell stress response: Lithium acetate may induce a mild cell stress response and activate certain genes related to DNA repair and recombination, thereby improving the integration and expression efficiency of plasmid DNA.

[0036] 4. Optimize transfection conditions: Using an appropriate amount of lithium acetate may help optimize transfection conditions and reduce the amount of transfection reagents (such as Lipofectamine TM ) and improve cell survival rate and transfection efficiency.

[0037] Based on the above content, a transfection enhancement method for improving the efficiency of plasmid transient transfection is proposed, comprising the following steps:

[0038] Step 1. Plasmid extraction: Use an endotoxin-free plasmid extraction kit to extract the plasmid to ensure high purity and low endotoxin levels of plasmid DNA, thereby reducing cytotoxicity and improving transfection efficiency.

[0039] Step 2: Cell preparation before transfection: Resuscitate HEK293T cells and subculture until the cells grow well and reach a density of 70-90% during transfection. Ensure that the cells are in the best growth state, thereby improving the cells' ability to take up plasmid DNA.

[0040] Step 3: Transfection:

[0041] (Take T75 cell culture flask as an example), the plasmid dosage is 25 μg / T75 cell culture flask.

[0042] 1) Under sterile conditions, add 1 ml serum-free medium (DMEM) to a 5 ml centrifuge tube, and then add 25 μl Lipofectamine TM 3000 transfection reagent, mix thoroughly;

[0043] 2) In another 5 ml centrifuge tube, add 1 ml serum-free medium and 50 μl P3000 TM reagents, and add 25 μg of plasmid after thorough mixing;

[0044] 3) Add the solution in 1) to 2), mix well and incubate for 15 minutes;

[0045] 4) 5 min before the end of incubation, gently wash the cells with PBS buffer, and then replace the medium in T75 with 6 ml of serum-free medium (DMEM);

[0046] 5) Add the solution mixed in 3) to the cells in 4) and gently shake the culture medium to make it uniform. Place it in a cell culture incubator for transfection for 4-5 hours;

[0047] 6) Then replace with 6 ml of lithium acetate serum-free medium (DMEM) with a final concentration of 3 mM and place in an incubator for 4-6 hours. Treat cells with serum-free medium containing lithium acetate. Lithium acetate at an appropriate concentration further promotes the expression of plasmid DNA by changing cell membrane permeability and regulating cell signaling pathways.

[0048] 7) Discard the culture medium from the previous step and replace it with 30 ml of DMEM containing 2% serum. After culturing for 48 hours, detect the protein expression and activity. After transfection, replace it with a serum-containing culture medium to provide the nutrients required for cell growth and ensure that the cells grow and express the target protein under optimal conditions. After 48 hours, detect the protein expression and activity to ensure reliable experimental results.

[0049] Example: SLC-MATE2-k transporter transport activity

[0050] SLC-MATE2-k transporters are a class of proteins present on the cell membrane that have the function of taking up or excreting drugs or endogenous substances into or out of cells. Human MATE has two subtypes, MATE1 and MATE2-K. MATE1 is mainly expressed in the kidney and liver, mediating the final excretion of organic cationic substances through proton exchange. MATE1 and MATE2-K are mainly expressed on the apical membrane of the renal proximal tubule cells, and MATE2-K is specifically expressed in the kidney. As the most important excretory organ in the human body, the kidney has important significance for studying the interaction between the MATE2-K transporter and the substrate in vitro, which helps to verify whether the drug under investigation is a substrate and inhibitor of MATE2-K, and can further determine the effect of the drug under investigation on changes in endogenous (such as creatinine, glucose) or exogenous substances in the body.

[0051] 1. Vector construction:

[0052] 1) MATE2-K Primer:

[0053] F:TTCCATTTCAGGTGTCGTGAG ATGGACAGCCTCCAGGACACA

[0054] R:TCTAGAGCCGGCGCGGCCCGG CTAGTGCCTGGTGGCTAGGATC

[0055] 2) MATE2-K sequence:

[0056] NCBI Reference Sequence:NM_001099646.3

[0057] 2. Cell Preparation:

[0058] HEK293T cells were revived and passaged until the cells were in good growth condition and reached 70-90% density at the time of transfection.

[0059] 3. Cell transient transfection:

[0060] 2-5 hours after transfection with Lip3000, the cell culture medium needs to be replaced with serum-free DMEM basal medium containing lithium acetate (3-10mM) for 4-6 hours.

[0061] 4. Cell cryopreservation:

[0062] Cryopreserved in 90% fetal bovine serum cell freezing solution at a concentration of 10 million / mL.

[0063] 5. Transport activity detection:

[0064] 5.1) Preparation of poly-lysine coated culture plates:

[0065] Poly-lysine (Solarbio, P2100) was diluted 10 times with PBS solution and sterilized by filtration with a 0.22 μm filter. 500 μL of poly-lysine coating solution was added to each well of a 24-well cell culture plate to ensure that the bottom of the well was covered with the coating solution. After standing in a 37°C incubator for 30 minutes, the coating solution was completely aspirated and the coated culture plate was naturally air-dried in a clean bench.

[0066] 5.2) Cell recovery:

[0067] Prepare complete culture medium (DMEM + 10% fetal bovine serum). Take out the cells frozen in liquid nitrogen and quickly thaw them in a 37°C water bath. Add the cell suspension to 3-5 mL of complete culture medium, centrifuge at 300g for 5 minutes at room temperature, resuspend the cell pellet in complete culture medium, and adjust the cell density to 0.5-0.8×106 / mL.

[0068] 5.3) Adherent culture cells:

[0069] The poly-lysine coated 24-well cell culture plate was washed twice with PBS and then the cells were seeded in the cell culture plate, with the number of cells in each well being 0.5-0.8×106. Metabolic experiments were performed after culturing at 37° C. and 5% CO 2 for 12-16 hours.

[0070] 5.4) Transport activity detection:

[0071] MATE2-K: Aspirate the complete medium from each well, wash twice with pH7.4 Buffer, and then add 500μL pH7.4 Buffer. Incubate in a 37℃ incubator for 10min. Remove pH7.4 Buffer, add 500μL pH8.4 Buffer containing 30μM TEA (final concentration), and incubate at 37℃ for 5min. Remove the buffer and wash 5 times with pH8.4 Buffer. Add 100μL acetonitrile to each well to fully lyse the cells. Centrifuge at 10000g, 4℃ for 5min. Aspirate the supernatant and determine the protein concentration in the supernatant. Detect the amount of probe substrate TEA in the supernatant by LC-MS / MS. The transport activity of MATE2-K is evaluated by measuring the transport rate of specific substrates in the presence of transporters.

[0072] Figure 1 The electrophoresis images of MATE2-K protein obtained under different conditions. Figure 2 The LC-MS / MS test results of MATE2-K transport activity under different conditions. Band 1 is the blank control group of MOCK transfection; Band 2 is the group without adding lithium acetate after cell transfection; Band 3 is the group with adding 3mM lithium acetate after cell transfection; Band 4 is the group with adding 5mM lithium acetate after cell transfection; Band 5 is the group with adding 10mM lithium acetate after cell transfection.

[0073] The results showed that although the application of lithium acetate in plasmid transient transfection is not as common as in yeast transformation, its potential mechanism of action and experimental results showed that lithium acetate improves the efficiency of plasmid transient transfection by changing cell membrane permeability, regulating cell signaling pathways and inducing cell stress response. The activity of the group treated with 3mM lithium acetate after cell transfection was the highest.

[0074] The above is only a preferred specific implementation of the present invention; however, the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solution and its improved conception within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A transfection enhancement method for improving the efficiency of plasmid transient transfection, characterized in that: The following steps are involved: Step 1: Plasmid extraction: Use an endotoxin-free plasmid extraction kit to extract the plasmid; Step 2: Cell preparation before transfection: resuscitate and culture the cells to a density of 70-90% at the time of transfection; Step 3: Transfection: 1) Under sterile conditions, add an appropriate amount of serum-free culture medium to a centrifuge tube, then add the transfection reagent and mix thoroughly; 2) In another centrifuge tube, add serum-free medium and enhancer, mix thoroughly and then add plasmid; 3) Add the solution in 1) to 2), mix well and incubate for 15 minutes; 4) 5 min before the end of incubation, gently wash the cells with PBS buffer and then replace with serum-free medium; 5) Add the solution mixed in 3) to the cells in 4) and gently shake the culture medium to make it uniform. Place it in a cell culture incubator for transfection for 4-5 hours; 6) The culture medium was replaced with a serum-free culture medium containing lithium acetate, and the cells were placed in an incubator for 4-6 hours. The serum-free culture medium containing lithium acetate was 6 ml of a serum-free culture medium containing 3 mM lithium acetate; 7) Discard the culture medium from the previous step and replace it with a serum-containing culture medium. After culturing for 48 hours, detect the protein expression and activity.

2. A transfection enhancement method for improving the efficiency of plasmid transient transfection according to claim 1, characterized in that: The cells are HEK293T cells, and the amount of the plasmid is 25 μg / T75 cell culture flask.

3. A transfection enhancement method for improving the efficiency of plasmid transient transfection according to claim 1, characterized in that: The serum-free culture medium was DMEM.

4. A transfection enhancement method for improving the efficiency of plasmid transient transfection according to claim 1, characterized in that: The transfection reagent in step 1) is Lipofectamine TM 3000, the amount of the transfection reagent is 25 μl.

5. The method for enhancing transfection efficiency of plasmid transient transfection according to claim 1, characterized in that: The enhancer is P3000 TM , the dosage of the enhancer is 50 μl.

Images