Method for modifying specificity of non-coding RNA molecules for silencing gene expression in eukaryotic cells

Abstract

A method for modifying a gene encoding or processed to a non-coding RNA molecule having no RNA silencing activity in a eukaryotic cell is disclosed, with the proviso that the eukaryotic cell is not a plant cell. The method comprises introducing a DNA editor into the eukaryotic cell, the DNA editor conferring a silence specificity of the non-coding RNA molecule for a target RNA of interest. Also disclosed is a method of modifying a gene for encoding or being processed into an RNA silencing molecule for a target RNA in a eukaryotic cell. Also disclosed are methods of preventing and treating various diseases, methods of inducing apoptosis, and methods of producing an eukaryotic non-human organism.

Description

[0001] This application is a divisional application. The application date of the original application is September 18, 2018, the application number is 201880074921.9 (international application number PCT / IB2018 / 057143), and the name is “Method for modifying the specificity of non-coding RNA molecules for silencing gene expression in eukaryotic cells”.

[0002] Technical field and background technology

[0003] Some embodiments of the present invention relate to modifying genes that encode or are processed into non-coding RNA molecules (including RNA silencing molecules), and particularly, but not exclusively, to using the same genes to silence endogenous or exogenous target RNAs of interest in eukaryotic cells (not plant cells).

[0004] Of the approximately 25,000 annotated genes in the human genome, mutations in more than 3,000 have been associated with disease phenotypes, and more genetic variants associated with disease are being discovered at an astonishing rate. Emerging therapeutic strategies that can modify nucleic acids within cells and tissues affected by disease have the potential to treat monogenic, highly penetrant diseases such as severe combined immunodeficiency (SCID), hemophilia, and certain enzyme deficiencies, which have well-defined genetics and are often lacking safe and effective alternative therapies. To date, the two most powerful gene therapy technologies developed are gene therapy, which can restore missing gene function through viral transgene expression, and RNA interference (RNAi), which mediates the suppression of multiple defective genes by knocking down the target mRNA.

[0005] By semi-randomly integrating multiple functional genes into the genomes of multiple hematopoietic stem / progenitor cells, gene therapy has been successfully used to treat multiple monogenic recessive disorders affecting the hematopoietic system, such as SCID and Wiskott-Aldrich syndrome (Gaspar et al., Sci. Transl. Med., 2011, 3:97ra79; Howe et al., J. Clin. Invest., 2008, 118:3143-3150). RNAi has been used in other clinical trials to inhibit the function of multiple genes involved in cancer, age-related macular degeneration, and transthyretin (TTR)-related amyloidosis. Despite its promise and recent successes, gene therapy and RNAi still have limitations that prevent their use in many diseases. For example, viral gene therapy can cause mutagenesis at the integration site and lead to dysregulated transgene expression (Howe et al., 2008, supra). At the same time, the use of RNAi is limited to targets that are beneficial for gene knockdown. In addition, RNAi is generally unable to completely inhibit gene expression, due to the transient nature of the siRNA delivered and the lack of a silent amplification mechanism (such as in plants or nematodes). Therefore, it is unlikely to provide benefits for diseases that require complete inhibition of gene function during treatment. The main obstacle to current RNA-based therapeutic methods is the effective delivery of RNA to cells. Although some delivery agents can enhance therapeutic RNA endocytosis (endocytosis), only a very small part (less than 0.01%) will escape from endosomes (endosome) and have biological activity (Steven F Dowdy, Nature Biotechnol., 2017, 35, 222 to 229).

[0006] Recent advances in genome editing technology have made it possible to change multiple DNA sequences in multiple living cells by editing only a few of the billions of nucleotides in human patient cells. Over the past decade, the tools and expertise for using genome editing in human somatic and pluripotent cells have grown to such an extent that the method is currently being widely developed as a strategy for treating human diseases. The basic process depends on creating a site-specific DNA double-strand break (DSB) in the genome, and then allowing the cell's endogenous DSB repair mechanism to repair the break (e.g., by non-homologous end-joining (NHEJ) or homologous recombination (HR)), wherein the latter can allow precise nucleotide changes to the DNA sequence (Porteus, Annu Rev Pharmacol Toxicol., 2016, 56: 163 to 90).

[0007] Three main approaches use mutagenic genome editing (NHEJ) of cells as potential therapeutics: (a) knocking out multiple functional genetic elements by creating spatially precise insertions or deletions, (b) creating insertions or deletions that compensate for underlying frameshift mutations; thereby reactivating a partially or non-functional gene, and (c) creating defined gene deletions. Although several different therapeutic applications use NHEJ for editing, the most widespread therapeutic editing application is likely to be genome editing through homologous recombination (HR), a rare event that is highly accurate because it relies on a template to copy the correct sequence during the repair process.

[0008] The four main therapeutic applications of HR-mediated genome editing are currently: (a) gene correction (i.e., correction of a disease caused by a point mutation in a single gene); (b) functional gene correction (i.e., correction of a disease caused by mutations dispersed throughout the gene); (c) safe harbor gene addition (i.e., when precise regulation is not required or supraphysiological levels of a therapeutic transgene are desired); and (d) targeted transgene addition (i.e., when precise regulation is desired) (Porteus, 2016, supra).

[0009] Previous work on genome editing of RNA molecules in various eukaryotic organisms (e.g., mice, humans, shrimp, plants) has focused on knocking out miRNA gene activity or altering its binding site in target RNAs, such as:

[0010] Regarding genome editing in human cells, Jiang et al. (Jiang et al., RNA Biology, 2014, 11(10):1243-9) used CRISPR / Cas9 to significantly deplete human miR-93 from a population by targeting the 5' region in HeLa cells. Various small insertions and deletions (indels) were induced in the target region containing the Drosha processing site (i.e., the location where Drosha (a double-stranded RNA-specific RNase III enzyme) binds, cleaves, and thereby processes primary miRNA (pri-miRNA) into pre-miRNA in the nucleus of a host cell) and the seed sequence (i.e., the conserved heptametrical sequence, which is essential for miRNA binding to mRNA and is usually located at positions 2 to 7 of the 5' end of the miRNA). According to Jiang et al., even a single nucleotide deletion can completely knock out the target miRNA with high specificity.

[0011] Regarding genome editing in mouse species, Zhao et al. (Zhao et al., Scientific Reports, 2014, 4:3943) provided a miRNA inhibition strategy using the CRISPR system in mouse cells. Zhao used a specially designed guide RNA to cut the miRNA gene at a single site via Cas9, resulting in knockdown of the miRNA in these cells.

[0012] Regarding plant genome editing, Bortesi and Fischer (Bortesi and Fischer, Biotechnology Advances, 2015, 33:41-52) discuss the use of CRISPR-Cas technology in plants as compared to ZFNs and TALENs, and Basak and Nithin (Basak and Nithin, Front Plant Sci., 2015, 6:1001) teach that CRISPR-Cas technology has been applied to knock out protein-coding genes in typical plants (e.g., Arabidopsis and tobacco) and crops (e.g., wheat, corn, and rice).

[0013] In addition to disrupting miRNA activity or target binding sites, gene silencing methods that utilize artificial microRNA (amiRNA)-mediated gene silencing of endogenous and exogenous target genes have also been used (Tiwari et al., Plant Mol Biol., 2014, 86:1). Similar to microRNAs, amiRNAs are single-stranded, approximately 21 nucleotides (nt) long, and are designed by replacing the mature double-stranded miRNA sequence within a pre-miRNA (Tiwari et al., 2014). These amiRNAs are introduced as a transgene into an artificial expression cassette (containing a promoter, terminator, etc.) (Carbonell et al., Plant Physiology, 2014, pp. 113.234989), processed by the small RNA biogenesis and silencing machinery, and downregulate target expression. According to Schwab et al. (Schwab et al., The Plant Cell, 2006, Vol. 18, 1121-1133), amiRNAs are active when expressed under tissue-specific or inducible promoters and can be used for specific gene silencing in plants, especially when several related but not identical target genes need to be downregulated.

[0014] Senis et al. (Senis et al., Nucleic Acids Research, 2017, Vol. 45(1):e3) disclosed engineering a promoterless antiviral RNAi hairpin into an endogenous miRNA locus. Specifically, Senis et al. inserted an amiRNA precursor transgene (hairpin pri-amiRNA) into the vicinity of a naturally occurring miRNA gene (e.g., miR122) by homology-directed DNA recombination induced by sequence-specific nucleases (e.g., Cas9 or TALEN). This method uses promoterless and terminatorless amiRNA by utilizing transcriptionally active DNA expressing a natural miRNA (miR122), that is, the endogenous promoter and terminator drive and regulate the transcription of the inserted amiRNA transgene.

[0015] A variety of DNA-free methods for introducing RNA and / or proteins into cells have been previously described. For example, RNA transfection using electroporation and lipofection is described in U.S. Patent Application No. 20160289675. Cho described direct delivery of Cas9 / gRNA ribonucleoprotein (RNP) complexes to cells by microinjection of Cas9 protein and gRNA complexes (Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins," Genetics, 2013, 195: 1177-1180). Kim described the delivery of Cas9 protein / gRNA complexes by electroporation (Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins," Genome Res., 2014, 24: 1012-1019). Zuris reported the delivery of Cas9 protein-associated gRNA complexes by liposomes (Zuris et al., "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo," Nat Biotechnol., 2014, doi: 10.1038 / nbt.3081). Summary of the Invention

[0016] According to one aspect of some embodiments of the present invention, a method is provided for modifying a gene that encodes or is processed into a non-coding RNA molecule that does not have RNA silencing activity in a eukaryotic cell, provided that the eukaryotic cell is not a plant cell, the method comprising: introducing a DNA editing agent into the eukaryotic cell, the DNA editing agent conferring a silencing specificity to the non-coding RNA molecule against a target RNA of interest, thereby modifying the gene that encodes or is processed into the non-coding RNA molecule.

[0017] According to one aspect of some embodiments of the present invention, a method is provided for modifying a gene in a eukaryotic cell that encodes or is processed into a non-coding RNA molecule that does not have RNA silencing activity, provided that the eukaryotic cell is not a plant cell, the method comprising: introducing a DNA editing agent into the eukaryotic cell, the DNA editing agent conferring silencing specificity to the non-coding RNA molecule against a target RNA of interest.

[0018] According to one aspect of some embodiments of the present invention, a method is provided for modifying a gene that encodes or is processed into an RNA silencing molecule targeting a target RNA in a eukaryotic cell, provided that the eukaryotic cell is not a plant cell, the method comprising: introducing a DNA editing agent into the eukaryotic cell, the DNA editing agent redirecting the silencing specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.

[0019] According to one aspect of some embodiments of the present invention, a method is provided for modifying a gene that encodes or is processed into an RNA silencing molecule targeting a target RNA in a eukaryotic cell, provided that the eukaryotic cell is not a plant cell, the method comprising: introducing a DNA editing agent into the eukaryotic cell, the DNA editing agent redirecting the silencing specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different.

[0020] According to one aspect of some embodiments of the present invention, there is provided a method for treating an infectious disease in a subject in need thereof, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method described in some embodiments of the present invention, wherein the target RNA of interest is associated with the onset or development of the infectious disease, thereby treating the infectious disease in the subject.

[0021] According to one aspect of some embodiments of the present invention, there is provided a method for treating a monogenic recessive genetic disease in a subject in need thereof, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method of some embodiments of the present invention, wherein the target RNA of interest is associated with the monogenic recessive genetic disease, thereby treating the monogenic recessive genetic disease in the subject.

[0022] According to one aspect of some embodiments of the present invention, there is provided a method for treating an autoimmune disease in a subject in need thereof, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method described in some embodiments of the present invention, wherein the target RNA of interest is associated with the autoimmune disease, thereby treating the autoimmune disease in the subject.

[0023] According to one aspect of some embodiments of the present invention, there is provided a method for treating a cancerous disease in a subject in need thereof, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method of some embodiments of the present invention, wherein the target RNA of interest is associated with the cancerous disease, thereby treating the cancerous disease in the subject.

[0024] According to one aspect of some embodiments of the present invention, a method for enhancing the efficacy and / or specificity of a chemotherapeutic agent in a subject in need thereof is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method described in some embodiments of the present invention, wherein the target RNA of interest is associated with the enhancement of the efficacy and / or specificity of the chemotherapeutic agent, thereby enhancing the efficacy and / or specificity of a chemotherapeutic agent in the subject.

[0025] According to one aspect of some embodiments of the present invention, a method for inducing cell apoptosis in a subject in need thereof is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method described in some embodiments of the present invention, wherein the target RNA of interest is associated with the apoptosis, thereby inducing cell apoptosis in the subject.

[0026] According to one aspect of some embodiments of the present invention, a method for producing a eukaryotic non-human organism is provided, provided that the organism is not a plant, at least some of the cells of the organism include a modified gene for encoding or being processed into a non-coding RNA molecule, the non-coding RNA molecule including a silencing specificity for a target RNA of interest, and the method includes modifying a gene according to the method of some embodiments of the present invention, thereby producing the eukaryotic non-human organism.

[0027] According to some embodiments of the invention, the gene encoding or processed into the non-coding RNA molecule is endogenous to the eukaryotic cell.

[0028] According to some embodiments of the invention, the gene encoding the RNA silencing molecule is endogenous to the eukaryotic cell.

[0029] According to some embodiments of the invention, the modification of the gene encoding or processed into the non-coding RNA molecule comprises conferring on the non-coding RNA molecule at least 45% complementarity to the target RNA of interest.

[0030] According to some embodiments of the present invention, the modification of the gene encoding the RNA silencing molecule comprises conferring upon the RNA silencing molecule at least 45% complementarity to the second target RNA.

[0031] According to some embodiments of the invention, the silencing specificity of the non-coding RNA molecule is determined by measuring an RNA or protein level of the target RNA of interest.

[0032] According to some embodiments of the invention, the silencing specificity of the RNA silencing molecule is determined by measuring an RNA or protein level of the second target RNA.

[0033] According to some embodiments of the present invention, the silencing specificity of the non-coding RNA molecule or the RNA silencing molecule is determined phenotypically.

[0034] According to some embodiments of the invention, phenotypically determining is achieved by determining at least one phenotype selected from the group consisting of a cell size, a growth rate / inhibition, a cell shape, a cell membrane integrity, a tumor size, a tumor shape, a pigmentation of an organism, an infection parameter, and an inflammation parameter.

[0035] According to some embodiments of the present invention, the silencing specificity of the non-coding RNA molecule or the RNA silencing molecule is determined by genotype.

[0036] According to some embodiments of the invention, the phenotype is determined before a genotype.

[0037] According to some embodiments of the invention, the genotype is determined prior to a phenotype.

[0038] According to some embodiments of the present invention, the non-coding RNA molecule or the RNA silencing molecule is processed from a precursor.

[0039] According to some embodiments of the invention, the non-coding RNA molecule or the RNA silencing molecule is an RNA interference (RNAi) molecule.

[0040] According to some embodiments of the present invention, the RNAi molecule is selected from the group consisting of a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a Piwi-interacting RNA (piRNA), and a trans-acting siRNA (tasiRNA).

[0041] According to some embodiments of the present invention, the non-coding RNA molecule is selected from the group consisting of a small nuclear RNA (snRNA), a small nucleolar RNA (snoRNA), a long non-coding RNA (lncRNA), a ribosomal RNA (rRNA), a transfer RNA (tRNA), a repeat-derived RNA, and a transposable element RNA.

[0042] According to some embodiments of the invention, the RNAi molecules are modified to retain structural originality and to facilitate recognition by multiple cellular RNAi factors.

[0043] According to some embodiments of the invention, the modification of the gene is affected by a modification selected from the group consisting of a deletion, an insertion, a point mutation, and combinations thereof.

[0044] According to some embodiments of the invention, the modification is in a stem region of the non-coding RNA molecule or the RNA silencing molecule.

[0045] According to some embodiments of the present invention, the modification is in a loop region of the non-coding RNA molecule or the RNA silencing molecule.

[0046] According to some embodiments of the invention, the modification is in an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

[0047] According to some embodiments of the present invention, the modification is in a stem region and a loop region of the non-coding RNA molecule or the RNA silencing molecule.

[0048] According to some embodiments of the invention, the modification is in a stem region, a loop region, and an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

[0049] According to some embodiments of the invention, the modification is an insertion.

[0050] According to some embodiments of the invention, the modification is a deletion.

[0051] According to some embodiments of the invention, the modification is a point mutation.

[0052] According to some embodiments of the invention, the modification comprises a modification of at most 200 nucleotides.

[0053] According to some embodiments of the present invention, the method further comprises: introducing a plurality of donor oligonucleotides into the eukaryotic cell.

[0054] According to some embodiments of the invention, the DNA editing agent comprises at least one gRNA operably linked to a plant-expressible promoter.

[0055] According to some embodiments of the invention, the DNA editing agent does not comprise an endonuclease.

[0056] According to some embodiments of the invention, the DNA editing agent comprises an endonuclease.

[0057] According to some embodiments of the present invention, the DNA editing agent comprises a DNA editing system selected from the group consisting of a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) and CRISPR.

[0058] According to some embodiments of the present invention, the nuclease comprises Cas9.

[0059] According to some embodiments of the invention, the DNA editing agent is applied to the cell in the form of DNA, RNA or RNP.

[0060] According to some embodiments of the invention, the DNA editing agent is linked to a reporter for monitoring expression in a eukaryotic cell.

[0061] According to some embodiments of the invention, the reporter is a fluorescent protein.

[0062] According to some embodiments of the invention, the target RNA of interest or the second target RNA is endogenous to the eukaryotic cell.

[0063] According to some embodiments of the present invention, the target RNA of interest or the second target RNA is associated with a cancer.

[0064] According to some embodiments of the invention, the target RNA of interest or the second target RNA is exogenous to the eukaryotic cell.

[0065] According to some embodiments of the present invention, the target RNA of interest or the second target RNA is associated with an infectious disease.

[0066] According to some embodiments of the present invention, the eukaryotic cell is obtained from a eukaryotic organism selected from the group consisting of a mammal, an insect, a nematode, a bird, a reptile, a fish, a crustacean, a fungus, and an algae.

[0067] According to some embodiments of the invention, the eukaryotic cell is a mammalian cell.

[0068] According to some embodiments of the invention, the mammalian cell comprises a human cell.

[0069] According to some embodiments of the invention, the eukaryotic cell is a totipotent stem cell.

[0070] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, exemplary methods and / or materials are described below. In the event of a conflict, the patent specification and its definitions shall prevail. In addition, the materials, methods, and examples are illustrative only and are not intended to necessarily limit the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] Some embodiments of the present invention are described herein by way of example only with reference to the accompanying drawings. With specific reference now to the drawings, it should be understood that the details shown are by way of example and for purposes of illustrative discussion of the embodiments of the present invention. It will therefore be apparent to those skilled in the art how to implement the embodiments of the present invention as will be apparent from the description in conjunction with the accompanying drawings.

[0072] In the drawings:

[0073] Figure 1A flowchart of an embodiment of a computational pipeline for generating multiple Genome Editing-Induced Gene Silencing (GEiGS) templates. The computational GEiGS pipeline utilizes biological metadata and automatically generates multiple GEiGS DNA donor templates for minimally editing multiple miRNA genes, resulting in a novel gain of function, i.e., redirecting their silencing capacity to target sequences of interest.

[0074] Figure 2 FIG. 1 is a flow chart of an example of GEiGS that replaces miRNA with siRNA targeting green fluorescent protein (GFP), which results in silencing of a stably expressed GFP gene in a human cell line.

[0075] Figures 3A to 3B The photographs show that the GFP expression level was knocked down in multiple human cells. Figure 3B ) compared to multiple control group cells ( Figure 3A ) stably express GFP at high levels.

[0076] Figure 4 Figure 1 is a flow chart of an embodiment of multiple GEiGS cells stably expressing siGFP. All positive transfection events were red fluorescent protein (RFP) + GFP. However, since multiple GEiGS cells stably expressed siGFP, multiple positively transfected cells only showed red fluorescent expression.

[0077] Figure 5 Figure 1 is a flow chart showing an example of multiple GEiGS cells stably expressing siRNA targeting p53. All positive transfection events expressed GFP and escaped cell death induced by chemotherapy or the hDM2 inhibitor Nutlin3.

[0078] Figure 6 Figure 1 is a flow chart showing an example of multiple GEiGS cells stably expressing siRNA targeting multiple pro-apoptosis genes in the human cancer cell line U2OS. All positive transfection events were RFPs and escaped chemotherapy-induced cell death.

[0079] Figure 7 The flowchart of one embodiment is a method for generating multiple GEiGS cells resistant to lentivirus infection (GFP is used as the viral marker gene or as the exogenous gene).

[0080] Figure 8FIG. 1 is a flow chart of one embodiment of generating a plurality of GEiGS cells that are resistant to viral infection (ie, cellular immunity to an exogenous viral gene).

[0081] Figure 9 FIG2 is a flowchart illustrating one embodiment of the major stages required to design RNA silencing molecules with minimally edited miRNA gene bases.

[0082] Figure 10 1 is a diagram showing various non-coding RNA types that are actively involved in RNA interference (RNAi). The table provides a variety of non-coding RNA types, all of which are Dicer substrates (proven to be bound by Dicer) and processed into small silencing RNAs (their small RNAs have been shown to be bound by Argonaute proteins) (y-axis). Each type has multiple slightly different subtypes (x-axis).

[0083] Figures 11A to 11E This is an example of an embodiment of multiple human non-coding RNAs, which shows the non-coding RNA precursors and their derived multiple small RNAs that bind to Ago. The figure shows that multiple small RNAs that bind to AGO2 and AGO3 are mapped to multiple non-coding RNA precursors that bind to Dicer. ( Figure 11A ) shows the let7 microRNA (microRNA) and its major (marked by blue lines) and minor mature miRNA sites (indicated by gray bars). ( Figures 11B to 11E ) shows examples of other organism types where the small RNA mapping shows a signature that mimics that found in microRNAs.

[0084] Figures 12A to 12E is an example of an embodiment of multiple GEiGS oligonucleotide designs. Multiple selections of multiple non-coding RNA precursors that produce mature multiple small RNA molecules are highlighted in green. Sequence differences between the multiple GEiGS oligonucleotides and the wild-type sequence are highlighted in red. ( Figure 12A) Example embodiments of multiple GEiGS oligonucleotide designs, wherein the multiple GEiGS precursors retain the same secondary structure as the wild-type (wt) noncoding RNA. The designs are based on human microRNA-100. From left to right: wild-type microRNA, GEiGS designs with matching structure and minimal sequence changes, and GEiGS designs with matching structure and maximum sequence changes. Notably, the multiple GeiGS designs are based on a 21nt siRNA targeting human heparin-binding vascular endothelial growth factor (VEGF). ( Figure 12B ) Example of multiple GEiGS oligonucleotide designs, wherein the multiple GEiGS precursors do not retain the secondary structure as the wt non-coding RNA. The designs are based on the human microRNA-100. From left to right: wild-type microRNA, GEiGS designs with mismatched structures and minimal sequence changes, and GEiGS designs with mismatched structures and maximum sequence changes. Notably, the multiple GeiGS designs are based on a 21nt siRNA targeting human heparin-bound vascular endothelial growth factor (VEGF). ( Figure 12C ) Example of multiple GEiGS oligonucleotide designs, wherein the multiple GEiGS precursors retain the same secondary structure as the wt noncoding RNA. The designs are based on CID_001033tRNA. From left to right: wild-type tRNA, GEiGS designs with matching structure and minimal sequence changes, and GEiGS designs with matching structure and maximum sequence changes. Notably, the multiple GeiGS designs are based on 21nt siRNAs targeting the bcr / abl e8a2 fusion protein gene. ( Figure 12D ) Example of multiple GEiGS oligonucleotide designs, wherein the multiple GEiGS precursors do not retain the secondary structure as the wt noncoding RNA. Designs are based on CID_001033tRNA. From left to right, wild-type tRNA, GEiGS designs with mismatched structures and minimal sequence variation, and GEiGS designs with mismatched structures and maximum sequence variation. The multiple GEiGS designs are based on 21nt siRNAs targeting the bcr / able8a2 fusion protein gene. ( Figure 12E) Example of an embodiment of multiple GEiGS oligonucleotide designs, wherein the precursor structure does not play a role in biogenesis and therefore does not need to be maintained. The design is based on the Brassica rapa bnTAS3B tasiRNA. From left to right: wild-type tasiRNA, GEiGS design with minimal sequence variation, and GEiGS design with maximum sequence variation. It is worth noting that the circular structure is not inherent to the molecule, but is used for convenience. Unlike miRNA and tRNA, tasiRNA biogenesis does not depend on the precursor secondary structure (as discussed in detail by Borges and Martienssen (2015, Nature Reviews Molecular Cell Biology | AOP, published online on November 4, 2015; doi:10.1038 / nrm4085)). Details containing multiple modified parts are provided below the multiple complete molecules. The multiple GEiGS designs are based on 21nt siRNA targeting the bcr / able8a2 fusion protein gene.

[0085] Figure 13 PDS3 phenotype / genotype shown: bleached phenotypic plants were selected and genotyped by internal amplicon PCR followed by restriction analysis with BtsαI (NEB) to verify the presence of the donor relative to the wild-type sequence. Run 1: plants treated with no donor restriction; Runs 2 to 4: plants treated with PDS3 restricted with donor restriction; Run 5: unrestricted positive plasmid donor control; Run 6: no template water control; Run 7: restricted positive plasmid donor; Run 8: plants bombarded with restricted negative donor; Run 9: restricted untreated control plants. The amplicon was subsequently amplified by external PCR and sequenced to verify the insertion.

[0086] Figure 14 ADH1 phenotype / genotype is shown: plants were selected for resistance to allyl alcohol and genotyped by internal amplicon PCR followed by restriction digestion with BccI (NEB) to verify the presence of the donor. Run 1: restricted allyl alcohol-sensitive control plants; Runs 2 to 4: donor-restricted allyl alcohol-resistant plants; Run 5: unrestricted positive plasmid donor control; Run 6: no template control; Run 7: restricted positive plasmid donor; Run 8: plants bombarded with restricted nonspecific donor; Run 9: restricted non-allyl alcohol-treated control.

[0087] Figure 15Figure 2 is a graph showing gene expression analysis in plants modified with miR-173 targeting the AtPDS3 transcript. Analysis of AtPDS3 expression was performed by qRT-PCR in regenerating plants bombarded with GEiGS#4 and SWAP3, compared to plants bombarded with GEiGS#5 and SWAP1 and 2 (GFP). Notably, the average observed gene expression level was reduced by 82% when miR-173 was modified to target AtPDS3 compared to control plants (error bars show SD; p-value calculated based on Ct value <0.01).

[0088] Figure 16 Figure 2 shows gene expression analysis in plants modified with miR-390 targeting the AtPDS3 transcript. Analysis of AtADH1 expression was performed by qRT-PCR in regenerating plants bombarded with GEiGS#1 and SWAP11, compared to plants bombarded with GEiGS#5 and SWAP1 and 2 (GFP). Notably, the average observed gene expression level was reduced by 82% when miR-390 was modified to target AtADH1 compared to control plants (error bars show SD; p-value calculated based on Ct value <0.01). DETAILED DESCRIPTION

[0089] Some embodiments of the present invention relate to modifying genes that encode or are processed into non-coding RNA molecules (including RNA silencing molecules), and particularly, but not exclusively, to using the same genes to silence the expression of endogenous or exogenous target genes of interest in eukaryotic cells (not plant cells).

[0090] The principles and operation of the present invention may be better understood with reference to the several drawings and accompanying descriptions.

[0091] Before explaining at least one embodiment of the present invention in detail, it should be understood that the application of the present invention is not necessarily limited to the details set forth in the following description or illustrated by the multiple examples. The present invention is capable of other embodiments or can be practiced or carried out in various ways. In addition, it should be understood that the wording and terminology used herein are for illustrative purposes only and should not be considered as limiting.

[0092] The two most powerful gene therapy technologies developed to date are gene therapy, which is able to restore missing gene function through viral transgene expression, and RNAi, which mediates the suppression of multiple defective genes by knocking down the target mRNA. Recent advances in genome editing technologies have also made it possible to alter multiple DNA sequences by editing a few nucleotides in human patient cells, for example, by inducing site-specific multiple double-strand breaks (DSBs) at desired locations in the genome followed by genome editing (NHEJ and HR).

[0093] While putting the present invention into practice, the inventors have designed a gene editing technology that utilizes multiple non-coding RNA molecules designed to target and interfere with any target gene of interest (endogenous or exogenous to the eukaryotic cell). The gene editing technology described herein does not require multiple classical molecular genetics and transgenic tools including multiple expression cassettes (with a promoter, terminator, and selection marker). In addition, the gene editing technology of some embodiments of the present invention includes genome editing of a non-coding RNA molecule (e.g., endogenous), but it is stable and heritable.

[0094] As shown below and in the Examples section that follows, the present inventors have designed a Genome Editing Induced Gene Silencing (GEiGS) platform that can utilize multiple endogenous non-coding RNA molecules of a eukaryotic cell (including, for example, multiple RNA silencing molecules (e.g., siRNA, miRNA, piRNA, tasiRNA, tRNA, rRNA, antisense RNA, etc.)) and modify them to target any RNA target of interest (see Figure 2 Using GEiGS, the present method is capable of screening multiple potential non-coding RNA molecules, editing some nucleotides in these endogenous RNA molecules, thereby redirecting their activity and / or specificity to effectively and specifically target any RNA of interest, for example, including endogenous RNAs encoding multiple mutant proteins (e.g., oncogenes in cancer) or exogenous RNAs encoded by multiple pathogens (see Figure 1 In summary, GEiGS can be used as a novel technology for regulating endogenous gene expression and can also immunize organisms against different biotic and abiotic stresses, such as cancer, viruses, insects, fungi, nematodes, high temperature, drought, starvation, etc.

[0095] Therefore, according to one aspect of the present invention, a method for modifying a gene that encodes or is processed into a non-coding RNA molecule that does not have RNA silencing activity in a eukaryotic cell is provided, provided that the eukaryotic cell is not a plant cell, the method comprising introducing a DNA editing agent into the eukaryotic cell, wherein the DNA editing agent confers a silencing specificity to the non-coding RNA molecule against a target RNA of interest, thereby modifying the gene that encodes or is processed into the non-coding RNA molecule.

[0096] According to another aspect of the present invention, a method is provided for modifying a gene encoding or processed into an RNA silencing molecule targeting a target RNA in a eukaryotic cell, provided that the eukaryotic cell is not a plant cell, the method comprising: introducing a DNA editing agent into the eukaryotic cell, the DNA editing agent redirecting the silencing specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.

[0097] As used herein, the term "eukaryotic cell" refers to any cell of a eukaryotic organism. Eukaryotic organisms include both unicellular and multicellular organisms. Unicellular eukaryotic organisms include, but are not limited to, yeast, protozoa, slime molds, and algae. Multicellular eukaryotic organisms include, but are not limited to, animals (e.g., mammals, insects, nematodes, birds, fish, reptiles, and crustaceans), fungi, and algae (e.g., brown algae, red algae, green algae).

[0098] According to one embodiment, the eukaryotic cell is not a cell of a plant.

[0099] According to one embodiment, the eukaryotic cell is an animal cell.

[0100] According to one embodiment, the eukaryotic cell is a cell of a vertebrate.

[0101] According to one embodiment, the eukaryotic cell is a cell of an invertebrate.

[0102] According to a specific embodiment, the invertebrate cell is a cell of an insect, a snail, a clam, an octopus, a starfish, a sea urchin, a jellyfish, or a worm.

[0103] According to a specific embodiment, the invertebrate cell is a cell of a crustacean. Exemplary crustaceans include, but are not limited to, shrimp, prawn, crab, lobster, and crayfish.

[0104] According to a specific embodiment, the invertebrate cell is a cell of a fish. Exemplary fish include, but are not limited to, salmon, tuna, pollock, catfish, cod, haddock, prawns, sea bass, tilapia, Arctic char, and carp.

[0105] According to one embodiment, the eukaryotic cell is a mammalian cell.

[0106] According to a specific embodiment, the mammalian cell is a cell of a non-human organism, such as, but not limited to, rodents, rabbits, pigs, goats, ruminants (e.g., cows, sheep, antelopes, deer, and giraffes), dogs, cats, horses, and non-human primates.

[0107] According to a specific embodiment, the eukaryotic cell is a human cell.

[0108] According to one embodiment, the eukaryotic cell is a primary cell, a cell line, an integral cell, a germ cell, a stem cell, an embryonic stem cell, an adult stem cell, a hematopoietic stem cell, a mesenchymal stem cell, an induced pluripotent stem cell (iPS), a gamete cell, a zygote cell, a blastocyst cell, an embryo, a fetus, and / or a donor cell.

[0109] As used herein, phrase " stem cell " refers to the cell (for example, omnipotent, multipotent (pluripotent) or special (multipotent) stem cell) that can continue to maintain an undifferentiated state for a long time in culture, until being induced to differentiate into other cell types (for example, fully differentiated cells) with a special, specialized function. Totipotent cells, such as embryonic cells in the first pair of cell divisions after fertilization, are unique cells that can be differentiated into embryonic cells and extraembryonic cells (extra-embryonic cell) and can develop into a viable person's cell. Preferably, phrase " pluripotent stem cell " refers to the cell that can be differentiated into all three embryonic germ layers (that is, ectoderm (ectoderm), endoderm (endoderm) and mesoderm (mesoderm)) or maintain an undifferentiated state. Described pluripotent stem cells include embryonic stem cells (ESC) and induced pluripotent stem cells (iPS).Described special stem cells include adult stem cells and hematopoietic stem cells.

[0110] The phrase "embryonic stem cell" refers to an embryonic cell that is capable of differentiating into all three embryonic germ layers (i.e., endoderm, ectoderm, and mesoderm), or maintaining an undifferentiated state. The phrase "embryonic stem cell" can include cells obtained from embryonic tissue (e.g., blastocyst) formed after gestation (gestation) before the embryo implantation (i.e., a pre-implantation blastocyst), extended blastocyst cells (EBC) obtained from blastocysts at the post-implantation / pre-gastrulation stage (see WO2006 / 040763), embryonic germ (EG) cells obtained from the genital tissue of a fetus at any time during gestation (preferably before 10 weeks of gestation), and cells from an unfertilized egg stimulated by parthenogenesis (parthenogenetic activation of embryos (parthenotes)).

[0111] The embryonic stem cells of some embodiments of the present invention can be obtained using well-known cell culture methods. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from human pre-implantation embryos in vivo or from in vitro fertilized (IVF) embryos. Alternatively, a single-cell human embryo can be expanded to the blastocyst stage.

[0112] It should be understood that commercially available stem cells may also be used according to some embodiments of the present invention. Human ES cells can be purchased from the NIH Human Embryonic Stem Cell Registry (www(dot)grants(dot)nih(dot)gov / stem_cells / registry / current(dot)htm).

[0113] In addition, embryonic stem cells can be obtained from a variety of species, including mouse (Mills and Bradley, 2001), golden hamster (Doetschman et al., 1988, Dev Biol., 127:224-7), rat (Iannaccone et al., 1994, Dev Biol., 163:288-92), rabbit (Giles et al., 1993, Mol Reprod Dev., 36:130-8; Graves & Moreadith, 1993, Mol Reprod Dev., 1993, 36:424-33), several livestock species (Notarianni et al., 1991, J Reprod Fertil Suppl., 43:255-60; Wheeler, 1994, Reprod Fertil Suppl., 43:255-60), and 1995, Mol Reprod Dev., 36:33-34. Dev., 6:563-8; Mitalipova et al., 2001, Cloning., 3:59-67) and non-human primate species (Rhesus monkey and marmoset) (Thomson et al., 1995, Proc Natl Acad Sci, USA, 92:7844-8; Thomson et al., 1996, Biol Reprod., 55:254-9).

[0114] "Induced pluripotent stem cells" (iPS; embryonic-like stem cells) refer to cells obtained by dedifferentiation of adult somatic cells, which confers pluripotency, i.e., the ability to differentiate into the three embryonic germ cell layers, i.e., endoderm, ectoderm, and mesoderm. According to some embodiments of the present invention, such cells are obtained from a differentiated tissue (e.g., a one-cell tissue such as skin) and dedifferentiated by genetic manipulation, wherein the genetic manipulation reprograms the cells to acquire embryonic stem cell properties. According to some embodiments of the present invention, the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4, and c-Myc in one-cell stem cells.

[0115] Induced pluripotent stem (iPS) cells (embryonic stem cell-like) can be generated from somatic cells by genetic manipulation of the somatic cells, for example, by retroviral transduction of somatic cells, for example, fibroblasts, hepatocytes, gastric epithelial cells, with transcription factors (e.g., Oct-4, Sox2, c-Myc, and Kfl4) (as described in Park et al., Reprogramming of human somatic cells to pluripotency with defined factors, Nature, 2008, 451: 141-146).

[0116] The phrase "adult stem cell" (also known as "tissue stem cell" or a stem cell from a single cell tissue) refers to any stem cell derived from a single cell tissue (a postnatal or prenatal animal, particularly a human). The adult stem cell is generally considered to be a multipotent stem cell, capable of differentiating into a variety of cell types. Adult stem cells can be derived from any adult, neonatal, or fetal tissue, for example, adipose tissue, skin, kidney, liver, prostate, pancreas, intestine, bone marrow, and placenta.

[0117] According to one embodiment, the stem cells utilized in some embodiments of the present invention are bone marrow-derived (BM-derived) stem cells, including hematopoietic, stromal, or mesenchymal stem cells (Dominici, M et al., 2001, J. Biol. Regul. Homeost. Agents., 15: 28-37). BM-derived stem cells can be obtained from the iliac crest, femora, tibia, spine, rib, or other medullary cavities.

[0118] Hematopoietic stem cells (HSCs), which may also be referred to as adult tissue stem cells, include stem cells obtained from the blood or bone marrow tissue of an individual of any age or from the umbilical cord blood of a newborn individual. Preferred stem cells according to this aspect of some embodiments of the present invention are embryonic stem cells, preferably of human or primate (e.g., monkey) origin.

[0119] Placental and umbilical cord blood stem cells can also be called "young stem cells."

[0120] Mesenchymal stem cells (MSCs) are formative multipotent blast cells that can give rise to one or more mesenchymal tissues (e.g., fat, bone (osseous), cartilage, elastic and fibrous connective tissue, myoblasts), as well as tissues derived from outside the embryonic mesoderm (e.g., neural cells), depending on the various influences of bioactive factors (e.g., cytokines). Although these cells can be isolated from embryonic yolk sac, placenta, umbilical cord, fetal and adolescent skin, blood, and other tissues, their abundance in the BM far exceeds their abundance in other tissues, and therefore isolation from the BM is currently preferred.

[0121] Adult tissue stem cells can be isolated using various methods known in the art, such as the method disclosed by Alison, MR (J Pathol., 2003, 200(5):547-50). Fetal stem cells can be isolated using various methods known in the art, such as the method disclosed by Eventov-Friedman S et al. (PLoS Med., 2006, 3:e215).

[0122] Hematopoietic stem cells can be isolated using various methods known in the art, such as those disclosed in Handbook of Stem Cells, edited by Robert Lanze (Elsevier Academic Press, 2004, Chapter 54, pp. 609-614, Isolation and characterization of hematopoietic stem cells by Spangrude and William B Stayton).

[0123] Methods for isolating, purifying, and expanding mesenchymal stem cells (MSCs) are known in the art and include, for example, the methods disclosed by Caplan and Haynesworth in U.S. Pat. No. 5,486,359 and Jones EA et al. (2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum., 46(12):3349-60).

[0124] According to one embodiment, the eukaryotic cell is isolated from its natural environment (eg, human body).

[0125] According to one embodiment, the eukaryotic cell is a healthy cell.

[0126] According to one embodiment, the eukaryotic cell is a diseased cell or a cell susceptible to disease.

[0127] According to one embodiment, the eukaryotic cell is a cancer cell.

[0128] According to one embodiment, the eukaryotic cell is an immune cell (eg, a T cell, a B cell, a macrophage, a NK cell, etc.).

[0129] According to one embodiment, the eukaryotic cell is a cell infected by a pathogen (eg, by a bacterial, viral or fungal pathogen).

[0130] As used herein, the term "non-coding RNA molecule" refers to an RNA sequence that is not translated into an amino acid sequence and does not encode a protein.

[0131] According to one embodiment, the non-coding RNA molecule is generally subject to the RNA silencing processing mechanism or activity. However, some changes of multiple nucleotides (e.g., up to 24 nucleotides) are also contemplated herein, which may cause a processing mechanism that results in RNA interference or translation inhibition.

[0132] According to a specific embodiment, the non-coding RNA molecule is endogenous (naturally occurring, e.g., native) to the cell.

[0133] It will be understood that the non-coding RNA molecule may also be exogenous to the cell (ie, added externally and not naturally occurring in the cell).

[0134] According to some embodiments, the non-coding RNA molecule comprises an intrinsic translational repression activity.

[0135] According to some embodiments, the non-coding RNA molecule comprises an intrinsic RNAi activity.

[0136] According to some embodiments, the non-coding RNA molecule does not include an intrinsic translational inhibition activity or an intrinsic RNAi activity (ie, the non-coding RNA molecule does not have an RNA silencing activity).

[0137] According to one embodiment of the present invention, the non-coding RNA molecule is specific for a target RNA (e.g., a natural target RNA) and does not cross-suppress or silence a second target RNA or target RNA of interest, unless designed to do so (as described below), and exhibits 100% or less global homology to the target gene, such as less than 99%, less than 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% global homology; as determined at the RNA or protein level by RT-PCR, immunoblotting, immunohistochemistry and / or flow cytometry, or any other detection method.

[0138] According to one embodiment, the non-coding RNA molecule is an RNA silencing or RNA interference (RNAi) molecule.

[0139] The term "RNA silencing" or RNAi refers to a cellular regulatory mechanism in which multiple noncoding RNA molecules (the "RNA silencing molecules" or "RNAi molecules") mediate co-transcriptional or post-transcriptional repression of gene expression or translation in a sequence-specific manner.

[0140] According to one embodiment, the RNA silencing molecule is capable of mediating RNA inhibition during transcription (co-transcriptional gene silencing).

[0141] According to one embodiment, co-transcriptional gene silencing comprises epigenetic silencing (eg, a chromatic state that prevents gene expression).

[0142] According to one embodiment, the RNA silencing molecule is capable of mediating RNA inhibition after transcription (post-transcriptional gene silencing).

[0143] Post-transcriptional gene silencing (PTGS) generally refers to the process by which multiple messenger RNA (mRNA) molecules are degraded or cleaved, reducing their activity by preventing translation. For example, and as discussed in detail below, a guide strand of an RNA silencing molecule pairs with a complementary sequence in an mRNA molecule and induces cleavage, for example, by Argonaute 2 (Ago2).

[0144] Co-transcriptional gene silencing generally refers to the inactivation of gene activity (i.e., transcriptional inhibition), and usually occurs in the cell nucleus. This gene activity inhibition is mediated by multiple epigenetic-related factors, for example, methyltransferases, which methylate target DNA and histones. Therefore, in co-transcriptional gene silencing, the binding of a small RNA to a target RNA (small RNA-transcript interaction) destroys the stability of the target nascent transcript and recruits multiple DNA and histone modifying enzymes (i.e., multiple epigenetic factors), thereby inducing chromatin remodeling to a structure that inhibits gene activity and transcription. In addition, in co-transcriptional gene silencing, multiple long non-coding RNA scaffolds associated with chromatin may recruit multiple chromatin modification complexes independently of multiple small RNAs. These co-transcriptional silencing mechanisms form multiple RNA surveillance systems that detect and silence inappropriate transcriptional events and provide a memory of these events through multiple self-reinforcing epigenetic loops (as described in D. Hoch and D. Moazed, RNA-mediated epigenetic regulation of gene expression, Nat Rev Genet., 2015, 16(2): 71-84).

[0145] According to one embodiment of the present invention, the RNAi biogenesis / processing machinery produces the RNA silencing molecule.

[0146] According to one embodiment of the present invention, the RNAi biogenesis / processing machinery produces the RNA silencing molecule, but the specific target has not yet been identified.

[0147] According to one embodiment, the non-coding RNA molecule has the ability to induce RNA interference (RNAi).

[0148] The following is a detailed description of non-coding RNA molecules comprising an intrinsic RNAi activity (eg, RNA silencing molecules) that can be used according to certain embodiments of the present invention.

[0149] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a precursor.

[0150] According to one embodiment, the non-coding RNA molecule or RNA silencing molecule is processed from a single-stranded RNA (ssRNA) precursor.

[0151] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a single-stranded RNA precursor with a double-stranded structure.

[0152] According to one embodiment, the non-coding RNA molecule or RNA silencing molecule is processed from a dsRNA precursor (eg, including perfect and imperfect base pairing).

[0153] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from an unstructured RNA precursor.

[0154] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a protein-coding RNA precursor.

[0155] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a non-coding RNA precursor.

[0156] According to one embodiment, the dsRNA may be derived from two different complementary RNAs, or from a single RNA that folds upon itself to form the dsRNA.

[0157] Based on complete and incomplete paired RNA (i.e., double-stranded RNA, dsRNA), siRNA, and shRNA - the presence of multiple long dsRNAs in multiple cells stimulates the activity of a ribonuclease III enzyme (called dicer). Dicer, also known as endoribonuclease Dicer or helicase with RNase motifs, is an enzyme encoded by the DICER1 gene in humans. Dicer is involved in the process of processing the dsRNA into multiple short fragments of dsRNA (called short interfering RNA (siRNA)). The siRNA derived from dicer activity is typically about 21 to about 23 nucleotides in length and includes an approximately 19 base pair duplex with two 3' nucleotide overhangs.

[0158] Therefore, some embodiments of the present invention contemplate modifying a gene encoding a dsRNA to redirect silencing specificity (including silencing activity) toward a second target RNA (ie, the target of interest).

[0159] According to one embodiment, a plurality of dsRNA precursors longer than 21 bp are used. Various studies have shown that long dsRNA can be used to silence gene expression without inducing a stress response or causing significant off-target effects—see, for example, (Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13: 3803 to 3810; Bhargava A et al., Brain Res. Protoc., 2004, 13: 115 to 125; Diallo M. et al., Oligonucleotides, 2003, 13: 381 to 392; Paddison PJ et al., Proc. Natl Acad. Sci. USA, 2002, 99: 1443 to 1448; Tran N. et al., FEBS Lett., 2004, 573: 127 to 134).

[0160] The term "siRNA" refers to a small inhibitory RNA duplex (usually between 18 and 30 base pairs) that induces the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21-mers with a central 19 bp duplex region and symmetrical 2-base 3'-overhangs at the ends, although recently chemically synthesized RNA duplexes of 25 to 30 bases long have been described that are 100-fold more effective than 21-mers at the same positions. The observed increased efficacy obtained by using longer RNA to trigger RNAi is suggested to be caused by providing Dicer with a substrate (27-mers) rather than a product (21-mers), which increases the speed or efficiency of the siRNA duplex entry into RISC.

[0161] It has been found that the position (but not the composition) of the 3'-overhang affects the potency of an siRNA, and asymmetric duplexes with a 3'-overhang on the antisense strand are generally more potent than asymmetric duplexes with the 3'-overhang on the sense strand (Rose et al., 2005).

[0162] Multiple strands of a double-stranded interfering RNA (e.g., siRNA) can be linked to form a hairpin or stem-loop structure (e.g., an shRNA). Therefore, as described above, the RNA silencing molecule of some embodiments of the present invention can also be a short hairpin RNA (shRNA).

[0163] As used herein, the term short hairpin RNA ("shRNA") refers to an RNA molecule having a stem-loop structure, comprising a first and a second region of complementary sequence, the degree of complementarity and the orientation of the regions being sufficient to allow base pairing to occur between the regions, the first and second regions being connected by a loop region, the loop being caused by the lack of base pairing between the nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is between and including 3 and 23, or 5 and 15, or 7 and 13, or 4 and 9, or 9 and 11, and some of the nucleotides in the loop can participate in base pairing interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5'-CAAGAGA-3' and 5'-UUACAA-3' (International Patent Application Nos. WO2013126963 and WO2014107763). Those skilled in the art will appreciate that the resulting single-stranded oligonucleotide forms a stem-loop or hairpin structure, comprising a double-stranded region capable of interacting with the RNAi machinery.

[0164] The RNA silencing molecules of some embodiments of the present invention are not necessarily limited to those containing only RNA, but further include a plurality of chemically modified nucleotides and non-nucleotides.

[0165] The present invention contemplates various types of siRNAs, including trans-acting siRNA (Ta-siRNA), repeat-associated siRNA (Ra-siRNA), and natural-antisense transcript-derived siRNA (Nat-siRNA).

[0166] According to one embodiment, the silencing RNA comprises a "piRNA," which is a type of Piwi-interacting RNA with a length of approximately 26 and 31 nucleotides. Multiple piRNAs typically form multiple RNA-protein complexes by interacting with multiple Piwi proteins, i.e., multiple antisense piRNAs are typically loaded into multiple Piwi proteins (e.g., Piwi, Ago3, and Aubin (Aub)).

[0167] miRNA - According to another embodiment, the RNA silencing molecule can be a miRNA.

[0168] The terms "microRNA," "miRNA," and "miR" are synonymous and refer to a collection of noncoding, single-stranded RNA molecules of approximately 19 to 28 nucleotides in length that regulate gene expression. miRNAs are widely present in various organisms, including viruses, and have been shown to play a role in development, homeostasis, and disease pathogenesis.

[0169] Initially, the pre-miRNA exists as a long, non-perfectly double-stranded stem-loop RNA, which is further processed by Dicer into an siRNA-like duplex consisting of a mature guide strand (miRNA) and a similarly sized fragment, called the passenger strand (miRNA*). The miRNA and miRNA* can be derived from the opposite arms of the pri-miRNA and pre-miRNA. Multiple miRNA* sequences can be found in libraries of cloned miRNAs, but the frequency of occurrence is generally lower than that of miRNAs.

[0170] Although initially present as a double-stranded form with miRNA*, the miRNA ultimately becomes a single-stranded RNA incorporated into a ribonucleoprotein complex called the RNA-induced silencing complex (RISC). Various proteins can form the RISC, which can lead to variability in the specificity for the miRNA / miRNA* duplex, the binding site of the target gene, the activity of the miRNA (inhibition or activation), and which strand of the miRNA / miRNA* duplex is loaded into the RISC.

[0171] When the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the miRNA* is removed and degraded. The strand of the miRNA:miRNA* duplex loaded into the RISC is the strand with a loose 5' end pairing. In cases where both ends of the miRNA:miRNA* have approximately equal 5' pairing, both the miRNA and the miRNA* may have gene silencing activity.

[0172] The RISC identifies multiple target nucleic acids based on the high degree of complementarity between the miRNA and the mRNA, particularly through nucleotides 2 to 8 of the miRNA (referred to as the "seed sequence").

[0173] Many studies have focused on the base pairing requirements between miRNAs and their mRNA targets for effective translational repression (reviewed by Bartel (2004, Cell, 116-281)). Several computational studies analyzing miRNA binding across the genome have suggested a specific role for bases 2 to 8 at the 5' end of the miRNA (also known as the "seed sequence") in target binding, but a role for the first nucleotide, typically "A," has also been identified (Lewis et al., 2005, Cell, 120-15). Similarly, Krek et al. used nucleotides 1 to 7 or 2 to 8 to identify and validate multiple targets (2005, Nat Genet., 37-495). The multiple target sites in the mRNA can be in the 5'UTR, 3'UTR, or coding region. Interestingly, multiple miRNAs can regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA binding sites in most genetically identified targets may indicate that the coordinated action of multiple RISCs provides the most effective translational repression.

[0174] miRNAs may direct the RISC to downregulate gene expression through one of two mechanisms: mRNA cleavage or translational inhibition. If the mRNA has a certain degree of complementarity with the miRNA, the miRNA can direct the cleavage of the mRNA. When a miRNA directs cleavage, the cleavage is typically between the multiple nucleotides paired with residues 10 and 11 of the miRNA. Alternatively, if the miRNA does not have the necessary degree of complementarity with the miRNA, the miRNA can inhibit translation. Translational inhibition may be more prevalent in animals due to a lower degree of complementarity between the miRNA and the binding site.

[0175] It should be noted that there may be variability in the 5' and 3' ends of any pair of miRNA and miRNA*. This variability may be due to variability relative to the cleavage site during enzymatic processing by Drosha and Dicer. The variability at the 5' and 3' ends of miRNA and miRNA* may also be due to mismatches in the multiple stem structures of the pri-miRNA and pre-miRNA. The mismatches in the multiple stem strands may result in a large number of different hairpin structures. The variability in the multiple stem structures may also result in variability in multiple products cleaved by Drosha and Dicer.

[0176] It will be appreciated that the pre-miRNA sequence may comprise 45 to 90, 60 to 80, or 60 to 70 nucleotides, while the pri-miRNA sequence may comprise 45 to 30,000, 50 to 25,000, 100 to 20,000, 1,000 to 1,500, or 80 to 100 nucleotides.

[0177] According to one embodiment, the miRNA comprises miR-150 (eg, human miR-150, as shown in SEQ ID NO: 13).

[0178] According to one embodiment, the miRNA comprises miR-210 (eg, human miR-210, as shown in SEQ ID NO: 14).

[0179] According to one embodiment, the miRNA comprises Let-7 (eg, human Let-7, as shown in SEQ ID NO: 15).

[0180] According to one embodiment, the miRNA comprises miR-184 (eg, human miR-184, as shown in SEQ ID NO: 16).

[0181] According to one embodiment, the miRNA comprises miR-204 (eg, human miR-204, as shown in SEQ ID NO: 17).

[0182] According to one embodiment, the miRNA comprises miR-25 (eg, human miR-25, as shown in SEQ ID NO: 18).

[0183] According to one embodiment, the miRNA comprises miR-34 (eg, human miR-34a / b / c, as shown in SEQ ID NOs: 19 to 21, respectively).

[0184] Additional miRNAs are provided in Table 1B below.

[0185] Antisense - Antisense is a single-stranded RNA designed to prevent or inhibit the expression of a gene by specifically hybridizing to its mRNA. Downregulation of a target RNA can be achieved using an antisense polynucleotide that is capable of specifically hybridizing to an mRNA transcript encoding the target RNA.

[0186] As mentioned above, the non-coding RNA molecule may not include a typical (intrinsic) RNAi activity (e.g., it is not a typical RNA silencing molecule, or its target has not yet been identified). Such non-coding RNA molecules include the following:

[0187] According to one embodiment, the non-coding RNA molecule is a transfer RNA (tRNA). The term "tRNA" refers to an RNA molecule that serves as a physical link between the nucleotide sequences of multiple nucleic acids and the amino acid sequences of multiple proteins, formerly known as soluble RNA or sRNA. tRNA is typically about 76 to 90 nucleotides in length.

[0188] According to one embodiment, the non-coding RNA molecule is a ribosomal RNA (rRNA). The term "rRNA" refers to the RNA component of the ribosome, i.e., the small ribosomal subunit or the large ribosomal subunit.

[0189] According to one embodiment, the non-coding RNA molecule is a small nuclear RNA (snRNA or U-RNA). The term "sRNA" or "U-RNA" refers to a plurality of small RNA molecules found in the splicing speckles and Cajal bodies of the nucleus of various eukaryotic cells. The length of snRNA is generally about 150 nucleotides.

[0190] According to one embodiment, the non-coding RNA molecule is a small nucleolar RNA (snoRNA). The term "snoRNA" refers to a class of small RNA molecules that primarily guide the chemical modification of other RNAs (e.g., rRNA, tRNA, and snRNA). snoRNAs are generally divided into two categories: C / D box snoRNAs are typically about 70 to 120 nucleotides in length and are associated with methylation; and H / ACA box snoRNAs are typically about 100 to 200 nucleotides in length and are associated with pseudouridylation.

[0191] Similar to snoRNAs are scaRNAs (small Cajal body RNA genes), which play a similar role in RNA maturation as snoRNAs, but their targets are spliceosomal snRNAs, and they perform site-specific modifications on spliceosomal snRNA precursors (in the Cajal bodies of the nucleus).

[0192] According to one embodiment, the non-coding RNA molecule is an extracellular RNA (exRNA). The term "exRNA" refers to RNA species that exist outside the cells where they are transcribed (e.g., exosomal RNA).

[0193] According to one embodiment, the non-coding RNA molecule is a long non-coding RNA (lncRNA). The term "lncRNA" or "long ncRNA" refers to a non-protein coding transcript that is generally longer than 200 nucleotides.

[0194] According to one embodiment, non-limiting examples of multiple non-coding RNA molecules include, but are not limited to, microRNA (miRNA), piwi-interacting RNA (piRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), trans-acting siRNA (tasiRNA), small nuclear RNA (snRNA or URNA), small nucleolar RNA (snoRNA), small Cajal RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), extracellular RNA (exRNA), repeat-derived RNA, transposable element RNA, and long non-coding RNA (lncRNA).

[0195] According to one embodiment, non-limiting examples of multiple RNAi molecules include, but are not limited to, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), Piwi-interacting RNA (piRNA), and trans-acting siRNA (tasiRNA).

[0196] As described above, the methods of some embodiments of the present invention are used to redirect a silencing activity and / or specificity of the non-coding RNA molecule (or, if the non-coding RNA molecule does not have an inherent ability to silence an RNA molecule, to generate a silencing activity and / or specificity) to a second target RNA or to a target RNA of interest.

[0197] According to one embodiment, said target RNA and said second target RNA are different.

[0198] According to one embodiment, a method for modifying a gene encoding or processed into an RNA silencing molecule in a eukaryotic cell, provided that the eukaryotic cell is not a plant cell, comprises introducing a DNA editing agent into the eukaryotic cell, wherein the DNA editing agent redirects the silencing activity and / or specificity of the RNA silencing molecule to a second target RNA, wherein the target RNA and the second target RNA are different, thereby modifying the gene encoding the RNA silencing molecule.

[0199] As used herein, the term "redirecting silencing specificity" refers to reprogramming the original specificity of the non-coding RNA (e.g., RNA silencing molecule) to a non-natural target of the non-coding RNA (e.g., RNA silencing molecule). Thus, the original specificity of the non-coding RNA is destroyed (i.e., loss of function), and the new specificity is directed to an RNA target different from the natural target (i.e., RNA of interest), i.e., gain of function. It should be understood that gain of function occurs only when the non-coding RNA has no silencing activity.

[0200] As used herein, the term "target RNA" refers to an RNA sequence that is naturally bound by a non-coding RNA molecule. Therefore, those skilled in the art consider the target RNA to be a substrate of the non-coding RNA.

[0201] As used herein, the term "second target RNA" refers to an RNA sequence (coding or non-coding) that is not naturally bound by a non-coding RNA molecule. Therefore, the second target RNA is not a natural substrate of the non-coding RNA.

[0202] As used herein, the term "target RNA of interest" refers to an RNA sequence (coding or non-coding) that is silenced by a designed non-coding RNA molecule.

[0203] As used herein, the phrase "silencing a target gene" refers to the absence or observable reduction in the levels of protein and / or mRNA products from the target gene. Thus, silencing of a target gene can be reduced by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% compared to a target gene not targeted by the designed non-coding RNA molecule of the present invention.

[0204] The outcome of silencing can be confirmed by examining various external characteristics of a eukaryotic cell or organism or by various biochemical techniques (as described below).

[0205] It should be understood that the designed non-coding RNA molecules of some embodiments of the present invention may have some off-target specific effects, provided that they do not affect the growth, differentiation or function of the eukaryotic cells or organisms.

[0206] According to one embodiment, the second target RNA or target RNA of interest is endogenous to the eukaryotic cell. Exemplary endogenous second target RNA or target RNA of interest include, but are not limited to, a gene product associated with cancer and / or apoptosis. Exemplary target genes associated with cancer include, but are not limited to, p53, BAX, PUMA, NOXA, and FAS genes, as discussed in detail below.

[0207] According to one embodiment, the second target RNA or target RNA of interest is exogenous to the eukaryotic cell (also referred to herein as heterologous). In this case, the second target RNA or target RNA of interest is a product of a gene that is not a natural part of the genome of the eukaryotic cell (i.e., the non-coding RNA is expressed). Exemplary exogenous target RNAs include, but are not limited to, products of a gene associated with an infectious disease, for example, a gene of a pathogen (e.g., an insect, a virus, a bacterium, a fungus, a nematode), as discussed further below. An exogenous target RNA (coding or non-coding) can include a nucleic acid sequence that shares sequence identity with an endogenous RNA sequence of the eukaryotic organism (e.g., can be partially homologous to an endogenous nucleic acid sequence).

[0208] The specific binding of an endogenous non-coding RNA molecule to a target RNA can be determined by computational algorithms (e.g., BLAST) and can be identified by methods including, for example, Northern blot, in situ hybridization, QuantiGene Plex analysis, etc.

[0209] The term "complementarity" or "complementary" refers to the ability of the non-coding RNA molecule (or at least a portion thereof in the form of the processed small RNA, or at least one strand of a double-stranded polynucleotide or a portion thereof, or a portion of a single-stranded polynucleotide) to hybridize with the target RNA or a fragment thereof under physiological conditions to achieve regulation, action or inhibition of the target gene. For example, in some embodiments, when compared to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 In some embodiments, a non-coding RNA molecule has 100% sequence identity, or at least about 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity when compared to a sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 150, 200, 300, 400, 500 or more consecutive nucleotides.

[0210] As used herein, a non-coding RNA molecule or processed small RNA form thereof is said to exhibit "complete complementarity" when every nucleotide of one of the multiple sequences read from 5' to 3' is complementary to every nucleotide of the other sequence read from 3' to 5'. A nucleotide sequence that is completely complementary to a reference nucleotide sequence will exhibit a sequence that is identical to the reverse complement of the reference nucleotide sequence.

[0211] Methods for determining sequence complementarity are well known in the art and include, but are not limited to, a variety of bioinformatics tools well known in the art (eg, BLAST, multiple sequence alignment).

[0212] According to one embodiment, if the non-coding RNA molecule is an siRNA or is processed into an siRNA, the complementarity to its target sequence is in the range of 90 to 100% (eg, 100%).

[0213] According to one embodiment, if the non-coding RNA molecule is a miRNA or piRNA, or is processed into a miRNA or piRNA, the complementarity to its target sequence is in the range of 33 to 100%.

[0214] According to one embodiment, if the non-coding RNA molecule is a miRNA, the complementarity of the seed sequence to its target sequence (ie, from nucleotides 2 to 8 of the 5' end) is in the range of 85 to 100% (eg, 100%).

[0215] According to one embodiment, the non-coding RNA can be further processed into a small RNA form (e.g., pre-miRNA is processed into a mature miRNA). In this case, homology is measured based on the processed small RNA form (e.g., the mature miRNA sequence).

[0216] As used herein, the term "small RNA form" refers to the mature small RNA that is capable of hybridizing with a target RNA (or a fragment thereof). According to one embodiment, the small RNA form has a silencing activity.

[0217] According to one embodiment, the complementarity with the target sequence is at least about 33% of the processed small RNA form (e.g., 33% of 21 to 24 nt). Thus, for example, if the non-coding RNA molecule is a miRNA, 33% of the mature miRNA sequence (e.g., within 21 nt) includes seed complementarity (e.g., 7 nt within the 21 nt).

[0218] According to one embodiment, the complementarity with the target sequence is at least about 45% of the processed small RNA form (e.g., 45% of 21 to 28 nt). Thus, for example, if the non-coding RNA molecule is a miRNA, 45% of the mature miRNA sequence (e.g., 21 nt) includes seed complementarity (e.g., 9 to 10 nt of the 21 nt).

[0219] According to one embodiment, the non-coding RNA (i.e., before modification) is typically selected as a molecule having about 10%, 20%, 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or up to 99% complementarity to the sequence of the second target RNA or target RNA of interest.

[0220] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected to have no more than 99% complementarity to said sequence of said second target RNA or target RNA of interest.

[0221] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 98% complementarity to said sequence of said second target RNA or target RNA of interest.

[0222] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 97% complementarity to said sequence of said second target RNA or target RNA of interest.

[0223] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 96% complementarity to said sequence of said second target RNA or target RNA of interest.

[0224] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 95% complementarity to said sequence of said second target RNA or target RNA of interest.

[0225] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 90% complementarity to said sequence of said second target RNA or target RNA of interest.

[0226] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 85% complementarity to said sequence of said second target RNA or target RNA of interest.

[0227] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 50% complementarity to said sequence of said second target RNA or target RNA of interest.

[0228] According to a specific embodiment, said non-coding RNA molecule (ie before modification) is typically selected as a molecule having no more than 30% complementarity to said sequence of said second target RNA or target RNA of interest.

[0229] According to one embodiment, the non-coding RNA molecule (e.g., RNA silencing molecule) is designed to comprise at least about 33%, 40%, 45%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% complementarity to the sequence of the second target RNA or target RNA of interest.

[0230] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 33% complementarity to the second target RNA or target RNA of interest (eg, 85 to 100% seed match).

[0231] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 40% complementarity to the second target RNA or target RNA of interest.

[0232] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 45% complementarity to the second target RNA or target RNA of interest.

[0233] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 50% complementarity to the second target RNA or target RNA of interest.

[0234] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 60% complementarity to the second target RNA or target RNA of interest.

[0235] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 70% complementarity to the second target RNA or target RNA of interest.

[0236] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 80% complementarity to the second target RNA or target RNA of interest.

[0237] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 85% complementarity to the second target RNA or target RNA of interest.

[0238] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 90% complementarity to the second target RNA or target RNA of interest.

[0239] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 95% complementarity to the second target RNA or target RNA of interest.

[0240] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 96% complementarity to the second target RNA or target RNA of interest.

[0241] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 97% complementarity to the second target RNA or target RNA of interest.

[0242] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 98% complementarity to the second target RNA or target RNA of interest.

[0243] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to comprise at least 99% complementarity to the second target RNA or target RNA of interest.

[0244] According to a specific embodiment, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to include 100% complementarity to the second target RNA or target RNA of interest.

[0245] In order to generate the silencing activity and / or specificity of a non-coding RNA molecule or redirect the silencing activity and / or specificity of a non-coding RNA molecule (e.g., RNA silencing molecule) to a second target RNA or target RNA of interest, a DNA editing agent is used to modify the gene encoding a non-coding RNA molecule (e.g., RNA silencing molecule).

[0246] The following is a description of various non-limiting examples of methods and DNA editing agents for introducing nucleic acid changes into a gene encoding a non-coding RNA molecule (e.g., an RNA silencing molecule), as well as reagents for implementing the methods and DNA editing agents that can be used according to specific embodiments of the present disclosure.

[0247] Genome editing using engineered endonucleases - This approach refers to a reverse genetics approach that typically uses artificially engineered nucleases to cut and create multiple specific double-stranded breaks (DSBs) at the desired location(s) in the genome, which are then repaired by various cellular endogenous processes, such as homologous recombination (HR) or non-homologous end-joining (NHEJ). NHEJ directly joins the DNA ends at a double-strand break (DSB) (with or without minimal end modifications), while HR utilizes a homologous donor sequence as a template (i.e., sister chromatids formed during S phase) to regenerate / replicate the missing DNA sequence at the break site. In order to introduce multiple specific nucleotide modifications into the genomic DNA, a donor DNA repair template (exogenously provided single-stranded or double-stranded DNA) containing the desired sequence must be present during HR.

[0248] Genome editing cannot be performed using traditional restriction endonucleases because most restriction enzymes recognize a few base pairs on the DNA as their targets, and these sequences are typically found in many locations in the genome, resulting in multiple cuts that are not limited to a desired location. To overcome this challenge and generate multiple site-specific single-strand or double-strand breaks (DSBs), several different classes of nucleases have been discovered and bioengineered to date. These include meganucleases, zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs), and the CRISPR / Cas9 (and all its variants) system.

[0249] Meganucleases - Meganucleases are generally divided into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by multiple structural motifs that influence catalytic activity and recognition sequences. For example, multiple members of the LAGLIDADG family are characterized by having one or two copies of a preserved LAGLIDADG motif. These four meganuclease families are largely distinguished from each other in terms of multiple preserved structural elements as well as DNA recognition sequence specificity and catalytic activity. Meganucleases are commonly found in microbial species and have the unique property of having multiple very long recognition sequences (>14 bp), thereby making them naturally very specific for cleavage at a desired location.

[0250] This can be used to create multiple site-specific double-strand breaks (DSBs) in genome editing. Those skilled in the art can use these naturally occurring meganucleases, but the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutagenesis and high-throughput screening methods have been used to generate multiple meganuclease variants that recognize multiple unique sequences. For example, various meganucleases have been fused to generate multiple hybrid enzymes that recognize a new sequence.

[0251] Alternatively, multiple DNA-interacting amino acids of the meganuclease can be altered to design sequence-specific meganucleases (e.g., see U.S. Patent No. 8,021,867). Meganucleases can be designed using methods such as those described in Certo, MT et al. (Nature Methods, 2012, 9:073-975), U.S. Patent Nos. 8,304,222, 8,021,867, 8,119,381, 8,124,369, 8,129,134, 8,133,697, 8,143,015, 8,143,016, 8,148,098, or 8,163,514, each of which is incorporated herein by reference in its entirety. Alternatively, commercially available technologies (e.g., Precision Biosciences' directed nuclease editor) can be used to design sequence-specific meganucleases. TM (Directed Nuclease Editor TM ) genome editing technology) to obtain meganucleases with site-specific cleavage characteristics.

[0252] ZFNs and TALENs - Two different engineered nucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both been shown to efficiently generate multiple targeted double-strand breaks (DSBs) (Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).

[0253] Basically, ZFN and TALEN restriction endonuclease technology utilizes a non-specific DNA cutting enzyme that is connected to a specific DNA binding domain (a series of multiple zinc finger domains or multiple TALE repeat sequences, respectively). Typically, a restriction enzyme is selected whose DNA recognition site and cleavage site are separated from each other. The cleavage portion is separated and then connected to a DNA binding domain, thereby producing a nuclease with very high specificity for a desired sequence. An exemplary restriction enzyme with this property is Fok1. In addition, the advantage of Fok1 is that dimerization is required to have nuclease activity, which means that as each nuclease partner recognizes a unique DNA sequence, the specificity is significantly increased. In order to enhance this effect, multiple Fok1 nucleases have been engineered that can only function as multiple heterodimers and have increased catalytic activity. The heterodimer acts on the nuclease to avoid the possibility of unwanted homodimer activity, thereby increasing the specificity of the double-strand break (DSB).

[0254] Therefore, for example, in order to target a specific site, multiple ZFNs and multiple TALENs are constructed as multiple nuclease pairs, each molecule in the pair being designed to bind to multiple adjacent sequences at the target site. After transient expression in multiple cells, the multiple nucleases bind to their multiple target sites, and the multiple FokI domains heterodimerize to produce a double-strand break (DSB). Repairing these double-strand breaks (DSBs) by the non-homologous end joining (NHEJ) approach typically results in multiple small deletions or multiple small sequence insertions (Indels). Since each repair performed by NHEJ is unique, an allelic series (allelic series) with a series of multiple different insertions or deletions can be produced at the target site using a single nuclease pair.

[0255] In general, NHEJ is relatively accurate in gene editing (approximately 85% of DSBs in human cells are repaired by NHEJ within approximately 30 minutes of detection). Error-dependent NHEJ is critical because, when the repair is accurate, the nuclease will continue to cleave until the repair product mutates and the recognition / cleavage site / PAM motif disappears / mutates, or the transiently introduced nuclease is no longer present.

[0256] Deletions typically range in length from a few base pairs to several hundred base pairs, but larger deletions have been successfully generated in cell culture by using two nuclease pairs simultaneously (Carlson et al., 2012; Lee et al., 2010). Furthermore, when a DNA fragment with homology to the targeted region is introduced in conjunction with the nuclease pair, the double-strand break (DSB) can be repaired by homologous recombination (HR) to generate multiple specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).

[0257] Although the multiple nuclease parts of multiple ZFNs and multiple TALENs have similar properties, the difference between these engineered nucleases lies in their DNA recognition peptides. ZFN relies on Cys2-His2 zinc fingers, while TALEN relies on TALEs. These DNA recognition peptide domains of both have a characteristic that they naturally occur in the combination of their proteins. Multiple Cys2-His2 zinc fingers are typically present in multiple repeat sequences with a spacing of 3bp and are present in multiple different combinations of multiple nucleic acid interacting proteins. On the other hand, multiple TALEs are present in multiple repeat sequences with a one-to-one recognition rate between the multiple amino acids and the multiple recognized nucleotide pairs. Since both zinc fingers and TALEs occur in a repeated pattern, different combinations can be tried to create a variety of sequence specificities. Various methods for preparing site-specific zinc finger endonucleases include, for example, modular assembly (where multiple zinc fingers associated with a triplet sequence are linked in a row to cover the desired sequence), OPEN (low stringency selection of multiple peptide domains against multiple triplet nucleotides, followed by high stringency selection of multiple peptide combinations against the final target in multiple bacterial systems), and bacterial one-hybrid screening of multiple zinc finger libraries. ZFNs can also be obtained from, for example, Sangamo Biosciences TM (Richmond, CA) Commercial Design and Acquisition.

[0258] Methods for designing and obtaining TALENs are described, for example, in Reyon et al. (Nature Biotechnology, 2012 May; 30(5):460-5), Miller et al. (Nat Biotechnol., 2011, 29:143-148), Cermak et al. (Nucleic Acids Research, 2011, 39(12):e82), and Zhang et al. (Nature Biotechnology, 2011, 29(2):149-53). A recently developed web-based program (called Mojo Hand) introduced by the Mayo Clinic is used to design multiple TAL and TALEN constructs for genome editing applications (accessible through www(dot)talendesign(dot)org). ZFNs can also be obtained from, for example, Sangamo Biosciences TM (Richmond, CA) Commercial Design and Acquisition.

[0259] The T-GEE system (Target Gene's Genome Editing Engine) provides a programmable nucleoprotein molecular complex comprising a polypeptide portion and a specificity conferring nucleic acid (SCNA), which is assembled in vivo in a target cell and is capable of interacting with a predetermined target nucleic acid sequence. The programmable nucleoprotein molecular complex is capable of specifically modifying and / or editing a target site within the target nucleic acid sequence and / or modifying the function of the target nucleic acid sequence. The nucleoprotein composition comprises (a) a polynucleotide molecule encoding a chimeric polypeptide and comprising (i) a functional domain capable of modifying the target site, and (ii) a linker domain capable of interacting with the specificity conferring nucleic acid; and (b) a specificity conferring nucleic acid (SCNA), which comprises (i) a nucleotide sequence complementary to the region of the target nucleic acid on both sides of the target site, and (ii) a recognition region capable of specifically attaching to the linker domain of the polypeptide. By conferring base pairing between a specific nucleic acid and a target nucleic acid, the composition exhibits high specificity and the ability of the molecular complex to bind to the target nucleic acid, enabling accurate, reliable, and cost-effective modification of a predetermined nucleic acid sequence target. The composition also exhibits low genotoxicity, modular assembly, utilizes a single platform that requires no customization, can be used independently outside of dedicated core facilities, and has a short development cycle and low cost.

[0260] CRISPR-Cas systems and all their variants (also referred to herein as "CRISPR") - Many bacteria and archea contain an endogenous RNA-based adaptive immune system that can degrade multiple nucleic acids from invading phages and plasmids. These systems consist of multiple clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that produce multiple RNA components and CRISPR-related (Cas) genes (encoding multiple protein components). The multiple CRISPR RNAs (crRNAs) contain very short homologies to the DNA of multiple specific viruses and plasmids and guide the Cas nuclease to degrade multiple nucleic acids complementary to the corresponding pathogens. Studies of the type II CRISPR / Cas system of Streptococcus pyogenes indicate that three components form an RNA / protein complex that together are sufficient for sequence-specific nuclease activity: the Cas9 nuclease, a crRNA with 20 base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al., Science, 2012, 337:816-821).

[0261] It was further demonstrated that a synthetic chimeric guide RNA (gRNA) consisting of a fusion between crRNA and tracrRNA can direct Cas9 in vitro to cleave multiple DNA targets complementary to the crRNA. It was also demonstrated that co-transient expression of Cas9 with multiple synthetic gRNAs can be used to generate targeted double-strand breaks (DSBs) in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a, b; Jinek et al., 2013; Mali et al., 2013).

[0262] The CRISPR / Cas system for genome editing contains two distinct components: a gRNA and an endonuclease, such as Cas9.

[0263] The gRNA (also referred to herein as short guide RNA (sgRNA)) is typically a 20-nucleotide sequence that encodes a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA (linking the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA / Cas9 complex is recruited to the target sequence by base pairing between the gRNA sequence and the complementary genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct protospacer adjacent motif (PAM) sequence immediately following the target sequence. The binding of the gRNA / Cas9 complex positions the Cas9 at the genomic target sequence so that the Cas9 can cleave both strands of the DNA, resulting in a double-strand break (DSB). Like ZFNs and TALENs, the double-strand breaks (DSBs) generated by CRISPR / Cas can undergo homologous recombination or NHEJ and are prone to specific sequence modifications during DNA repair.

[0264] The Cas9 nuclease has two functional domains: RuvC and HNH, each of which cuts a different DNA strand. When both of these domains are active, the Cas9 will cause multiple double-strand breaks (DSBs) in the genomic DNA.

[0265] A significant advantage of CRISPR / Cas is the high efficiency of this system combined with the ability to easily produce multiple synthetic gRNAs. This creates a system that can be easily modified to target multiple modifications at different genomic sites and / or target multiple different modifications at the same site. In addition, protocols have been established that can simultaneously target multiple genes. Most cells carrying the mutations exhibit multiple biallelic mutations in the multiple targeted genes.

[0266] However, apparent flexibility in the base-pairing interaction between the gRNA sequence and the genomic DNA target sequence allows imperfect matches to the target sequence to be cleaved by Cas9.

[0267] Modified forms of the Cas9 enzyme that contain a single inactive catalytic domain (RuvC- or HNH-) are called "nickases." With only one active nuclease domain, the Cas9 nickase only cuts one strand of the target DNA, creating a single-strand break or "nick." A single-strand break or nick is mostly repaired by single-strand break repair mechanisms involving proteins such as, but not limited to, PARP (sensor) and the XRCC1 / LIG III complex (ligation). If a single-strand break (SSB) is generated at a naturally occurring SSB by topoisomerase I poisons or by drug-trapping RARP1, these may persist, and when the cell enters S phase and the replication fork encounters such SSBs, they will become single-ended DSBs that can only be repaired by HR. However, two proximal, opposite-strand nicks introduced by a Cas9 nickase are considered a double-strand break, often referred to as a "double nick" CRISPR system. A double nick, essentially a non-parallel DSB, can be repaired by HR or NHEJ like other DSBs, depending on the desired effect on the gene target and the presence of a donor sequence and the cell cycle phase (HR is less abundant and can only occur during the S and G2 phases of the cell cycle). Therefore, if specificity and reduced off-target effects are critical, using the Cas9 nickase to generate a double nick (by designing two gRNAs and multiple target sequences in close proximity and on multiple opposing strands of the genomic DNA) will reduce off-target effects, as either gRNA alone will cause a nick that is unlikely to alter the genomic DNA, even though such events are not impossible.

[0268] A modified form of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9 or dCas9) has no nuclease activity but is still able to bind to DNA based on gRNA specificity. The dCas9 can be used as a platform for multiple DNA transcription regulators, activating or inhibiting gene expression by fusing the inactive enzyme to known regulatory domains. For example, the binding of dCas9 alone to a target sequence in genomic DNA can interfere with gene transcription.

[0269] There are many publicly available tools that can assist in the selection and / or design of multiple target sequences and bioinformatically determined lists of unique gRNAs for different genes in different species, such as, but not limited to, Target Finder from Feng Zhang's laboratory, Target Finder (E-CRISP) from Michael Boutros' laboratory, RGEN Tools: Cas-OFFinder, CasFinder: A Flexible Algorithm for Identifying Specific Cas9 Targets in the Genome, and CRISPR Optimal Target Finder.

[0270] In order to use the CRISPR system, both the gRNA and a Cas endonuclease (e.g., Cas9) should be expressed or present in a target cell (e.g., as a ribonucleoprotein complex). The insertion vector can contain two cassettes on a single plasmid, or the multiple cassettes can be expressed from two separate plasmids. Multiple CRISPR plasmids are commercially available, for example, the px330 plasmid from Addgene (75 Sidney St, Suite 550A, Cambridge, MA 02139). Bauer et al. (J Vis Exp., 2015, (95): e52118. doi: 10.3791 / 52118) disclose at least one method for modifying mammalian genomes using clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) guide RNA technology and a Cas endonuclease, the contents of which are incorporated herein by reference in their entirety. Cas endonucleases that can be used for DNA editing via gRNA include, but are not limited to, Cas9, Cpf1 (Zetsche et al., 2015, Cell, 163(3):759-71), C2c1, C2c2, and C2c3 (Shmakov et al., Mol Cell., 2015 Nov 5;60(3):385-97).

[0271] According to a specific embodiment, the CRISPR comprises a short guide RNA (sgRNA) comprising a nucleic acid sequence as shown in SEQ ID NOs: 5 to 6 or SEQ ID NOs: 165 to 236.

[0272] The "hit and run" or "in-out" strategy of gene targeting involves a two-step recombination procedure. In the first step, an insertion vector containing a dual positive / negative selection marker cassette is used to introduce the desired sequence change. The insertion vector contains a single continuous region of homology to the targeted locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at a site within the homology region, introduced into the cells, and positive selection is performed to isolate homologous recombination-mediated events. The DNA carrying the homologous sequence can be provided in the form of a plasmid, single-stranded or double-stranded oligonucleotide. These homologous recombinants contain a local duplication separated by an intermediate vector sequence containing the selection cassette. In the second step, multiple targeted clones are negatively selected to identify multiple cells that have lost the selection cassette by intrachromosomal recombination between the repeated sequences. The local recombination event removes the duplication and, depending on the recombination site, the allele retains the introduced mutation or reverts to wild type. The end result is the introduction of the desired modification without retaining any exogenous sequence.

[0273] "Double-replacement" or "tag and exchange" strategy: involves a two-step selection procedure, similar to the hit and run approach to gene targeting, but requires the use of two different target constructs. In the first step, a standard targeting vector with 3' and 5' homology arms is used to insert a dual positive / negative selection cassette near the location where the mutation is to be introduced. After the system components are introduced into the cells and positive selection is performed, HR-mediated events can be identified. Next, a second targeting vector containing a region of homology to the desired mutation is introduced into multiple targeted clones, and negative selection is performed to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation while eliminating the unwanted exogenous sequence.

[0274] According to a specific embodiment, the DNA editing agent includes a DNA targeting module (e.g., gRNA).

[0275] According to a specific embodiment, the DNA editing agent does not include an endonuclease.

[0276] According to a specific embodiment, the DNA editing agent includes a nuclease (e.g., an endonuclease) and a DNA targeting module (e.g., gRNA).

[0277] According to a specific embodiment, the DNA editing agent is a CRISPR / Cas, for example, gRNA and Cas9.

[0278] According to a specific embodiment, the DNA editing agent is TALEN.

[0279] According to a specific embodiment, the DNA editing agent is ZFN.

[0280] According to a specific embodiment, the DNA editing agent is a nuclease.

[0281] According to one embodiment, the DNA editing agent is linked to a reporter for monitoring expression in a eukaryotic cell.

[0282] According to one embodiment, the reporter is a fluorescent reporter protein.

[0283] The term "a fluorescent protein" refers to a polypeptide that fluoresces and is typically detected by flow cytometry, microscopy or any fluorescence imaging system, and can therefore be used as a basis for selecting cells expressing this protein.

[0284] Examples of fluorescent proteins that can be used as reporters include, but are not limited to, green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent proteins (e.g., dsRed, mCherry, RFP). A non-limiting list of fluorescent or other reporters includes proteins that are detected by luminescence (e.g., luciferase) or colorimetric assays (e.g., GUS). According to a specific embodiment, the fluorescent reporter is a red fluorescent protein (e.g., dsRed, mCherry, RFP) or GFP.

[0285] A review of the multiple new classes and applications of various fluorescent proteins can be found in Trends in Biochemical Sciences (Rodriguez, Erik A.; Campbell, Robert E.; Lin, John Y.; Lin, Michael Z.; Miyawaki, Atsushi; Palmer, Amy E.; Shu, Xiaokun; Zhang, Jin; Tsien, Roger Y., “The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins,” Trends in Biochemical Sciences, doi: 10.1016 / j.tibs.2016.09.010).

[0286] According to another embodiment, the reporter is an antibiotic selection marker. Examples of multiple antibiotic selection markers that can be used as multiple reporters include, but are not limited to, neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). Other multiple marker genes that can be used according to the present teachings include, but are not limited to, gentamycin acetyltransferase (accC3) resistance and bleomycin and phleomycin resistance genes.

[0287] It is understood that the enzyme NPTII inactivates many aminoglycoside antibiotics by phosphorylation, for example, kanamycin, neomycin, geneticin (or G418), and paromomycin, among which G418 is commonly used to select transformed mammalian cells.

[0288] Regardless of the DNA editing agent used, the method of the present invention is used so that the gene encoding the non-coding RNA molecule (e.g., RNA silencing molecule) is modified by at least one of a deletion, an insertion, or a point mutation.

[0289] According to one embodiment, the modification is in a structured region of the non-coding RNA molecule or the RNA silencing molecule.

[0290] According to one embodiment, the modification is in a stem region of the non-coding RNA molecule or the RNA silencing molecule.

[0291] According to one embodiment, the modification is in a loop region of the non-coding RNA molecule or the RNA silencing molecule.

[0292] According to one embodiment, the modification is in a stem region and a loop region of the non-coding RNA molecule or the RNA silencing molecule.

[0293] According to one embodiment, the modification is in an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

[0294] According to one embodiment, the modification is in a stem region, a loop region and an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

[0295] According to a specific embodiment, the modifications include modifications of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0296] According to one embodiment, the modifications include modifications of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0297] According to one embodiment, the modification can be a continuous nucleic acid sequence (e.g., at least 5, 10, 20, 30, 40, 50, 100, 150, 200 bases).

[0298] According to one embodiment, the modification can be in a non-contiguous manner, for example, throughout a sequence of 20, 50, 100, 150, 200, 500, 1000 nucleic acids.

[0299] According to a specific embodiment, the modification comprises modification of up to 200 nucleotides.

[0300] According to a specific embodiment, the modification comprises modification of up to 150 nucleotides.

[0301] According to a specific embodiment, the modification comprises modification of up to 100 nucleotides.

[0302] According to a specific embodiment, the modification comprises modification of up to 50 nucleotides.

[0303] According to a specific embodiment, the modification comprises modification of up to 25 nucleotides.

[0304] According to a specific embodiment, the modification comprises modification of up to 20 nucleotides.

[0305] According to a specific embodiment, the modification comprises modification of up to 15 nucleotides.

[0306] According to a specific embodiment, the modification comprises modification of at most 10 nucleotides.

[0307] According to a specific embodiment, the modification comprises modification of up to 5 nucleotides.

[0308] According to one embodiment, said modification depends on said structure of said RNA silencing molecule.

[0309] Therefore, when the RNA silencing molecule contains a non-essential structure (i.e., a secondary structure of the RNA silencing molecule does not play a role in its proper biogenesis and / or function) or is pure dsRNA (i.e., the RNA silencing molecule has a complete or almost complete dsRNA), some modifications (e.g., 20 to 30 nucleotides, e.g., 1 to 10 nucleotides, e.g., 5 nucleotides) are introduced to redirect the silencing specificity of the RNA silencing molecule.

[0310] According to another embodiment, when the RNA silencing molecule has an essential structure (i.e., the proper biogenesis and / or activity of the RNA silencing molecule depends on its secondary structure), multiple larger modifications (e.g., 10 to 200 nucleotides, e.g., 50 to 150 nucleotides, e.g., more than 30 nucleotides and not more than 200 nucleotides, 30 to 200 nucleotides, 35 to 200 nucleotides, 35 to 150 nucleotides, 35 to 100 nucleotides) are introduced to redirect the silencing specificity of the RNA silencing molecule.

[0311] According to one embodiment, the modification is such that the recognition / cleavage site / PAM motif of the RNA silencing molecule is modified to eliminate the original PAM recognition site.

[0312] According to a specific embodiment, the modification is in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acids in a PAM motif.

[0313] According to one embodiment, the modification comprises an insertion.

[0314] According to a specific embodiment, the insertion comprises an insertion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0315] According to a specific embodiment, the insertion comprises an insertion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0316] According to one embodiment, the insertion comprises an insertion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0317] According to a specific embodiment, the insertion comprises an insertion of at most 200 nucleotides.

[0318] According to a specific embodiment, the insertion comprises an insertion of at most 150 nucleotides.

[0319] According to a specific embodiment, the insertion comprises an insertion of at most 100 nucleotides.

[0320] According to a specific embodiment, the insertion comprises an insertion of at most 50 nucleotides.

[0321] According to a specific embodiment, the insertion comprises an insertion of at most 25 nucleotides.

[0322] According to a specific embodiment, the insertion comprises an insertion of at most 20 nucleotides.

[0323] According to a specific embodiment, the insertion comprises an insertion of at most 15 nucleotides.

[0324] According to a specific embodiment, the insertion comprises an insertion of at most 10 nucleotides.

[0325] According to a specific embodiment, the insertion comprises an insertion of at most 5 nucleotides.

[0326] According to one embodiment, the modification comprises a deletion.

[0327] According to a specific embodiment, the deletion comprises a deletion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0328] According to one embodiment, the deletion comprises a deletion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0329] According to a specific embodiment, the deletion comprises a deletion of at most 200 nucleotides.

[0330] According to a specific embodiment, the deletion comprises a deletion of at most 150 nucleotides.

[0331] According to a specific embodiment, the deletion comprises a deletion of at most 100 nucleotides.

[0332] According to a specific embodiment, the deletion comprises a deletion of at most 50 nucleotides.

[0333] According to a specific embodiment, the deletion comprises a deletion of at most 25 nucleotides.

[0334] According to a specific embodiment, the deletion comprises a deletion of at most 20 nucleotides.

[0335] According to a specific embodiment, the deletion comprises a deletion of at most 15 nucleotides.

[0336] According to a specific embodiment, the deletion comprises a deletion of at most 10 nucleotides.

[0337] According to a specific embodiment, the deletion comprises a deletion of at most 5 nucleotides.

[0338] According to one embodiment, the modification comprises a point mutation.

[0339] According to a specific embodiment, the point mutations include point mutations of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0340] According to one embodiment, the point mutations include point mutations of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0341] According to a specific embodiment, the point mutation comprises a point mutation of at most 200 nucleotides.

[0342] According to a specific embodiment, the point mutation comprises a point mutation of at most 150 nucleotides.

[0343] According to a specific embodiment, the point mutation comprises a point mutation of at most 100 nucleotides.

[0344] According to a specific embodiment, the point mutation comprises a point mutation of at most 50 nucleotides.

[0345] According to a specific embodiment, the point mutation comprises a point mutation of at most 25 nucleotides.

[0346] According to a specific embodiment, the point mutation comprises a point mutation of at most 20 nucleotides.

[0347] According to a specific embodiment, the point mutation comprises a point mutation of at most 15 nucleotides.

[0348] According to a specific embodiment, the point mutation comprises a point mutation of at most 10 nucleotides.

[0349] According to a specific embodiment, the point mutation includes a point mutation of at most 5 nucleotides.

[0350] According to one embodiment, the modification comprises a combination of any one of a deletion, an insertion and / or a point mutation.

[0351] According to one embodiment, the modification comprises a nucleotide replacement (eg, nucleotide swapping).

[0352] According to a specific embodiment, the exchange comprises exchanging about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0353] According to one embodiment, the nucleotide exchange comprises nucleotide replacement of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a naturally occurring non-coding RNA molecule, e.g., an RNA silencing molecule).

[0354] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 200 nucleotides.

[0355] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 150 nucleotides.

[0356] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 100 nucleotides.

[0357] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 50 nucleotides.

[0358] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 25 nucleotides.

[0359] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 20 nucleotides.

[0360] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 15 nucleotides.

[0361] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 10 nucleotides.

[0362] According to a specific embodiment, the nucleotide exchange comprises nucleotide replacement of up to 5 nucleotides.

[0363] According to one embodiment, the gene encoding the non-coding RNA molecule (e.g., RNA silencing molecule) is modified by exchanging a sequence of an endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA).

[0364] According to a specific embodiment, the sequence of an siRNA for gene exchange of an endogenous RNA silencing molecule (e.g., miRNA) comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 4, 93 to 164, or 243 to 252.

[0365] According to one embodiment, the guide strand of the non-coding RNA molecule (e.g., RNA silencing molecule) is modified to retain structural originality and maintain the same base pairing profile.

[0366] According to one embodiment, the passenger strand of the non-coding RNA molecule (e.g., an RNA silencing molecule) is modified to retain structural originality and maintain the same base pairing profile.

[0367] As used herein, the term "structural originality" refers to the secondary RNA structure (i.e., base pairing shape). Maintaining the structural originality is very important for the correct and efficient biogenesis / processing of the non-coding RNA (e.g., RNA silencing molecules, e.g., siRNA or miRNA), which is structure-dependent rather than simply sequence-dependent.

[0368] According to one embodiment, the non-coding RNA (e.g., an RNA silencing molecule) is modified in the guide strand (silencing strand) to have about 50 to 100% complementarity with the target RNA (as described above), while the passenger strand is modified to retain the original (unmodified) non-coding RNA structure.

[0369] According to one embodiment, the non-coding RNA (eg, RNA silencing molecule) is modified such that the seed sequence (eg, nucleotides 2 to 8 for the miRNA from the 5' end) is complementary to the target sequence.

[0370] According to a specific embodiment, the RNA silencing molecule (ie, RNAi molecule) is designed such that a sequence of the RNAi molecule is modified to retain structural originality and to be recognized by cellular RNAi processing and multiple executing factors.

[0371] The DNA editing agents of the present invention can be introduced into multiple eukaryotic cells using multiple DNA delivery methods (e.g., via multiple expression vectors) or using multiple DNA-free methods.

[0372] According to one embodiment, the gRNA (or any other DNA recognition module used, depending on the DNA editing system used) can be provided to the cell as RNA.

[0373] Thus, it should be understood that the present technology involves the use of DNA-free methods to introduce the DNA editing agent, for example, RNA transfection (e.g., mRNA+gRNA transfection) or ribonucleoprotein (RNP) transfection (e.g., protein-RNA complex transfection, for example, Cas9 / gRNA RNP complex transfection, or any combination of DNA / RNA / protein).

[0374] For example, Cas9 can be introduced as a DNA expression plasmid, an in vitro transcript (i.e., RNA), or as a recombinant protein bound to the RNA portion of a ribonucleoprotein particle (RNP). gRNA can be delivered, for example, as a DNA plasmid or an in vitro transcript (i.e., RNA).

[0375] In accordance with the present teachings, any method known in the art for RNA or RNP transfection can be used, such as, but not limited to, microinjection (as described by Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins," Genetics, 2013, 195: 1177-1180, incorporated herein by reference), electroporation (as described by Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins," Genome Res., 2014, 24: 1012-1019, incorporated herein by reference), or lipid-mediated transfection, for example, using liposomes (as described by Zuris et al., "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo," Nat Biotechnol., 2014, doi: 10.1038 / nbt.3081, incorporated herein by reference). Other multiple methods of RNA transfection are described in U.S. Patent Application No. 20160289675, the entire contents of which are incorporated herein by reference.

[0376] An advantage of the multiple RNA transfection method of the present invention is that RNA transfection is inherently transient and vector-free. An RNA transgene can be delivered to a cell as a minimal expression cassette and expressed therein without the need for any additional sequences (e.g., multiple viral sequences).

[0377] According to one embodiment, to express multiple exogenous DNA editing agents of the present invention in multiple mammalian cells, a polynucleotide sequence encoding the DNA editing agent is linked to a nucleic acid construct suitable for mammalian cell expression. This nucleic acid construct comprises a promoter sequence for directing transcription of the polynucleotide sequence in the cells in a constitutive or inducible manner.

[0378] The nucleic acid constructs (also referred to herein as "expression vectors") of some embodiments of the present invention contain additional sequences that make the vector suitable for replication and integration in various eukaryotic organisms (e.g., shuttle vectors). Furthermore, typical cloning vectors may also contain a transcription and translation initiation sequence, a transcription and translation terminator, and a polyadenylation signal. For example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, a site for second-strand DNA synthesis, and a 3' LTR or a portion thereof.

[0379] Many eukaryotic promoters typically contain two types of recognition sequences, a TATA box and an upstream promoter element. The TATA box (located 25 to 30 base pairs upstream of the transcription start site) is believed to be involved in instructing RNA polymerase to begin RNA synthesis. Other upstream promoter elements determine the rate of transcription initiation.

[0380] Preferably, the promoter utilized by the nucleic acid constructs of some embodiments of the present invention is active in a specific cell population that is transformed. Examples of cell type-specific and / or tissue-specific promoters include liver-specific promoters (e.g., albumin) (Pinkert et al., 1987, Genes Dev., 1:268-277), lymphoid-specific promoters (Calame et al., 1988, Adv. Immunol., 43:235-275); in particular, promoters for the T cell receptor (Winoto et al., 1989, EMBO J., 8:729-733) and immunoglobulin promoters; (Banerji et al., 1983, Cell, 33729-740), neuron-specific promoters (e.g., neurofilament promoter) (Byrne et al., 1989, Proc. Natl. Acad. Sci., USA, 86:5473-5477), pancreas-specific promoters (Edlunch et al., 1985, Science, 230:912-916) or mammary gland-specific promoters (e.g., whey promoter) (U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).

[0381] Multiple enhancer elements can stimulate transcription up to 1,000 times from the homologous or heterologous promoters connected. When multiple enhancers are placed downstream or upstream of the transcription start site, the enhancer is active. Many enhancer elements derived from multiple viruses have a wide host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer / promoter combinations suitable for some embodiments of the present invention include those derived from polyoma virus, human or mouse cytomegalovirus (CMV), long terminal repeats from various retroviruses (for example, murine leukemia virus, mouse or Roussarcoma virus and HIV). See Enhancer and Eukaryotic Expression (Enhancers and Eukaryotic Expression) (Cold Spring Harbor Press, Cold Spring Harbor, New York, 1983), which are incorporated herein by reference.

[0382] In constructing the expression vector, the promoter is preferably positioned at approximately the same distance from the heterologous transcription start site as it is in its natural environment. However, as is known in the art, some variation in this distance can be accommodated without loss of promoter function.

[0383] Multiple polyadenylation sequences can also be added to the expression vector to increase the efficiency of mRNA translation. Accurate and efficient polyadenylation requires two different sequence elements: a GU or U-rich sequence located downstream of the polyadenylation site, and a highly conserved 6-nucleotide sequence AAUAAA located 11 to 30 nucleotides upstream. Termination and polyadenylation signals suitable for use in some embodiments of the present invention include those derived from SV40.

[0384] In addition to the multiple elements described, the expression vectors of some embodiments of the present invention may generally contain other specialized elements intended to increase the expression level of multiple cloned nucleic acids or to facilitate identification of multiple cells carrying the recombinant DNA. For example, some animal viruses contain multiple DNA sequences that promote additional extrachromosomal replication of the viral genome in permissive cell types. Multiple plasmids carrying these viral replicons are episomally replicated as long as the multiple genes carried on the plasmids or appropriate factors are provided together with the genome of the host cell.

[0385] The vector may or may not contain a eukaryotic replicon. If a eukaryotic replicon is present, the vector can be amplified in multiple eukaryotic cells using an appropriate selection marker. If the vector does not contain a eukaryotic replicon, episomal amplification is not possible. Instead, the recombinant DNA is integrated into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.

[0386] The expression vector of some embodiments of the present invention may further comprise additional polynucleotide sequences that allow, for example, translation of multiple proteins from a single mRNA, such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.

[0387] It should be understood that the various elements included in the expression vector can be arranged in a variety of configurations. For example, multiple enhancer elements, multiple promoters, etc., and even the (multiple) polynucleotide sequences encoding a DNA editing agent can be arranged in a "head-to-tail" configuration, can be presented as a reverse complement, or can be presented in a complementary configuration (such as an antiparallel chain). Although multiple non-coding elements of the expression vector are more likely to undergo such configurational changes, multiple alternative configurations of the coding sequence within the expression vector can also be envisioned.

[0388] Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 (available from Invitrogen), pCI (available from Promega), pMbac, pPbac, pBK-RSV and pBK-CMV (available from Stratagene), pTRES (available from Clontech), and derivatives thereof.

[0389] Multiple expression vectors containing multiple regulatory elements from multiple eukaryotic viruses (e.g., multiple retroviruses) can also be used. Multiple SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein Bar virus include pHEBO and p2O5. Other exemplary vectors include pMSG, pAV009 / A + 、pMTO10 / A + , pMAMneo-5, baculovirus pDSVE, and any other vector that allows expression of proteins under the direction of the SV-40 early promoter, the SV-40 late promoter, the metallothionein promoter, the mouse mammary tumor virus promoter, the Rous sarcoma virus promoter, the polyhedrin promoter, or other promoters that have shown efficient expression in eukaryotic cells.

[0390] Viruses are very specific infectious agents that, in many cases, have evolved to evade host defense mechanisms. Typically, viruses infect and spread in a variety of specific cell types. The targeting specificity of viral vectors utilizes their natural specificity to specifically target a predetermined cell type, thereby introducing a recombinant gene into the infected cell. Therefore, the type of vector used in some embodiments of the present invention will depend on the cell type being transformed. The ability to select an appropriate vector based on the cell type being transformed is well within the capabilities of those skilled in the art, and therefore a general description of selection considerations is not provided herein. For example, human T-cell leukemia virus type 1 (HTLV-1) can be used to target bone marrow cells, while a heterologous promoter present in the baculovirus Autographa californica nucleopolyhedrovirus (AcMNPV) can be used to target kidney cells, as described by Liang CY et al. (2004, Arch Virol., 149: 51-60).

[0391] Recombinant viral vectors are useful for in vivo expression of DNA editing agents because of their advantages, such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of retroviruses, for example, and is the process by which a single infected cell produces many progeny virions that bud off and infect multiple neighboring cells. The result is that a large area is rapidly infected, most of which are not initially infected by the original viral particles. This is in contrast to vertical infection, in which the infectious agent is only transmitted through progeny. Viral vectors that cannot be transmitted laterally can also be produced. This feature may be useful if the desired purpose is to introduce a specific gene only into a local number of target cells.

[0392] According to one embodiment, in order to express a functional DNA editing agent, the expression vector can be used to encode the cleaving module and the DNA recognition unit (e.g., gRNA in the case of CRISPR / Cas) in case the cleaving module (nuclease) is not a component of the DNA recognition unit.

[0393] Alternatively, the shearing module (nuclease) and the DNA recognition unit (e.g., gRNA) can be cloned into multiple separate expression vectors. In this case, at least two different expression vectors must be transformed into the same eukaryotic cell.

[0394] Alternatively, when a nuclease is not used (ie, not applied to the cells from an exogenous source), a single expression vector can be used to clone and express the DNA recognition element (eg, gRNA).

[0395] According to one embodiment, the DNA editing agent comprises a nucleic acid encoding at least one DNA recognition unit (e.g., gRNA), which is operatively linked to a cis-acting regulatory element (e.g., promoter) that is active in multiple eukaryotic cells.

[0396] According to one embodiment, the nuclease (e.g., endonuclease) and the DNA recognition unit (e.g., gRNA) are encoded from the same expression vector. Such a vector may include a single cis-acting regulatory element (e.g., promoter) active in multiple eukaryotic cells for expression of both the nuclease and the DNA recognition unit. Alternatively, the nuclease and the DNA recognition unit may each be operably linked to a cis-acting regulatory element (e.g., promoter) active in multiple eukaryotic cells.

[0397] According to one embodiment, the nuclease (e.g., endonuclease) and the DNA recognition unit (e.g., gRNA) are encoded from different expression vectors, wherein each expression vector is operably linked to a cis-acting regulatory element (e.g., promoter) that is active in multiple eukaryotic cells.

[0398] According to one embodiment, the method of some embodiments of the present invention further comprises introducing a plurality of donor oligonucleotides into the eukaryotic cell.

[0399] According to one embodiment, when the modification is an insertion, the method further comprises introducing a plurality of donor oligonucleotides into the eukaryotic cell.

[0400] According to one embodiment, when the modification is a deletion, the method further comprises introducing a plurality of donor oligonucleotides into the eukaryotic cell.

[0401] According to one embodiment, when the modification is a deletion and an insertion (eg, an exchange), the method further comprises introducing a plurality of donor oligonucleotides into the eukaryotic cell.

[0402] According to one embodiment, when the modification is a point mutation, the method further comprises introducing a plurality of donor oligonucleotides into the eukaryotic cell.

[0403] As used herein, the term "donor oligonucleotides" or "donor oligonucleotides" refers to exogenous nucleotides that are introduced into the eukaryotic cell from the outside to produce a precise change in the genome. According to one embodiment, the donor oligonucleotides are synthetic.

[0404] According to one embodiment, the plurality of donor oligonucleotides is a plurality of RNA oligonucleotides.

[0405] According to one embodiment, the plurality of donor oligonucleotides is a plurality of DNA oligonucleotides.

[0406] According to one embodiment, the plurality of donor oligonucleotides is a plurality of synthetic oligonucleotides.

[0407] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of single-stranded donor oligonucleotides (ssODNs).

[0408] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded donor oligonucleotides (dsODNs).

[0409] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded DNAs (dsDNAs).

[0410] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded DNA-RNA duplexes (DNA-RNA duplexes).

[0411] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded DNA-RNA hybrids.

[0412] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of single-stranded DNA-RNA hybrids.

[0413] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of single-stranded DNAs (ssDNAs).

[0414] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of double-stranded RNA (dsRNA).

[0415] According to one embodiment, the plurality of donor oligonucleotides comprises a plurality of single-stranded RNA (ssRNA).

[0416] According to one embodiment, said plurality of donor oligonucleotides comprises said DNA or RNA sequence for exchange (as described above).

[0417] According to one embodiment, the plurality of donor oligonucleotides are provided in the form of a non-expression vector or oligonucleotides.

[0418] According to one embodiment, the plurality of donor oligonucleotides comprises a DNA donor plasmid.

[0419] According to one embodiment, the plurality of donor oligonucleotides comprises about 50 to 5000, about 100 to 5000, about 250 to 5000, about 500 to 5000, about 750 to 5000, about 1000 to 5000, about 1500 to 5000, about 2000 to 5000, about 2500 to 5000, about 3000 to 5000, about 4000 to 5000, about 50 to 4000, about 100 to 4000, about 250 to 4000, about 500 to 4000, about 750 to 4000, about 1000 to 4000, about 1500 to 4000, about 2000 to 4000, about 2500 to 4000, about 3000 to 4000, about 50 to 3000, about 100 to 3000, about 250 to 3000, about 500 to 300 0, about 750 to 3000, about 1000 to 3000, about 1500 to 3000, about 2000 to 3000, about 50 to 2000, about 100 to 2000, about 250 to 2000, about 500 to 2000, about 750 to 2000, about 1000 to 2000, about 1500 to 2000, about 50 to 1000, about 100 to 1000, about 100, about 250 to 1000, about 500 to 1000, about 750 to 1000, about 50 to 750, about 150 to 750, about 250 to 750, about 500 to 750, about 50 to 500, about 150 to 500, about 200 to 500, about 250 to 500, about 350 to 500, about 50 to 250, about 150 to 250, or about 200 to 250 nucleotides.

[0420] According to a specific embodiment, the plurality of donor oligonucleotides comprising the ssODN (eg, ssDNA or ssRNA) comprises about 200 to 500 nucleotides.

[0421] According to a specific embodiment, the plurality of donor oligonucleotides comprising the dsODN (eg, dsDNA or dsRNA) comprises about 250 to 5000 nucleotides.

[0422] According to one embodiment, for gene exchange of an endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA), the expression vector, ssODN (e.g., ssDNA or ssRNA) or dsODN (e.g., dsDNA or dsRNA) does not need to be expressed in a eukaryotic cell and can only serve as a non-expression template. According to a specific embodiment, in this case, if provided in a DNA form, only the DNA editing agent (e.g., multiple Cas9 / sgRNA modules) need to be expressed.

[0423] According to some embodiments, for gene editing of an endogenous non-coding RNA molecule (e.g., an RNA silencing molecule) without the use of a nuclease, the DNA editing agent (e.g., gRNA) can be introduced into the eukaryotic cell with or without a donor oligonucleotide (as described herein).

[0424] According to one embodiment, a plurality of donor oligonucleotides are introduced into the eukaryotic cell using any of the methods described above (eg, using the expression vector or RNP transfection).

[0425] According to one embodiment, the gRNA and the multiple DNA donor oligonucleotides are co-introduced into the eukaryotic cell. It should be understood that any other factors (e.g., nucleases) can be co-introduced therewith.

[0426] According to one embodiment, the gRNA is introduced into the eukaryotic cell before the multiple DNA donor oligonucleotides (e.g., within a few minutes or hours). It should be understood that any other factors (e.g., nucleases) can be introduced before, simultaneously with, or after the gRNA or the multiple DNA donor oligonucleotides.

[0427] According to one embodiment, the gRNA is introduced into the eukaryotic cell after the multiple DNA donor oligonucleotides (e.g., within a few minutes or hours). It should be understood that any other factors (e.g., nucleases) can be introduced before, simultaneously with, or after the gRNA or the multiple DNA donor oligonucleotides.

[0428] According to one embodiment, a composition is provided that includes at least one gRNA and a plurality of DNA donor oligonucleotides for genome editing.

[0429] According to one embodiment, a composition is provided that includes at least one gRNA for genome editing, a nuclease (e.g., an endonuclease), and a plurality of DNA donor oligonucleotides.

[0430] Various methods can be used to introduce the expression vectors or multiple donor oligonucleotides of some embodiments of the present invention into multiple eukaryotic cells (e.g., multiple stem cells). Such methods are generally described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1989, 1992), Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland, 1989), Chang et al. (Somatic Gene Therapy, CRC Press, Ann Arbor, Michigan, 1995), Vega et al. (Gene Targeting, CRC Press, Ann Arbor, Michigan, 1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses. Uses) (Butterworths, Boston, MA, 1988) and Gilboa et al. (Biotechniques, 4(6): 504-512, 1986), and include, for example, stable or transient transfection, lipofection, electroporation, and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.

[0431] Introduction of multiple nucleic acids via viral infection has many advantages over other methods (eg, lipofection and electroporation) because the infectivity of viruses allows for higher transfection efficiencies.

[0432] Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non-viral constructs (e.g., adenovirus, lentivirus, herpes simplex I virus or adeno-associated virus (AAV) and lipid-based systems). Useful lipids for lipid-mediated gene transfer are, for example, DOTMA, DOPE, and DC-Chol (Tonkinson et al., Cancer Investigation, 14(1): 54-65, 1996). For gene therapy, preferred constructs are viruses, more preferably adenovirus, AAV, lentivirus, or retrovirus. A viral construct (e.g., a retroviral construct) comprises at least one transcriptional promoter / enhancer or locus-defining element(s), or other elements that control gene expression by other means (e.g., alternate splicing, nuclear RNA export, or post-translational modification of the messenger). Such vector constructs also include a packaging signal, multiple long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites suitable for the virus used, unless it is already present in the viral construct. In addition, such a construct typically includes a signal sequence for secreting the peptide from a host cell in which it is located. Preferably, the signal sequence used for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variant of some embodiments of the present invention. Alternatively, the construct may also include a signal indicating polyadenylation, as well as one or more restriction sites and a translation termination sequence. For example, such a construct will typically include a 5'LTR, a tRNA binding site, a packaging signal, a site for second strand DNA synthesis, and a 3'LTR or a portion thereof. Other non-viral vectors may be used, for example, cationic lipids, polylysine, and dendrimers.

[0433] In addition to containing the necessary elements for the transcription and translation of the inserted coding sequence, the expression constructs of some embodiments of the present invention may also contain sequences engineered to enhance the stability, production, purification, yield, or toxicity of the expressed peptide.

[0434] According to a specific embodiment, a bombardment method is used to introduce multiple exogenous genes into multiple eukaryotic cells. According to one embodiment, the method is transient. An exemplary bombardment method that can be used according to some embodiments of the present invention is discussed in the Examples section below. Uchida M et al. (Biochim Biophys Acta., 2009, 1790(8):754-64) also teaches bombardment of multiple eukaryotic cells (e.g., multiple mammalian cells), which is incorporated herein by reference.

[0435] Regardless of the transformation / infection method employed, the present teachings further provide for selecting for a plurality of transformed cells that comprise a genome editing event.

[0436] According to a specific embodiment, selection is performed so that only cells that include a successful and accurate modification (e.g., an exchange, insertion, deletion, point mutation) at the specific locus are selected. Thus, cells that include any event that includes a modification (e.g., an insertion, deletion, point mutation) at an unintended locus are not selected.

[0437] According to one embodiment, selection of multiple modified cells can be performed at the phenotypic level by detecting a molecular event, by detecting a fluorescent reporter, or by growing in the presence of a selection agent (e.g., an antibiotic or other selection marker, e.g., resistance to a drug (i.e., Nutlin3) in the case of TP53 silencing).

[0438] According to one embodiment, selection of a plurality of modified cells is performed by analyzing the biogenesis and occurrence of newly edited non-coding RNA molecules (e.g., the presence of new miRNA forms, the presence of newly edited siRNAs, piRNAs, tasiRNAs, etc.).

[0439] According to one embodiment, selection of a plurality of modified cells is performed by analyzing the silencing activity and / or specificity of the non-coding RNA molecule (e.g., RNA silencing molecule) against a second target RNA or a target RNA of interest by verifying a phenotype of at least one eukaryotic cell or the organism encoding the target RNA, such as cell size, growth rate / inhibition, cell shape, cell membrane integrity, tumor size, tumor shape, pigmentation of an organism, infection parameters (e.g., viral load or bacterial load) in an organism, or inflammation parameters (e.g., fever or redness) in an organism.

[0440] According to one embodiment, the silencing specificity of the non-coding RNA molecule is determined genotypically, for example, by the expression or lack of expression of a gene.

[0441] According to one embodiment, the silencing specificity of the non-coding RNA molecule is determined phenotypically.

[0442] According to one embodiment, a phenotype of said eukaryotic cell or organism is determined prior to a genotype.

[0443] According to one embodiment, a genotype of the eukaryotic cell or organism is determined prior to a phenotype.

[0444] According to one embodiment, a plurality of modified cells are selected by analyzing the silencing activity and / or specificity of the non-coding RNA molecule (e.g., RNA silencing molecule) against a second target RNA or target RNA of interest (by measuring the level of an RNA of the second target RNA or target RNA of interest). This can be achieved using any method known in the art, for example, by Northern blotting, nuclease protection assay, in situ hybridization, quantitative RT-PCR, or immunoblotting.

[0445] According to one embodiment, selection of a plurality of modified cells is performed by analyzing a plurality of eukaryotic cells or a plurality of clones comprising said DNA editing events, also referred to herein as "mutations" or "edits," depending on the type of edit sought, e.g., insertions, deletions, insertion-deletions (Indels), inversions, substitutions, and combinations thereof.

[0446] Methods for detecting sequence changes are well known in the art and include, but are not limited to, DNA and RNA sequencing (e.g., next generation sequencing), electrophoresis, an enzyme-based mismatch detection assay, and a hybridization assay, such as PCR, RT-PCR, RNase protection, in situ hybridization, primer extension, Southern blotting, Northern blotting, and dot blot analysis. Various methods for detecting single nucleotide polymorphisms (SNPs) can also be used, such as PCR-based T7 endonuclease, heteroduplex and Sanger sequencing, or PCR followed by restriction digest to detect the presence or absence of unique restriction site(s).

[0447] Another method for verifying the presence of a DNA editing event (eg, an insertion / deletion (Indel)) includes a mismatch cleavage assay, which utilizes a structure-selective enzyme (eg, an endonuclease) that recognizes and cleaves mismatched DNA.

[0448] According to one embodiment, multiple transformed cells are selected by flow cytometry (FACS), and the flow cytometry selection shows multiple transformed cells of fluorescence (emitted by the fluorescent reporter).After FACS sorting, multiple transformed eukaryotic cell groups of positive selection are collected, which show the fluorescent labeling, and an aliquot can be used to test DNA editing events as described above.

[0449] In the case of using an antibiotic selection marker, after transformation, a plurality of eukaryotic cells are cultured in the presence of selection (e.g., an antibiotic), e.g., in a cell culture. As described above, a portion of the cells in the cell culture are then analyzed (confirmed) for the DNA editing event.

[0450] According to one embodiment of the present invention, the method further comprises verifying the complementarity of the endogenous non-coding RNA molecule (eg, RNA silencing molecule) to the second target RNA in the plurality of transformed cells.

[0451] As described above, after modification of the gene encoding the non-coding RNA molecule (e.g., RNA silencing molecule), the non-coding RNA molecule (e.g., RNA silencing molecule) has at least about 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% complementarity to the sequence of the second target RNA or target RNA of interest.

[0452] The specific binding of the designed non-coding RNA molecule to a target RNA of interest can be determined by any method known in the art, for example, by a computational algorithm (e.g., BLAST), and verified by a variety of methods including, for example, Northern blotting, in situ hybridization, QuantiGene Plex assay, etc.

[0453] It should be understood that for the DNA editing event, a plurality of positive eukaryotic cells can be homozygous (homozygous) or heterozygous (heterozygous). In the case of a heterozygous cell, the cell can include a copy of a modified gene of the non-coding RNA molecule (e.g., RNA silencing molecule) and a copy of a non-modified gene. The technician will select the cell for further culture / regeneration according to the intended use.

[0454] According to one embodiment, when a transient method is desired, for the absence of a DNA editing agent (i.e., the loss of multiple DNA sequences encoding the DNA editing agent), further analysis and selection of multiple eukaryotic cells that exhibit the absence of the desired DNA editing event can be performed. For example, this can be performed by analyzing the loss of expression of the DNA editing agent (e.g., on the mRNA, protein), such as by fluorescence detection of GFP or q-PCR, HPLC.

[0455] According to one embodiment, when a transient method is required, the plurality of eukaryotic cells can be analyzed for the presence of a nucleic acid construct as described herein or a portion thereof, e.g., a nucleic acid sequence encoding the DNA editing agent. This can be confirmed by fluorescence microscopy, q-PCR, FACS, or any other method (e.g., Southern blotting, PCR, sequencing, HPLC).

[0456] Multiple positive eukaryotic cell clones can be stored (eg, cryopreserved).

[0457] Alternatively, the plurality of eukaryotic cells can be further cultured and maintained, for example, in an undifferentiated state for extended periods of time, or can be induced to differentiate into other desired cell types, tissues, organs, or organisms.

[0458] The multiple DNA editing agents and optionally the multiple donor oligonucleotides of some embodiments of the present invention can be administered to a single cell, to a group of cells (e.g., multiple primary cells or multiple cell lines as described above), or to an organism (e.g., mammals, birds, fish, and insects as described above).

[0459] Therefore, the multiple DNA editing agents and optionally the multiple donor oligonucleotides (or multiple expression vectors or RNP complexes comprising the same) of some embodiments of the present invention can be administered to an organism itself (per se) or administered as a pharmaceutical composition (mixed with a suitable carrier or excipient).

[0460] As used herein, a "pharmaceutical composition" refers to a preparation of one or more active ingredients described herein with other chemical components (eg, physiologically suitable carriers and excipients). The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0461] As used herein, the term "active ingredient" refers to the plurality of DNA editing agents and optionally the plurality of donor oligonucleotides (responsible for the biological effect).

[0462] Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier," which are used interchangeably, refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. These phrases encompass an adjuvant.

[0463] The term "excipient" as used herein refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples of excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars and various types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.

[0464] Techniques for formulation and administration of drugs may be found in Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton, Pa., latest edition), which is incorporated herein by reference.

[0465] Suitable routes of administration may include, for example, oral, rectal, transmucosal, especially nasal, enteral or parenteral delivery, including intramuscular, subcutaneous and intramedullary injection, as well as intrathecal, direct intraventricular, intracardiac injection, for example, into the right or left ventricular cavity, into the coronary artery, intravenous, intraperitoneal, intranasal or intraocular injection.

[0466] Traditional approaches for delivering drugs to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., generation of a chimeric fusion protein comprising a transport peptide with affinity for an endothelial cell surface molecule conjugated to an agent that is itself unable to cross the BBB) in an attempt to exploit an endogenous transport pathway of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of a water-soluble agent to a lipid or cholesterol carrier); and transient disruption of the integrity of the BBB by hypertonic disruption (due to infusion of a mannitol solution into the carotid artery or administration of a biologically active agent, e.g., an angiotensin peptide). However, each of these strategies has limitations, such as inherent risks associated with an invasive surgical procedure, size limitations due to inherent limitations in the endogenous transport system, potential adverse biological side effects associated with systemic administration of a chimeric molecule composed of a carrier motif that may be active outside the CNS, and the potential risk of brain damage in regions of the brain where the BBB is disrupted, making it a suboptimal delivery method.

[0467] Alternatively, the pharmaceutical composition may be administered in a local rather than systemic manner, for example, by injecting the pharmaceutical composition directly into a tissue area of ​​a patient.

[0468] The pharmaceutical compositions of some embodiments of the present invention can be prepared by methods well known in the art, for example, by conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, encapsulating or lyophilizing processes.

[0469] Therefore, the pharmaceutical compositions used according to some embodiments of the present invention can be formulated in a conventional manner using one or more physiologically acceptable carriers including excipients and adjuvants that facilitate processing of the multiple active ingredients into pharmaceutically acceptable formulations. Appropriate formulations depend on the selected route of administration.

[0470] For injection, the active ingredients of the pharmaceutical composition can be formulated in an aqueous solution, preferably in a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or physiological saline buffer. For transmucosal administration, a penetrant appropriate to the permeability barrier is used in the formulation. Such penetrants are well known in the art.

[0471] For oral administration, the pharmaceutical composition can be readily formulated by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like for oral ingestion by a patient. Pharmaceutical preparations for oral use can be prepared using a solid excipient, optionally grinding the resulting mixture, and processing the granular mixture after adding suitable adjuvants, if necessary, to obtain tablets or dragee cores. Suitable excipients include, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carbomethylcellulose; and / or physiologically acceptable polymers, such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate.

[0472] The dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions can be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyes or pigments may be added to the tablet or dragee coating to identify or characterize different combinations of active compound dosages.

[0473] Pharmaceutical compositions that can be used orally include push-fit capsules made of gelatin and sealed soft capsules made of gelatin and a plasticizer (e.g., glycerol or sorbitol). The push-fit capsules can contain the multiple active ingredients mixed with a filler (e.g., lactose), a binder (e.g., starch), a lubricant (e.g., talc or magnesium stearate), and an optional stabilizer. In the soft capsules, the multiple active ingredients can be dissolved or suspended in a suitable liquid, e.g., a fatty oil, liquid paraffin, or liquid polyethylene glycol. In addition, a stabilizer can be added. The dosage of all preparations for oral administration should be suitable for the selected route of administration.

[0474] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0475] For administration by nasal inhalation, the active ingredients used in accordance with some embodiments of the present invention are conveniently delivered in the form of a nebulizer spray from a pressurized pack or nebulizer using a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, or carbon dioxide. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges, e.g., of gelatin, can be formulated for use in a dispenser containing a powder mix of the compound and a suitable powder base, e.g., lactose or starch.

[0476] The pharmaceutical compositions described herein can be formulated for parenteral administration, for example, by bolus injection or continuous infusion. Injectable formulations can be presented in unit dosage form, for example, in ampoules or multi-dose containers, optionally with the addition of preservatives. The compositions can be suspensions, solutions, or emulsions in oily or aqueous vehicles and can contain preparatants such as suspending agents, stabilizers, and / or dispersants.

[0477] The pharmaceutical composition of parenteral administration comprises the aqueous solution of the active agent of water-soluble form.In addition, the suspension of described multiple active components can be prepared as suitable oil base or water-based injection suspension.Suitable lipophilic solvent or vehicle comprise fatty oil (for example, sesame oil) or synthetic fatty acid ester (for example, ethyl oleate, triglyceride or liposome).Aqueous injection suspension can contain the material that increases described suspension viscosity, for example, sodium carboxymethyl cellulose, sorbitol or dextran.Alternatively, described suspension can also contain the reagent of suitable stabilizing agent or increase the solubility of described multiple active components, to allow preparation of high concentration solution.

[0478] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle (eg, sterile, pyrogen-free, water-based solution) before use.

[0479] The pharmaceutical compositions of some embodiments of the invention may also be formulated in rectal compositions (eg, suppositories or retention enemas), using, for example, conventional suppository bases such as cocoa butter or other glycerides.

[0480] Pharmaceutical compositions suitable for use in the context of some embodiments of the present invention include compositions wherein the active ingredients are present in an effective amount to achieve the intended purpose. More specifically, a therapeutically effective amount refers to an amount of the active ingredient (DNA editing agent) that effectively prevents, alleviates, or ameliorates the symptoms of a disease (e.g., cancer or infectious disease) or prolongs the survival of the subject being treated.

[0481] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0482] For any formulation used in the methods of the present invention, the therapeutically effective amount or dosage can be estimated first from in vitro and cell culture assays. For example, a dose can be formulated in an animal model to achieve a desired concentration or titer. Such information can be used to more accurately determine a dosage useful in humans.

[0483] Animal models for cancer diseases are described, for example, in Yee et al., Cancer Growth Metastasis (2015, 8, Suppl 1: 115-118). Animal models for infectious diseases are described, for example, in Shevach's Current Protocols in Immunology (online publication: April 1, 2011, DOI: 10.1002 / 0471142735.im1900s93).

[0484] The toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, cell culture or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used to formulate a series of dosages for humans. The dosage can vary according to the dosage form adopted and the route of administration used. The specific formulation, route of administration and dosage can be selected by individual physicians according to the patient's condition (see, for example, Fingl et al., 1975, "The Pharmacological Basis of Therapeutics," Chapter 1, page 1).

[0485] Dosage and interval can be adjusted individually to provide a sufficient amount of the active ingredient to induce or inhibit the biological effect (minimal effective concentration (MEC)). The MEC will vary for each formulation but can be estimated based on in vitro data. The dose required to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0486] Depending on the severity and responsiveness of the condition to be treated, administration may be single or multiple administrations, with the course of treatment lasting from a few days to several weeks, or until a cure or a diminished disease state is achieved.

[0487] Of course, the amount of a composition administered will depend on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, and the like.

[0488] If desired, the compositions of some embodiments of the present invention can be presented in a package or dispenser device, for example, an FDA-approved test kit, which can contain one or more unit dosage forms (containing the active ingredient). The package can, for example, comprise metal or plastic foil, for example, a blister pack. The package or dispenser device can be accompanied by instructions for administration. The package or dispenser can also be accompanied by a note associated with the container (the format of which is prescribed by the government agency that manages the production, use, or sale of pharmaceuticals), which reflects the agency's approval of the form of the composition, or human or veterinary administration. For example, such notes can be a label approved by the U.S. Food and Drug Administration for prescription drugs, or an approved product additive. As further described above, a composition comprising a formulation of the present invention formulated in a compatible pharmaceutical carrier can also be prepared, placed in an appropriate container, and labeled to treat a specified disease.

[0489] The DNA editing agents designed to include a non-coding RNA molecule with a silencing specificity for a target RNA of interest can be used to treat various diseases and conditions as described below.

[0490] The term "treat" refers to inhibiting, preventing, or arresting the development of a pathology (disease, disorder, or condition) and / or causing the alleviation, remission, or regression of a pathology. Those skilled in the art will appreciate that various methods and assays can be used to assess the development of a pathology, and similarly, various methods and assays can be used to assess the alleviation, remission, or regression of a pathology.

[0491] As used herein, the term "prevent" or "preventing" refers to causing a disease, disorder, or condition to not occur in a subject who may be at risk for the disease but has not yet been diagnosed as having the disease.

[0492] As used herein, the term "subject" or "subject in need thereof" includes animals (including mammals, preferably humans) of any age or sex suffering from the pathology. Preferably, the term encompasses individuals at risk of developing the pathology.

[0493] According to one aspect of the present invention, a method for treating an infectious disease in a subject in need is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method of some embodiments of the present invention, wherein the target RNA of interest is associated with the onset or development of the infectious disease, thereby treating the infectious disease in the subject.

[0494] According to one aspect of the present invention, a DNA editing agent is provided, which confers a silencing specificity to a non-coding RNA molecule without RNA silencing activity against a target RNA of interest, wherein the target RNA of interest is associated with the onset or development of an infectious disease, for treating an infectious disease in a subject in need thereof.

[0495] According to one aspect of the present invention, a DNA editing agent is provided, which redirects the silencing specificity of a gene encoding or processed into an RNA silencing molecule to a target RNA targeting a second target RNA, wherein the target RNA and the second target RNA are different, wherein the second target RNA is associated with the onset or development of an infectious disease, for treating an infectious disease in a subject in need thereof.

[0496] As used herein, the term "infectious disease" refers to any chronic infectious disease, subacute infectious disease, acute infectious disease, viral disease, bacterial disease, protozoan disease, parasitic disease, fungal disease, mycoplasma disease, and prion disease.

[0497] According to one embodiment, to treat an infectious disease in a subject, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to target an RNA of interest associated with the onset or progression of the infectious disease.

[0498] According to one embodiment, the target RNA of interest comprises a product of a gene of the eukaryotic cell that confers resistance to the pathogen (e.g., virus, bacteria, fungus, etc.). Exemplary genes include, but are not limited to, CyPA- (cyclophilins (CyPs)), cyclophilin A (e.g., for hepatitis C virus infection), CD81, scavenger receptor class B type I (SR-BI), ubiquitin specific peptidase 18 (USP18), phosphatidylinositol 4-kinase III alpha (PI4K-IIIα) (e.g., for HSV infection), and CCR5- (e.g., for HIV infection). According to one embodiment, the target RNA of interest comprises a product of a gene of the pathogen.

[0499] According to one embodiment, the virus is an arbovirus (e.g., Vesicular stomatitis Indiana virus (VSV). According to one embodiment, the target RNA of interest comprises a product of a VSV gene, e.g., G protein (G), large protein (L), phosphoprotein, matrix protein (M), or nucleoprotein.

[0500] According to one embodiment, the target RNA of interest includes, but is not limited to, gag and / or vif genes (i.e., multiple conserved sequences in HIV-1); P protein (i.e., an important subunit of the viral RNA-dependent RNA polymerase in RSV); P mRNA (i.e., in PIV); core, NS3, NS4B and NS5B (i.e., in HCV); VAMP-associated protein (hVAP-A), La antigen and polypyrimidine tract binding protein (PTB) (i.e., for HCV).

[0501] According to a specific embodiment, when the organism is a human, the target RNA of interest includes, but is not limited to, a gene of a pathogen that causes malaria; a gene of HIV virus (e.g., as described in GenBank Accession No.: NC_001802.1); a gene of HCV virus (e.g., as described in GenBank Accession No.: NC_004102.1); and a gene of a parasitic worm (e.g., as described in GenBank Accession No.: XM_003371604.1).

[0502] According to a specific embodiment, when the organism is human, the target RNA of interest includes, but is not limited to, a gene associated with a cancerous disease (e.g., Homo sapiens mRNA for bcr / abl e8a2 fusion protein, as described in GenBank Accession No. AB069693.1) or a gene associated with myelodysplastic syndrome (MDS) and a vascular disease (e.g., human heparin-binding vascular endothelial growth factor (VEGF) mRNA, as described in GenBank Accession No. M32977.1).

[0503] According to a specific embodiment, when the organism is a cow, the target RNA of interest includes, but is not limited to, a gene of infectious bovine rhinotracheitis virus (e.g., as described in GenBank Accession No. AJ004801.1), a gene of type 1 bovine herpesvirus (BHV1) that causes, for example, BRD (Bovine Respiratory Disease complex); a gene of bluetongue (BTV virus) (e.g., as described in GenBank Accession No. KP821170.1); a gene of bovine viral diarrhea (BVD) (e.g., as described in GenBank Accession No. NC_001461.1); a gene of bovine viral diarrhea (BVD) (e.g., as described in GenBank Accession No. NC_001461.1); a gene of bovine herpesvirus (BHV1) that causes, for example, foot and mouth disease (Foot & Mouth Disease). a gene from a picornavirus that causes, for example, BRD (e.g., as described in GenBank Accession No. NC_004004.1); a gene from a parainfluenza virus type 3 (PI3) that causes, for example, BRD (e.g., as described in GenBank Accession No. NC_028362.1); a gene from Mycobacterium bovis (M. bovis) that causes, for example, bovine tuberculosis (bTB) (e.g., as described in GenBank Accession No. NC_037343.1).

[0504] According to a specific embodiment, when the organism is sheep, the target RNA of interest includes, but is not limited to, a gene of a pathogen causing tapeworm disease (Echinococcus granulosus life cycle, Echinococcus granulosus, Taenia ovis, Taenia hydatigena, Moniezia species) (e.g., as described in GenBank Accession No. AJ012663.1); a gene of a pathogen causing flatworm disease (Fasciola hepatica, Fasciola gigantica, Fascioloides magna, Dicrocoelium dendriticum, Schistosoma bovis)) (e.g., as described in GenBank Accession No. AY644459.1); a gene from a pathogen that causes bluetongue (BTV virus, as described in GenBank Accession No. KP821170.1); and a gene from a pathogen that causes roundworm disease (parasitic bronchitis, also known as "hoose," Elaeophora schneideri, Haemonchus contortus, Trichostrongylus species, Teladorsagia circumcincta, Cooperia species, Nematodirus species, Dictyocaulus filaria, Protostrongylus refescens), Muellerius capillaris, Oesophagostomum species, Neostrongylus linearis, Chabertia ovina, Trichuris ovis) (e.g., as described in GenBank Accession No. NC_003283.11).

[0505] According to a specific embodiment, when the organism is a pig, the target RNA of interest includes, but is not limited to, a gene of African Swine Fever virus (ASFV) (causing, for example, African swine fever) (e.g., as described in GenBank Accession No.: NC_001659.2); a gene of Classical Swine Fever virus (causing, for example, classical swine fever) (e.g., as described in GenBank Accession No. NC_002657.1); and a gene of Picornavirus (causing, for example, foot-and-mouth disease) (e.g., as described in GenBank Accession No.: NC_004004.1).

[0506] According to a specific embodiment, when the organism is a chicken, the target RNA of interest includes, but is not limited to, a gene of bird flu (or avian influenza), a gene of a variant of avian paramyxovirus 1 (APMV-1) (which causes, for example, Newcastle disease), or a gene of a pathogen that causes Marek's disease.

[0507] According to a specific embodiment, when the organism is a tadpole shrimp, the target RNA of interest includes, but is not limited to, a gene of White Spot Syndrome Virus (WSSV), a gene of Yellow Head Virus (YHV), or a gene of Taura Syndrome Virus (TSV).

[0508] According to a specific embodiment, when the organism is salmon, the target RNA of interest includes, but is not limited to, a gene for Infectious Salmon Anaemia (ISA), a gene for Infectious Hematopoietic Necrosis (IHN), or a gene for marine fish diseases (e.g., ectoparasitic copepods of the genera Lepeophtheirus and Caligus).

[0509] Table 1B below provides multiple exemplary endogenous non-coding RNA molecules that can be modified to target the RNA of interest (e.g., a gene of a pathogen), multiple exemplary gRNA sequences (i.e., a DNA editing agent) that can be used to modify the multiple endogenous non-coding RNA molecules, and multiple exemplary nucleotide sequences for redirecting a silencing specificity of the endogenous non-coding RNA molecule to the target RNA of interest.

[0510]

[0511]

[0512]

[0513]

[0514]

[0515]

[0516]

[0517]

[0518]

[0519]

[0520]

[0521]

[0522] The effectiveness of treatment can be assessed using any method known in the art, for example, by assessing the subject's physical health, by blood tests, by assessing viral / bacterial load, etc.

[0523] According to one aspect of the present invention, a method for treating a single gene recessive genetic disease in a subject in need is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method of some embodiments of the present invention, wherein the target RNA of interest is associated with the single gene recessive genetic disease, thereby treating the single gene recessive genetic disease in the subject.

[0524] According to one aspect of the present invention, a DNA editing agent is provided, which confers a silencing specificity to a non-coding RNA molecule that has no RNA silencing activity against a target RNA of interest, wherein the target RNA of interest is associated with a monogenic recessive genetic disease, for treating a monogenic recessive genetic disease in a subject in need thereof.

[0525] According to one aspect of the present invention, a DNA editing agent is provided, which redirects the silencing specificity of a gene encoding or processed into an RNA silencing molecule to a target RNA targeting a second target RNA, wherein the target RNA and the second target RNA are different, wherein the second target RNA is associated with a monogenic recessive genetic disease, for treating a monogenic recessive genetic disease in a subject in need thereof.

[0526] As used herein, the term "monogenic recessive disorder" refers to a disease or condition caused by a single defective gene on multiple autosomes.

[0527] According to one embodiment, the monogenic recessive genetic disease is the result of a spontaneous or inherited mutation.

[0528] According to one embodiment, the single gene recessive genetic disease is autosomal dominant, autosomal recessive or X-linked recessive.

[0529] Exemplary single gene recessive genetic diseases include, but are not limited to, severe combined immunodeficiency (SCID), hemophilia, enzyme deficiency, Parkinson's disease, Wiskott-Aldrich syndrome, cystic fibrosis, phenylketonuria, Friedrich's Ataxia, Duchenne Muscular Dystrophy, Hunter disease, Aicardi Syndrome, Klinefelter's Syndrome, and Leber's hereditary optic neuropathy (LHON).

[0530] According to one embodiment, to treat a single gene recessive genetic disease in a subject, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to target an RNA of interest associated with the single gene recessive genetic disease.

[0531] According to one embodiment, when the disease is Parkinson's disease, the target RNA of interest includes a product of SNCA (PARK1=4), LRRK2 (PARK8), Parkin (PARK2), PINK1 (PARK6), DJ-1 (PARK7), or ATP13A2 (PARK9) gene.

[0532] According to one embodiment, when the disease is hemophilia or von Willebrand disease, the target RNA of interest includes, for example, a product of an antithrombin gene, a coagulation factor VIII gene, or a factor IX gene.

[0533] The effectiveness of treatment can be assessed using any method known in the art, for example, by evaluating the subject's physical health, by blood tests, bone marrow aspirates, and the like.

[0534] According to one aspect of the present invention, a method for treating an autoimmune disease in a subject in need thereof is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method of some embodiments of the present invention, wherein the target RNA of interest is associated with the autoimmune disease, thereby treating the autoimmune disease in the subject.

[0535] According to one aspect of the present invention, a DNA editing agent is provided, which confers a silencing specificity to a non-coding RNA molecule without RNA silencing activity against a target RNA of interest, wherein the target RNA of interest is associated with an autoimmune disease, for treating an autoimmune disease in a subject in need thereof.

[0536] According to one aspect of the present invention, a DNA editing agent is provided that redirects the silencing specificity of a gene encoding or processed into an RNA silencing molecule to a target RNA directed against a second target RNA, wherein the target RNA and the second target RNA are different, wherein the second target RNA is associated with an autoimmune disease, for treating an autoimmune disease in a subject in need thereof.

[0537] Non-limiting examples of autoimmune diseases include, but are not limited to, cardiovascular diseases, rheumatoid diseases, glandular diseases, gastrointestinal diseases, skin diseases, liver diseases, neurological diseases, muscle diseases, kidney diseases, diseases related to reproduction, connective tissue diseases, and systemic diseases.

[0538] Examples of autoimmune cardiovascular diseases include, but are not limited to, atherosclerosis (Matsuura E. et al., Lupus., 1998; 7 Suppl 2: S135), myocardial infarction (Vaarala O., Lupus., 1998; 7 Suppl 2: S132), thrombosis (Tincani A. et al., Lupus, 1998; 7 Suppl 2: S107-9), Wegener's granulomatosis, Takayasu's arteritis, Kawasaki syndrome (Praprotnik S. et al., Wien Klin Wochenschr, 2000 Aug 25;112(15-16):660), anti-factor VIII autoimmune diseases (Lacroix-Desmazes S. et al., Semin Thromb Hemost., 2000;26(2):157), necrotizing small vessel vasculitis, microscopic polyangiitis, Churg and Strauss syndrome, pauci-immune focal necrotizing and crescentic glomerulonephritis (Noel LH., Ann Med Interne, Paris, 2000 May;151(3):178), antiphospholipid syndrome (Flamholz R. et al., J Am Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am ​​Am Clin Apheresis, 1999; 14(4): 171), antibody-induced heart failure (Wallukat G. et al., Am J Cardiol., 1999 Jun 17; 83(12A): 75H), thrombocytopenic purpura (Moccia F., Ann Ital Med Int., 1999 Apr-Jun; 14(2): 114; Semple JW.et al., Blood, 1996 May 15;87(10):4245), autoimmune hemolytic anemia (Efremov DG. et al., Leuk Lymphoma, 1998 Jan;28(3-4):285; Sallah S. et al., Ann Hematol, 1997 Mar;74(3):139), cardiac autoimmunity in Chagas' disease (Cunha-Neto E. et al., J Clin Invest, 1996 Oct 15;98(8):1709), and anti-helper T lymphocyte autoimmunity (Caporossi AP. et al., Viral Immunol, 1998;11(1):9).

[0539] Examples of autoimmune rheumatoid diseases include, but are not limited to, rheumatoid arthritis (Krenn V. et al., Histol Histopathol, 2000 Jul;15(3):791; Tisch R, McDevitt HO., Proc Natl Acad Sci units SA, 1994 Jan 18;91(2):437) and ankylosing spondylitis (Jan Voswinkel et al., Arthritis Res, 2001;3(3):189).

[0540] Examples of autoimmune glandular diseases include, but are not limited to, pancreatic disease, type I diabetes, thyroid disease, Graves' disease, thyroiditis, idiopathic autoimmune thyroiditis, Hashimoto's thyroiditis, idiopathic myxedema, ovarian autoimmunity, autoimmune anti-spermin fertility, autoimmune prostatitis, and Type I autoimmune polyglandular syndrome. Diseases include, but are not limited to, pancreatic autoimmune diseases, type 1 diabetes (Castano L. and Eisenbarth GS, Ann. Rev. Immunol., 8:647; Zimmet P., Diabetes Res Clin Pract, 1996 Oct;34 Suppl:S125), autoimmune thyroid diseases, Grave's disease (Orgiazzi J. Endocrinol Metab Clin North Am, 2000 Jun;29(2):339; Sakata S. et al., Mol Cell Endocrinol, 1993 Mar;92(1):77), autoimmune thyroiditis (Braley Mullen H. and Yu S, J Immunol, 2000 Dec 15;165(12):7262), Hashimoto's thyroiditis (Toyoda J. Endocrinol Metab Clin North Am, 2000 Jun;29(2):339 ... N. et al., Nippon-Rinsho, 1999 Aug;57(8):1810), idiopathic myxedema (Mitsuma T., Nippon-Rinsho, 1999 Aug;57(8):1759), ovarian autoimmune disease (Garza-KM. et al., J Reprod Immunol, 1998 Feb;37(2):87), autoimmune antisperm infertility (Diekman AB. et al., Am J Reprod Immunol., 2000 Mar;43(3):134), autoimmune prostatitis (Alexander RB. et al., Urology, 1997 Dec;50(6):893), and autoimmune polyglandular syndrome type I (Hara T. et al., Blood, 1991 Mar;77(5):1127).

[0541] Examples of autoimmune gastrointestinal diseases include, but are not limited to, chronic inflammatory bowel disease (Garcia Herola A. et al., Gastroenterol Hepatol., 2000 Jan;23(1):16), celiac disease (Landau YE. and Shoenfeld Y. Harefuah, 2000 Jan 16;138(2):122), colitis, ileitis, and Crohn's disease.

[0542] Examples of autoimmune skin diseases include, but are not limited to, autoimmune bullous skin diseases, such as, but not limited to, pemphigus vulgaris, bullous pemphigoid, and pemphigus foliaceus.

[0543] Examples of autoimmune liver diseases include, but are not limited to, hepatitis, autoimmune chronic active hepatitis (Franco A. et al., Clin Immunol Immunopathol, 1990 Mar;54(3):382), primary biliary cirrhosis ((Jones DE., Clin Sci (Colch), 1996 Nov;91(5):551; Strassburg CP. et al., Eur J Gastroenterol Hepatol., 1999 Jun;11(6):595) and autoimmune hepatitis (Manns MP., J Hepatol, 2000 Aug;33(2):326).

[0544] Examples of autoimmune neurological diseases include, but are not limited to, multiple sclerosis (Cross AH. et al., J Neuroimmunol, 2001 Jan 1; 112(1-2): 1), Alzheimer's disease (Oron L. et al., J Neural Transm Suppl., 1997; 49: 77), myasthenia gravis (Infante AJ. and Kraig E, Int Rev Immunol, 1999; 18(1-2): 83; Oshima M. et al., Eur J Immunol, 1990 Dec; 20(12): 2563), neuropathies, motor neuropathies (Kornberg AJ., J Clin Neurosci., 2000 May;7(3):191); Guillain-Barre syndrome and autoimmune neuropathies (Kusunoki S., Am J Med Sci., 2000 April;319(4):234), myasthenia gravis, Lambert-Eatonmyasthenic syndrome (Takamori M., Am J Med Sci., 2000 April;319(4):204); paraneoplastic neurological diseases, cerebellar atrophy, paraneoplastic cerebellar atrophy, and stiff-man syndrome (Hiemstra HS.et al., Proc Natl Acad Sci units SA, 2001 Mar 27;98(7):3988); non-paraneoplastic stiff man syndrome, progressive cerebellar atrophies, encephalitis, Rasmussen's encephalitis, amyotrophic lateral sclerosis, Sydeham chorea, Tourette syndrome, and autoimmune polyendocrinopathies (Antoine JC. and Honnorat J., Rev Neurol (Paris), 2000 Jan;156(1):23); dysimmune neuropathies (Nobile-Orazio E. et al., Electroencephalog Clin Neurophysiol Suppl, 1999;50:419); acquired neuromyotonia, arthrogryposis multiplex congenita (Vincent A. et al., Ann NY Acad Sci., 1998 May 13;841:482), neuritis, optic neuritis (Soderstrom M. et al., J Neurol Neurosurg Psychiatry, 1994 May;57(5):544), and neurodegenerative diseases.

[0545] Examples of autoimmune muscle diseases include, but are not limited to, myositis, autoimmune myositis, and primary Sjogren's syndrome (Feist E. et al., Int Arch Allergy Immunol, 2000 Sep;123(1):92) and smooth muscle autoimmune disease (Zauli D. et al., Biomed Pharmacother, 1999 Jun;53(5-6):234).

[0546] Examples of autoimmune kidney diseases include, but are not limited to, nephritis and autoimmune interstitial nephritis (Kelly CJ., J Am Soc Nephrol, 1990 Aug; 1(2): 140).

[0547] Examples of autoimmune diseases related to reproduction include, but are not limited to, repeated fetal loss (Tincani A. et al., Lupus, 1998; 7 Suppl 2: S107-9).

[0548] Examples of autoimmune connective tissue diseases include, but are not limited to, ear diseases, autoimmune ear diseases (Yoo TJ. et al., Cell Immunol, 1994 Aug;157(1):249) and autoimmune diseases of the inner ear (Gloddek B. et al., Ann NY Acad Sci, 1997 Dec 29;830:266).

[0549] Examples of autoimmune systemic diseases include, but are not limited to, systemic lupus erythematosus (Erikson J. et al., Immunol Res, 1998; 17(1-2):49) and systemic sclerosis (Renaudineau Y. et al., Clin Diagn Lab Immunol., 1999 Mar; 6(2):156; Chan OT. et al., Immunol Rev, 1999 Jun; 169:107).

[0550] According to one embodiment, the autoimmune disease comprises systemic lupus erythematosus (SLE).

[0551] According to one embodiment, to treat an autoimmune disease in a subject, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to target an RNA of interest associated with the autoimmune disease.

[0552] According to one embodiment, when the disease is lupus, the target RNA of interest includes an antinuclear antibody (ANA), for example, an antibody produced pathologically by B cells.

[0553] The effectiveness of treatment can be assessed using any method known in the art, for example, by evaluating the subject's physical health, by blood tests, bone marrow aspirates, and the like.

[0554] According to one aspect of the present invention, a method for treating a cancerous disease in a subject in need thereof is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method of some embodiments of the present invention, wherein the target RNA of interest is associated with the cancerous disease, thereby treating the cancerous disease in the subject.

[0555] According to one aspect of the present invention, a DNA editing agent is provided, which confers a silencing specificity to a non-coding RNA molecule without RNA silencing activity against a target RNA of interest, wherein the target RNA of interest is associated with a cancerous disease, for treating a cancerous disease in a subject in need thereof.

[0556] According to one aspect of the present invention, a DNA editing agent is provided that redirects the silencing specificity of a gene encoding or processed into an RNA silencing molecule to a target RNA directed against a second target RNA, wherein the target RNA and the second target RNA are different, wherein the second target RNA is associated with a cancerous disease, for treating a cancerous disease in a subject in need thereof.

[0557] Non-limiting examples of cancers that can be treated by the methods of some embodiments of the present invention can be any solid or non-solid cancer and / or cancer metastasis or precancer, including but not limited to gastrointestinal tumors (colon cancer, rectal cancer, colorectal carcinoma, colorectal cancer, colorectal adenoma, hereditary nonpolyposis type 1, hereditary nonpolyposis type 2, hereditary nonpolyposis type 3, hereditary nonpolyposis type 6; colorectal cancer, hereditary nonpolyposis type 7, small intestine cancer and / or large intestine cancer, esophageal carcinoma, tylosis with esophageal cancer, gastric cancer, pancreatic cancer, pancreatic endocrine tumors), endometrial cancer, dermatofibrosarcoma protuberans, ovarian cancer, ovarian cancer, ovarian fibrosarcoma ... protuberans), gallbladder cancer, biliary tract tumors, prostate cancer, prostate adenocarcinoma, kidney cancer (e.g., Wilms' tumor type 2 or type 1), liver cancer (e.g., hepatoblastoma, hepatocellular carcinoma, hepatocellular cancer), bladder cancer, embryonal rhabdomyosarcoma, germ cell tumor, trophoblastic tumor, testicular germ cell tumor, ovary, uterus, immature teratoma of the epithelial ovary, sacrococcygeal tumor, choriocarcinoma, placental site trophoblastic tumor, epithelial adult tumors, ovarian cancer, serous ovarian cancer, ovarian sex cord tumors tumor), cervical cancer, cervical cancer, small cell and non-small cell lung cancer, nasopharyngeal cancer, breast cancer (e.g., ductal breast cancer, invasive intraductal breast cancer, sporadic; breast cancer, breast cancer predisposition, type 4 breast cancer, breast cancer-1, breast cancer-3; breast, ovarian cancer), squamous cell carcinoma (e.g.,in the head and neck), neurogenic tumors, astrocytomas, ganglioblastomas, neuroblastomas, lymphomas (e.g., Hodgkin's disease, non-Hodgkin's lymphoma, B cell, human lymphoma cell line (Burkitt), cutaneous T cell, histiocytic, lymphoblastic, T cell, thymic), gliomas, adenocarcinomas, adrenal tumors, hereditary adrenocortical carcinomas, brain malignancies (tumors), various other carcinomas (e.g., large cell, bronchogenic, ductal, Ehrlich-Lettre ascites, epidermoid, large cell, Lewis lung, medullary, mucoepidermoid, oat cell, small cell, spindle cell), cell, spinocellular, transitional cell, undifferentiated, carcinosarcoma, choriocarcinoma, cystadenocarcinoma), ependymoblastoma, epithelioma, erythroleukemia (e.g., Friend, lymphoblastic), fibrosarcoma, giant cell tumor, glial tumor, glioblastoma (e.g., multiforme, astrocytoma), glioma hepatoma, heterohybridoma, heteromyeloma, histiocytoma, hybridoma (e.g., B cell), hypernephroma, insulinoma, islet tumor tumor), keratoma, leiomyoblastoma, leiomyosarcoma, leukemia (e.g.,acute lymphoid, acute lymphoblastic, acute lymphoblastic pre-B cell, acute lymphoblastic T-cell leukemia, acute-megakaryocyte, monocytic, acute myelogenous, acute myeloid, acute myeloid with eosinophils, B cell, basophilic, chronic myeloid, chronic, B cell, eosinophilic, Friend, granulocytic or myelocytic, hairy cell, lymphocyte, megakaryocyte, monocyte, mononuclear macrophage, myeloblastic, myeloid, myelomonocytic, plasma cell, pre-B cell, promyelocytic, subacute, T cell, lymphoid neoplasm, myeloid malignancy malignancy, acute nonlymphocytic leukemia), lymphosarcoma, melanoma, breast tumor, mastocytoma, medulloblastoma, mesothelioma, metastatic tumor, monocytoma, multiple myeloma, myelodysplastic syndrome, myeloma, nephroblastoma, neural glioma, neural neuron tumor, neurinoma, neuroblastoma, oligodendroglioma, osteochondroma, osteomyeloma, osteosarcoma (Ewing's), papilloma, transitional cell cell), pheochromocytoma, pituitary tumor (aggressive), plasmacytoma, retinoblastoma, rhabdomyosarcoma, sarcoma (e.g., Ewing's, histiocytic, Jensen's, osteoblastic, reticulum cell), schwannoma, subcutaneous tumor, teratocarcinoma (e.g.,pluripotency), teratoma, testicular tumor, thymoma and cystic adenoid epithelioma, gastric cancer, fibrosarcoma, glioblastoma multiforme; multiple glomus tumor, Li-Fraumeni syndrome, liposarcoma, Lynch cancer family syndrome II, male germ cell tumor, mast cell leukemia, medullary thyroid, multiple meningioma, endocrine neoplasia myxosarcoma, paraganglioma, familial nonchromaffin tumor, pilomatricoma, papillary, familial and sporadic, rhabdoid predisposition syndrome syndrome), familial rhabdoid tumor, soft tissue sarcoma, and Turcot syndrome with glioblastoma.

[0558] According to one embodiment, cancers that can be treated by the methods of some embodiments of the present invention include hematologic malignancies. An exemplary hematologic malignancy involves a malignant fusion of the ABL tyrosine kinase with a different chromosome, producing the so-called BCR-ABL, which in turn results in a malignant fusion protein. Therefore, targeting the fusion site in the mRNA can silence only the fusion mRNA for downregulation, while the normal protein essential to the cell is retained.

[0559] According to one embodiment, to treat a cancerous disease in a subject, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to target an RNA of interest associated with the cancerous disease.

[0560] According to one embodiment, the target RNA of interest comprises a product of an oncongene (eg, a mutated oncongene).

[0561] According to one embodiment, the target RNA of interest restores the function of a tumor suppressor.

[0562] According to one embodiment, the target RNA of interest comprises a product of a RAS, MCL-1 or MYC gene.

[0563] According to one embodiment, the target RNA of interest includes a product of a BCL-2 family of apoptosis-related genes.

[0564] Exemplary target genes include, but are not limited to, mutant dominant negative TP53, Bcl-x, IAP, Flip, Faim3, and SMS1.

[0565] According to one embodiment, when the cancer is melanoma, the target RNA of interest includes BRAF. Several forms of BRAF mutations are contemplated herein, including, for example, V600E, V600K, V600D, V600G, and V600R.

[0566] According to one embodiment, the method is effected by targeting the non-coding RNA molecules in healthy immune cells (e.g., white blood cells, such as T cells, B cells, or NK cells (e.g., from a patient or from a cell donor)), thereby enabling the immune cells to (directly or indirectly) kill malignant cells (e.g., cells of a hematological malignancy).

[0567] According to one embodiment, the method is effected by targeting multiple non-coding RNA molecules to silence proteins (i.e., target RNAs of interest) that are manipulated by multiple cancer factors (i.e., in order to suppress the immune response that recognizes the malignant tumor), thereby allowing the cancer to be recognized and eradicated by the innate immune system.

[0568] The effectiveness of treatment can be assessed using any method known in the art, for example, by assessing the tumor growth or the number of neoplasms or metastasis, for example, by MRI, CT, PET-CT, blood tests, ultrasound, X-ray, etc.

[0569] According to one aspect of the present invention, a method for enhancing the efficacy and / or specificity of a chemotherapeutic agent for treating a cancerous disease in a subject in need thereof is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method described in some embodiments of the present invention, wherein the target RNA of interest is associated with the enhancement of the efficacy and / or specificity of the chemotherapeutic agent, thereby enhancing the efficacy and / or specificity of a chemotherapeutic agent in the subject.

[0570] According to one aspect of the present invention, a DNA editing agent is provided, which confers a silencing specificity to a non-coding RNA molecule that has no RNA silencing activity against a target RNA of interest, wherein the target RNA of interest is associated with the enhancement of the efficacy and / or specificity of the chemotherapeutic agent, and is used to enhance the efficacy and / or specificity of a chemotherapeutic agent in a subject in need thereof.

[0571] According to one aspect of the present invention, a DNA editing agent is provided, which redirects the silencing specificity of a gene encoding or processed into an RNA silencing molecule to a target RNA directed against a second target RNA, wherein the target RNA and the second target RNA are different, wherein the second target RNA is associated with the enhancement of the efficacy and / or specificity of the chemotherapeutic agent, and is used to enhance the efficacy and / or specificity of a chemotherapeutic agent in a subject in need.

[0572] As used herein, the term "chemotherapeutic agent" refers to an agent that reduces, prevents, alleviates, limits and / or delays the growth of a tumor or metastasis, or directly kills tumor cells by tumor necrosis or apoptosis or any other mechanism, or an agent that can be used in a pharmaceutically effective amount to reduce, prevent, alleviate, limit and / or delay the growth of a tumor or metastasis in a subject suffering from a neoplastic disease (e.g., cancer).

[0573] Chemotherapeutic agents include, but are not limited to, fluoropyrimidines; pyrimidine nucleosides; purine nucleosides; antifolates, platinum agents; anthracyclines / anthracenediones; epipodophyllotoxins; camptothecins (e.g., Karenitecin); hormones; hormone complexes; antihormonals; enzymes, proteins, peptides, and polyclonal and / or monoclonal antibodies; immunopharmaceuticals; vinca alkaloids; taxanes; epothilones; antimicrotubule agents; alkylating agents; antimetabolites; topoisomerase inhibitors; antivirals, and various other cytotoxic and cytostatic agents.

[0574] According to a specific embodiment, the chemotherapeutic agents include but are not limited to abarelix, aldesleukin, alemtuzumab, alemtuzumab, allopurinol, altretamine, amifostine, anastrozole, arsenic trioxide, trioxide), asparaginase, azacitidine, bevacuzimab, bexarotene, bleomycin, bortezomib, busulfan, calusterone, capecitabine, carboplatin, carmustine, celecoxib, cetuximab, cisplatin, cladribine, clofarabine, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, actinomycin D, darbepoetin alfa alfa), darbepoetin alfa, daunorubicin liposomal, daunorubicin, decitabine, denileukindiftitox, dexrazoxane, dexrazoxane, docetaxel, doxorubicin, dromostanolone propionate, Elliott's B Solution, epirubicin, epoetin alfaalfa), erlotinib, estramustine, etoposide, exemestane, filgrastim, floxuridine, fludarabine, fluorouracil 5-FU, fulvestrant, gefitinib, gemcitabine, gemtuzumab tuzumab, goserelin acetate, histrelin acetate, hydroxyurea, ibritumomab tiuxetan, idarubicin, ifosfamide, imatinib mesylate, interferon alfa 2a), interferon 2b, irinotecan, lenalidomide, letrozole, leucovorin, leuprolide acetate, levamisole, lomustine, CCNU, meclorethamine, nitrogen mustard, megestrol acetate, melphalan, L-PAM, mercaptopurine 6-MP, mesna, methotrexate, mitomycin CC), mitotane, mitoxantrone, nandrolone phenylpropionate, nelarabine, nofetumomab, oprelvekin, oprelvekin, oxaliplatin, paclitaxel, palifermin, pamidronate, pegademase, pegaspargase, pegfilgrastim, pemetrexed disodium, pentostatin, pipobroman, plicamycin mithramycin, porfimer sodium sodium), procarbazine, quinacrine, rasburicase, rituximab, sargramostim, sorafenib, streptozocin, sunitinib maleate, tamoxifen, temozolomide, teniposide VM-26, testolactone, thioguanine 6-TG, thiotepa, thiotepa, topotecan, toremifene, tositumomab, trastuzumab, tretinoin ATRA, uracil Mustard, valrubicin, vinblastine, vinorelbine, zoledronate, and zoledronic acid.

[0575] According to one embodiment, the effect of the chemotherapeutic agent is enhanced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% compared to the effect of the chemotherapeutic agent in a subject not treated with the DNA editing agent, wherein the DNA editing agent is designed to confer a silencing activity and / or specificity to a non-coding RNA molecule (e.g., an RNA silencing molecule) against a target RNA of interest.

[0576] The efficacy and / or specificity of a chemotherapeutic agent can be assessed using any method known in the art, for example, by assessing the tumor growth or the number of tumors or metastases, for example, by MRI, CT, PET-CT, blood tests, ultrasound, X-ray, etc.

[0577] According to one embodiment, the method is effected by targeting the multiple non-coding RNA molecules in multiple healthy immune cells (e.g., white blood cells, such as T cells, B cells or NK cells (e.g., from a patient or from a cell donor)), thereby enabling the multiple immune cells to reduce the resistance of the cancer to chemotherapy.

[0578] According to one embodiment, the method is effected by targeting the multiple non-coding RNA molecules in multiple healthy immune cells (e.g., white blood cells, such as T cells, B cells or NK cells (e.g., from a patient or from a cell donor)), thereby rendering the multiple immune cells resistant to chemotherapy.

[0579] According to one embodiment, in order to enhance the efficacy and / or specificity of a chemotherapeutic agent in a subject, the non-coding RNA molecule (e.g., RNA silencing molecule) is designed to target an RNA of interest that is associated with the inhibition of the efficacy and / or specificity of the chemotherapeutic agent.

[0580] According to one embodiment, the target RNA of interest includes a product of a drug metabolizing enzyme gene (e.g., cytochrome P450 (CYP) 2C8, CYP2C9, CYP2C19, CYP2D6, CYP3A4, CYP3A5, dihydropyrimidine dehydrogenase, uridine diphosphate glucuronosyltransferase (UGT) 1A1, glutathione S-transferase, sulfotransferase (SULT) 1A1, N-acetyltransferase (NAT), thiopurine methyltransferase (TPMT)) and a drug transporter (P-glycoprotein (multidrug resistance 1), multidrug resistance protein 2 (MRP2), breast cancer resistance protein (BCRP)).

[0581] According to one embodiment, the target RNA of interest comprises an anti-apoptotic gene. Exemplary target genes include, but are not limited to, Bcl-2 family members, such as Bcl-x, IAPs, Flip, Faim3, and SMS1.

[0582] According to one aspect of the present invention, a method for inducing cell apoptosis in a subject in need thereof is provided, the method comprising: modifying a gene encoding or processed into a non-coding RNA molecule or encoding or processed into an RNA silencing molecule according to the method of some embodiments of the present invention, wherein the target RNA of interest is associated with apoptosis, thereby inducing cell apoptosis in the subject.

[0583] According to one aspect of the present invention, a DNA editing agent is provided, which confers a silencing specificity to a non-coding RNA molecule without RNA silencing activity against a target RNA of interest, wherein the target RNA of interest is associated with apoptosis, for inducing cell apoptosis in a subject in need thereof.

[0584] According to one aspect of the present invention, a DNA editing agent is provided, which redirects the silencing specificity of a gene encoding or processed into an RNA silencing molecule to a target RNA targeting a second target RNA, wherein the target RNA and the second target RNA are different, wherein the second target RNA is associated with apoptosis, and is used to induce cell apoptosis in a subject in need thereof.

[0585] As used herein, the term "apoptosis" refers to the cellular process of programmed cell death. Apoptosis is characterized by distinct morphological changes in the cytoplasm and nucleus, chromatin fragmentation at regularly spaced sites, and endonucleolytic cleavage of genomic DNA at internucleosomal sites. These changes include blebbing of the cell membrane, cell shrinkage, nuclear fragmentation, chromatin condensation, and chromosomal DNA fragmentation.

[0586] According to one embodiment, cell apoptosis is enhanced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% compared to cell apoptosis in a subject not treated with the DNA editing agent, wherein the DNA editing agent confers a silencing activity and / or specificity of a non-coding RNA molecule (e.g., an RNA silencing molecule) against a target RNA of interest.

[0587] Apoptosis can be assessed using any method known in the art, for example, cell proliferation assays, FACS analysis, and the like.

[0588] According to one embodiment, to induce apoptosis in a subject, the non-coding RNA molecule (eg, RNA silencing molecule) is designed to target an RNA of interest associated with the apoptosis.

[0589] According to one embodiment, the target RNA of interest includes a product of a BCL-2 family of apoptosis-related genes.

[0590] According to one embodiment, the target RNA of interest comprises an anti-apoptotic gene. Exemplary genes include, but are not limited to, mutant dominant negative TP53, Bcl-x, IAPs, Flip, Faim3, and SMS1.

[0591] According to one aspect of the present invention, a method for producing a eukaryotic non-human organism is provided, provided that the organism is not a plant, wherein at least some of the cells of the eukaryotic non-human organism include a modified gene for encoding or being processed into a non-coding RNA molecule, and the non-coding RNA molecule includes a silencing specificity for a target RNA of interest, and the method includes introducing a DNA editing agent into at least one cell of the eukaryotic non-human organism, and the DNA editing agent confers a silencing specificity to the non-coding RNA molecule (e.g., an RNA silencing molecule) for the target RNA of interest.

[0592] The following information should be provided: (a) the target sequence ("target") for silencing by gene editing-induced gene silencing (GEiGS); and (b) whether the GEiGS (i.e., the non-coding RNA) is selected for ubiquitous expression (e.g., constitutive expression) or specific expression (e.g., expression in a particular tissue, developmental stage, stress, heat / cold shock, etc.).

[0593] This information is submitted to a publicly available miRNA dataset (e.g., small RNA sequencing, multiple genomic sequences, multiple microarrays, etc.) to filter (i.e., select) only relevant miRNAs that meet the input criteria: multiple miRNAs expressed according to the above requirement(s).

[0594] Using publicly available tools, a list of effective target-specific siRNA sequences can be generated. The miRNAs can be aligned with the effective siRNA sequences, and the most homologous miRNAs can be selected. The screened miRNAs may have a similar sequence in the same direction as the effective siRNAs.

[0595] Modify multiple naturally mature miRNA sequences to have a high degree of homology with multiple target-specific and effective siRNAs, thereby completely matching the sequence of the target. This modification can occur in a mature miRNA strand with the highest target homology (for example, it can be the original miRNA guide strand or passenger strand). This 100% complementarity with the target can convert the miRNA sequence into an siRNA.

[0596] Minimal GE can be achieved by screening multiple miRNA sequences that have naturally high homology (reverse complement) to the target.

[0597] Based on the multiple genomic DNA sequences flanking the modified miRNA precursor sequence (pre-miRNA), the multiple primary modified miRNA genes are used to generate multiple ssDNA oligonucleotides (e.g., 200 to 500 nt ssDNA length) and multiple dsDNA fragments (e.g., only 250 to 5000 nt dsDNA fragments or cloned into multiple plasmids). The guide strand (silencing strand) sequence of the modified miRNA can be designed to be 100% complementary to the target.

[0598] The sequences of other miRNA gene regions were modified to preserve the original (unmodified) miRNA precursor and mature structures by maintaining the same base pairing profile.

[0599] Multiple sgRNAs are designed to specifically target the original unmodified miRNA gene (specific to the genomic miRNA locus) rather than the modified form (ie, the multiple oligonucleotide / fragment sequences).

[0600] The comparative restriction enzyme sites between the modified miRNA and the original miRNA gene are analyzed and multiple differential restriction sites are summarized. This detection system is based on PCR, followed by restriction enzyme digestion and gel electrophoresis.

[0601] Validation was performed as discussed in detail above.

[0602] When the endogenous non-coding RNA (e.g., miRNA) includes a naturally occurring high homology (e.g., 60 to 90%) with the target, bioinformatics methods are used to examine the targeting of the non-coding RNA against multiple other targets (e.g., "off target effects") to obtain specific silencing of the target of interest.

[0603] The endogenous non-coding RNA (eg, miRNA) is minimally modified to enhance its potency in silencing the target of interest.

[0604] Validate the GEiGS results of multiple primary minimally edited miRNA genes to generate multiple candidate refined minimally edited miRNAs. An experimentally valid primary GEiGS result (the multiple primary minimally edited miRNA genes) is considered to be a miRNA with a guide strand or passenger strand modified to match the target 100%.

[0605] Generate multiple guide or passenger chain sequences that gradually return to the original sequence (e.g. Figure 9 ).

[0606] The seed sequence is maintained in such a way that there are at least 5 matches among the seven seed nucleotides (from nucleotides 2 to 8 at the 5' end).

[0607] Various candidate "refined minimally edited miRNA genes" were tested for their target silencing efficiency. The genes that provided the highest silencing with the least miRNA sequence modification upon GE-mediated knock-in were selected.

[0608] Testing of multiple refined minimally edited miRNA candidates for potential “off-target effects.” An important prediction of “off-target effects” influenced the final evaluation of the multiple refined minimally edited miRNA genes.

[0609] Based on experimental validation, multiple less refined minimally edited miRNA gene candidates were tested.

[0610] As used herein, the term "about" refers to ±10%.

[0611] The terms "comprises," "comprising," "includes," "including," "having" and their conjugations mean "including but not limited to."

[0612] The term "consisting of" means "including and limited to."

[0613] The term "consisting essentially of" means that the composition, method or structure may include other ingredients, steps and / or parts as long as the other ingredients, steps and / or parts do not materially change the basic and novel characteristics of the claimed composition, method or structure.

[0614] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0615] Throughout this application, different embodiments of the present invention may be presented in range format. It should be understood that descriptions in range format are for convenience and brevity only and should not be construed as immutable limitations on the scope of the invention. Therefore, descriptions of ranges should be considered to specifically disclose all possible subranges and individual numerical values ​​of such ranges. For example, a description of a range such as 1 to 6 should be considered to specifically disclose subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, and individual numbers of such ranges, such as 1, 2, 3, 4, 5, and 6. This applies regardless of the width of the range.

[0616] Whenever a numerical range is specified herein, it is intended to include any stated number (fractional or integer) within the specified range. The phrases "range between" a first indicated number and a second indicated number and "range from" a first indicated number to" a second indicated number are used interchangeably herein to include the first indicated number and the second indicated number and all fractions and integers therebetween.

[0617] The term "method" as used herein refers to ways, means, techniques and procedures for accomplishing a given task, including but not limited to those known to practitioners in the fields of chemistry, pharmacology, biology, biochemistry and medicine or readily developed by them from known ways, means, techniques and procedures.

[0618] It should be understood that certain features of the invention described in the context of separate embodiments, for the sake of clarity, may also be provided in combination in a single embodiment. Conversely, different features of the invention described in the context of a single embodiment, for the sake of brevity, may also be provided separately or in any suitable subcombination or applicable to any other described embodiment of the invention. Certain features described in the context of different embodiments are not to be considered essential features of that embodiment, unless the embodiment is inoperative without the elements.

[0619] In the following examples, experimental support is provided for various embodiments and aspects of the present invention as described above and claimed in the appended claims section.

[0620] It should be understood that any sequence identification number (SEQ ID NO) disclosed in this application can refer to a DNA sequence or an RNA sequence, depending on the context in which the SEQ ID NO is mentioned, even if the SEQ ID NO is expressed in only a DNA sequence format or an RNA sequence format. For example, SEQ ID NOs: 1 to 4 are expressed in a DNA sequence format (e.g., with T representing thymine), but it can refer to a DNA sequence corresponding to a gRNA nucleic acid sequence, or to the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, although certain sequences are expressed in an RNA sequence format (e.g., with U representing uracil), depending on the actual type of molecule, it can refer to the sequence of an RNA molecule, including a dsRNA, or it can refer to the sequence of a DNA molecule corresponding to the indicated RNA sequence. In any case, DNA and RNA molecules having the disclosed sequences together with any substituents are contemplated.

[0621] Examples

[0622] Reference is now made to the following examples, which together with the above descriptions illustrate the invention in a non limiting fashion.

[0623] In general, the nomenclature used herein and the laboratory procedures utilized in the present invention comprise molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are fully explained in the literature. See, for example, "Molecular Cloning: A Laboratory Manual", Sambrook et al., 1989; "Current Protocols in Molecular Biology", Volumes I to III, Ausubel, RM, ed., 1994; Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland, 1989; Perbal, "A Practical Guide to Molecular Cloning", John Wiley and Sons, New York, 1988; Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds.) "Genome Analysis: A Laboratory Manual Series", Volumes 1 to 4, Cold Spring Harbor Laboratory Press, 1994. Nos. 4,666,828, 4,683,202, 4,801,531, 5,192,659, and 5,272,057; Cell Biology: A Laboratory Handbook, Vols. I-III, Cellis, JE, ed., 1994; Culture of Animal Cells—A Manual of Basic Technique, Freshney, Wiley-Liss, New York, 1994, 3rd ed.; Current Protocols in Immunology, Vols. I-III, Coligan, JE, ed., 1994; Stites et al. (eds.), Basic and Clinical Immunology (8th ed.), Appleton and Lange, Norwalk, CT, 1994; Mishell and Shiigi (eds.), Selected Methods in Cellular Immunology, WH Freeman and Co., New York, 1980; available immunoassays are described extensively in the patent and scientific literature, see, for example, U.S. Patent Nos. 3,791,932, 3,839,153, 3,850,752, 3,850,578, 3,853,987, 3,867,517, 3,879,262, 3,901,654, 3,935,074, 3,984,533, 3,996,345, 4,034,074, 4,098,876, 4,879,219, 5,011,771, and 5,281,521, “Oligonucleotide Synthesis”, Gait, MJ, ed., 1984; “Nucleic Acid Hybridization”, Hames, BD and Higgins, ed. SJ, ed., 1985; "Transcription and Translation", Hames, BD and Higgins SJ, ed., 1984; "Animal Cell Culture", Freshney, RI, ed., 1986; "Immobilized Cells and Enzymes", IRL Press, 1986; "A Practical Guide to Molecular Cloning", Perbal, B., 1984 and "Methods in Enzymology", Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA, 1990; Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual", CSHL Press, 1996; all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout the document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All information contained therein is incorporated herein by reference.

[0624] General Materials and Experimental Procedures

[0625] Cell culture

[0626] Tissue culture was performed using human cell lines or mouse embryonic stem cells. Human osteosarcoma epithelial cells (U2OS), human retinal pigment epithelial cells (RPE1), adenocarcinoma human alveolar basal epithelial cells (A549), cervical cancer cells (HeLa), or human colorectal cancer cells (HCT116) were cultured in tissue culture medium supplemented with essential nutrients (amino acids, carbohydrates, vitamins, minerals), growth factors, and required hormones. The cells were cultured in a CO2-humidified incubator at a controlled temperature (37°C) under appropriate physicochemical conditions (pH buffer, osmotic pressure).

[0627] Cell survival assay

[0628] Chemosensitivity was determined by the crystal violet assay as previously described (Taniguchi et al., Cell, 2002, 109:459-72). Cells were plated at 2×10 4 Cells were seeded onto 12-well plates at a density of 100 cells / well and treated with cisplatin, camptothecin (Sigma), paclitaxel (Sigma), AZD2281 (Axon Medchem), or Nutlin3 (Selleckchem) at the specified doses. After 3 days of culture, the monolayer was fixed in 10% methanol containing 10% acetic acid. Adherent cells were stained with 0.5% crystal violet in methanol. The absorbed dye was redissolved in methanol containing 0.1% SDS, transferred to a 96-well plate, and photometrically measured (595 nm) in a microplate reader. Cell viability was calculated by normalizing the absorbance to that of an untreated control group.

[0629] The same method as above can be scaled up to a 6-well plate or larger and the colonies formed can be counted without re-dissolving the crystal violet. This format is called a clonogenic assay and is based on the ability of the treated cells to grow into colonies. Another assay used is the metabolic activity-based cell viability assay XTT or any other metabolic activity assay. XTT is a colorimetric assay used to assess cell viability in relation to cell number based on metabolic activity. This rapid, sensitive, non-radioactive assay is detected using a standard microplate absorbance reader. Cells are plated at 10 4 to 10 5Cells were grown at a density of 100 μL of test compound-containing medium in a 96-well plate and incubated in a CO2 incubator for 24 to 48 hours. Fresh buffer was prepared before each assay: 10 mM PMS solution in phosphate buffered saline and 4 mg of XTT dissolved in 4 mL of 37°C cell culture medium. Immediately before labeling the cells, 10 μL of the PMS solution was added to the 4 mL of XTT solution. 25 μL of the XTT / PMS solution was added directly to each well containing 100 μL of cell culture medium, incubated in a CO2 incubator (37°C) for 2 hours, and absorbance was measured at 450 nm.

[0630] Small RNA and miRNA isolation

[0631] Small RNAs containing miRNAs were isolated using the miRvana RNA isolation kit (Ambion, Austin, TX, USA) according to the manufacturer's protocol. RNA was quantified using a Qubit or Nanodrop spectrophotometer (Thermo Fisher, Wilmington, DE, USA) and quality was determined using an Agilent 6000 nanochip (Agilent Technologies, Palo Alto, CA, USA).

[0632] miRNA measurement

[0633] Real-time quantitative PCR analysis was performed as follows: RNA was reverse transcribed and PCR amplified using the miScript Reverse Transcription Kit and the miScript SYBR PCR Kit (Qiagen, Valencia, CA, USA) using an ABI 7500 Real-Time PCR System according to the manufacturer's protocol. Values ​​from replicate reactions were averaged and normalized to the level of U6S noRNA. Relative expression levels were calculated using the comparative Ct method as previously described (Schmittgen and Livak., Nat Protoc, 2008, 3:1101-1108). Alternatively, small RNA sequence analysis was used to detect and relatively quantify miRNAs (as described at www(dot)illumina(dot)com / techniques / sequencing / rna-sequencing / small-rna-seq(dot)html or Wake et al. (BMC Genomics, 2016, 17(1):1).

[0634] Computational pipeline to generate GEiGS templates

[0635] The computational Genome Editing Induced Gene Silencing (GEiGS) pipeline utilizes biological metadata and can automatically generate multiple GEiGS DNA templates, which are used to minimally edit multiple non-coding RNA genes (e.g., multiple miRNA genes) to acquire a new function, namely redirecting their silencing ability to target sequences of interest.

[0636] like Figure 1 As shown in , the pipeline starts with filling in and submitting inputs: (a) silencing the target sequence by GEiGS; (b) gene editing the host organism and expressing the GEiGS; (c) you can choose whether to express the GEiGS ubiquitously. If specific GEiGS expression is required, you can choose from several options (expression specific to a specific tissue, developmental stage, stress, heat / cold shock, etc.).

[0637] After all necessary inputs are submitted, the computational process will begin by searching between multiple miRNA data sets (e.g., small RNA sequencing, microarrays, etc.) and only screening (i.e., retaining) multiple related miRNAs that meet the input criteria. Next, selected multiple mature miRNA sequences are compared with the target sequence, and the miRNA with the highest level of complementarity is screened. These natural target complementary mature miRNA sequences are then modified so that they fully match the sequence of the target. The modified multiple mature miRNA sequences are then run through an algorithm that predicts siRNA efficacy, and the top 20 with the highest silencing scores are screened out. These final modified miRNA genes are then used to produce 200 to 500nt ssDNA or 250 to 5000nt dsDNA sequences, as shown below.

[0638] Based on the genomic DNA sequence flanking the modified miRNA, 200 to 500 nt ssDNA oligonucleotides and 250 to 5000 nt dsDNA fragments were designed. The pre-miRNA sequence was located in the center of the oligonucleotide. The guide strand (silencing) sequence of the modified miRNA was 100% complementary to the target. However, the sequence of the modified passenger miRNA strand was further modified to retain the original (unmodified) miRNA structure, maintaining the same base pairing profile.

[0639] Next, multiple differential sgRNAs were designed to specifically target the original unmodified miRNA gene rather than the modified, exchanged form. Finally, comparative restriction enzyme site analysis was performed between the modified miRNA gene and the original miRNA gene, and multiple differential restriction sites were summarized.

[0640] Thus, the pipeline output contains:

[0641] (a) 200 to 500 nt ssDNA oligonucleotides or 250 to 5000 nt dsDNA fragment sequences with minimally modified miRNAs.

[0642] (b) 2 to 3 differential sgRNAs that specifically target the original miRNA gene but not the modified miRNA gene.

[0643] (c) A list of multiple differential restriction enzyme cleavage sites between the modified miRNA gene and the original miRNA gene.

[0644] Selection of GEiGS precursors:

[0645] A list of multiple noncoding RNA types that are Dicer substrates and processed into small silencing RNAs was manually compiled from results previously published by Rybak-Wolf A. et al. (Rybak-Wolf A. et al., Cell, 2014, 159, 1153-1167), in which the PAR-CLIP technique was used to identify multiple RNA molecules bound by Dicer and Argonaute 2 and 3. The Dicer substrates were further filtered to remove regions overlapping with coding genes and further curated to remove ambiguous annotations. AGO2 and AGO3 small RNA sequences were processed using cutadapt v1.7 (Martin M., EMBnet. journal, 2011, 17(1):10-12) to remove sequencing adapters. The processed reads were aligned to the GRCh37 assembly of the human genome using STAR v2.6.1a (Dobin A. et al., Bioinformatics, 2013, 29, 15-21) (with parameters: "--alignIntronMax 1 --alignEndsType EndToEnd --scoreDelOpen-10000 --scoreInsOpen-10000"). Graphics were captured using Integrated Genomics Viewer software (Thorvaldsdóttir H. et al., Brief Bioinform, 2013, 14(2): 178-92).

[0646] target gene

[0647] Multiple miRNAs are selected that have a ubiquitous expression profile (depending on the application, multiple miRNAs can be selected that have an expression profile that is specific to a particular tissue, developmental stage, temperature, stress, etc.).

[0648] For example, miRNA was modified into siRNA targeting GFP, p53, BAX, PUMA, NOXA genes (see Table 1A below).

[0649] Table 1A: Target genes

[0650]

[0651]

[0652] siRNA design

[0653] Multiple target-specific siRNAs were designed using publicly available siRNA designers, such as ThermoFisher Scientific's "BLOCK-iT TM RNAi Designer (BLOCK-iT TM RNAi Designer) and Invivogen's "Find siRNA sequences".

[0654] sgRNA design

[0655] As previously described by Park et al. (Bioinformatics, 2015, 31(24): 4014-4016), multiple sgRNAs were designed to target the multiple endogenous miRNA genes using the publicly available sgRNA designer. Two sgRNAs were designed for each cassette, and only a single sgRNA was expressed per cell to initiate gene exchange. The sgRNAs corresponded to the modified pre-miRNA sequences after exchange.

[0656] To maximize the chance of efficient sgRNA selection, two different publicly available algorithms (CRISPER design: www(dot)crispr(dot)mit(dot)edu:8079 / and CHOPCHOP: www(dot)chopchop(dot)cbu(dot)uib(dot)no / ) were used, and the highest-scoring sgRNAs from each algorithm were selected.

[0657] Exchange ssDNA oligonucleotide design

[0658] A 400-bp ssDNA oligonucleotide was designed based on the genomic DNA sequence of the miRNA gene. The pre-miRNA sequence was located at the center of the oligonucleotide. Next, the multiple double-stranded siRNA sequences were swapped with the multiple mature miRNA sequences to ensure that the guide (silencing) siRNA strand maintained 100% complementarity with the target. The sequence of the passenger siRNA strand was modified to retain the original miRNA structure and maintain the same base pairing profile.

[0659] Exchange plasmid DNA design

[0660] A 4000bp dsDNA fragment was designed based on the genomic DNA sequence of the miRNA gene. The pre-miRNA sequence was located at the center of the dsDNA fragment. The fragment was cloned into a standard vector (e.g., Bluescript) and transfected into the cells using the Cas9 system components. Next, the mature miRNA sequences were swapped with the double-stranded siRNA sequences so that the guide (silencing) siRNA strand remained 100% complementary to the target. The sequence of the passenger siRNA strand was modified to retain the original miRNA structure, maintaining the same base pairing profile.

[0661] sgRNA sequence:

[0662] Human miR-150

[0663] 1.CCAGCACTGGTACAAGGGTTGGG(SEQ ID NO:5)

[0664] 2.CCAACCCTTGTACCAGTGCTGGG(SEQ ID NO:6)

[0665] List of exchanged endogenous miRNAs:

[0666] 1. Human miR-150 (SEQ ID NO: 13)

[0667] 2. Human miR-210 (SEQ ID NO: 14)

[0668] 3. Human miR-34 (SEQ ID NO: 19-21)

[0669] 4. Human Let7b (SEQ ID NO: 15)

[0670] 5. Human miR-184 (SEQ ID NO: 16)

[0671] 6. Human miR-204 (SEQ ID NO: 17)

[0672] 7. Human miR-25 (SEQ ID NO: 18)

[0673] ssDNA oligonucleotides for gene exchange:

[0674] Oligonucleotide-1: GFP-siRNA1_hsa-mir150 (5'→3') (SEQ ID NO: 1)

[0675] Oligonucleotide-2: GFP-siRNA6_hsa-mir150 (5'→3') (SEQ ID NO: 2)

[0676] Oligonucleotide-3:TP53-siRNA1_hsa-mir150(5'→3') (SEQ ID NO:3)

[0677] Oligonucleotide-4:TP53-siRNA2_hsa-mir150(5'→3') (SEQ ID NO:4)

[0678] Oligonucleotide-5: TP53-siRNA1-mMIR17 (5'→3') (SEQ ID NO: 243)

[0679] Oligonucleotide-6:TP53-siRNA2-mMIR17 (5'→3') (SEQ ID NO: 244)

[0680] Oligonucleotide-7: HPRT-siRNA1-mMIR17 (5'→3') (SEQ ID NO: 245)

[0681] Oligonucleotide-8: HPRT-siRNA2-mMIR17 (5'→3') (SEQ ID NO: 246)

[0682] Oligonucleotide-9:TP53-siRNA1-mMIR21a (5'→3') (SEQ ID NO: 247)

[0683] Oligonucleotide-10: TP53-siRNA2-mMIR21a (5'→3') (SEQ ID NO: 248)

[0684] Oligonucleotide-11: HPRT-siRNA1-mMIR21a (5'→3') (SEQ ID NO: 249)

[0685] Oligonucleotide-12: HPRT-siRNA2-mMIR21a (5'→3') (SEQ ID NO: 250)

[0686] Oligonucleotide-13: GFP-siRNA1-mMIR17 (5'→3') (SEQ ID NO: 251)

[0687] Oligonucleotide-14: GFP-siRNA1-mMIR21a (5'→3') (SEQ ID NO: 252)

[0688] sgRNA cloning

[0689] The transfection plasmid used is composed of 4 modules, including:

[0690] (1) mCherry driven by the CMV promoter (terminated by a BGH poly(A) signal termination sequence);

[0691] (2) Cas9 driven by the EF1a core promoter (human codon optimized), wherein the promoter is terminated by a BGH poly(A) signal termination sequence;

[0692] (3) Pol III (U6) promoter sgRNA was used to indicate 1;

[0693] Plasmid design

[0694] For transient expression, a plasmid containing three transcription units was used. The first transcription unit contained the EF1a core promoter and the BGH poly(A) signal terminator to drive Cas9 expression. The next transcription unit consisted of the CMV promoter and the BGH poly(A) signal terminator to drive mCherry expression. The third contained the pol III (U6) promoter to express sgRNAs targeting multiple miRNA genes (each vector contained a single sgRNA).

[0695] Design and cloning of CRISPR / CAS9 to target miR-173 and miR-390 and introduction of SWAP to target GFP, AtPDS3, and AtADH1

[0696] To prove the concept, the present inventors have designed the changes in mature miR-173 and miR-390 sequences. In their genomic context, by producing reverse complementary small RNAs of multiple target genes, to target GFP, AtPDS3 or AtADH1 (in multiple plant cells). In addition, in order to maintain the secondary structure of the miRNA precursor transcript, the pri-miRNA is further changed (Table 2 below). These fragments are cloned into multiple PUC plasmids and named as donors (DONORs), and the multiple DNA fragments are called SWAP. For modifying the sequence-SWAP1 and SWAP2 targeting GFP, SWAP3 and SWAP4 targeting AtPDS3 and SWAP9 and SWAP10 targeting AtADH1 of miR-173 (see Table 2 below). For modifying the sequence-SWAP5 and SWAP6 targeting GFP, SWAP7 and SWAP8 targeting AtPDS3 and SWAP11 and SWAP12 targeting AtADH1 of miR-390 (see Table 2 below).

[0697] Multiple guide RNAs targeting miR-173 and miR-390 were introduced into the CRISPR / CAS9 vector system to generate a DNA shear in the desired miRNA locus. They were co-introduced into multiple plants with the multiple donor (DONOR) vectors via a gene bombardment protocol to introduce the desired multiple modifications via homologous DNA repair (HDR). These guide RNAs are detailed in Table 2 below.

[0698] Table 2: Sequences and oligonucleotides used in the experiments

[0699]

[0700]

[0701]

[0702]

[0703] Plasmid transfection

[0704] For transfection, use according to the manufacturer's protocol. 2000 transfection reagent (or any other reagent), in short:

[0705] For adherent cells: One day before transfection, add 0.5 to 2 x 10 5 Cells were seeded in 500 μl of growth medium (without antibiotics) so that the cells would be 90 to 95% confluent at the time of transfection.

[0706] For suspension cells: seed 4 to 8 x 10 cells in 500 μl of growth medium (without antibiotics) before preparing the complexes. 5 cell.

[0707] For each transfection sample, multiple complexes were prepared as follows: (a) DNA was added to 50 μl serum-free Opti- Reduced serum medium (Opti- Dilute in Reduced Serum Medium (or other medium without serum) and mix gently. (b) Before use, TM 2000 with gentle mixing, then dilute the appropriate amount in 50 μl Opti- (c) After 5 minutes of incubation, the diluted DNA was mixed with the diluted Lipofectamine TM(d) Add 100 μl of complex to each well containing cells and medium and gently mix by rocking the plate back and forth. (e) Culture the cells at 37°C in a CO2 incubator for 18 to 48 hours before testing for transgene expression. The medium can be changed after 4 to 6 hours.

[0708] FACS sorting of fluorescent protein-expressing cells

[0709] 48 hours after plasmid / RNA delivery, cells were collected using a flow cytometer and sorted for fluorescent protein expression (e.g., mCherry) to enrich for multiple cells expressing fluorescent protein / editing agent expression as previously described (Chiang et al., SciRep, 2016, 6: 24356). This enrichment step allows bypassing antibiotic selection and only collecting cells that transiently express the fluorescent protein, Cas9, and the sgRNA. These cells can be further tested for editing of the target gene through HR events and effective silencing of the target gene (i.e., GFP).

[0710] Bombardment and plant regeneration

[0711] Arabidopsis root preparation:

[0712] Chlorine-sterilized Arabidopsis thaliana (cv. Col-0) seeds were sown on MS minus sucrose plates, vernalized for 3 days in the dark at 4°C, and then germinated vertically under constant light at 25°C. After 2 weeks, roots were cut into 1 cm segments and placed on Callus Induction Media (CIM: 1 / 2 MS (containing B5 vitamins), 2% glucose, pH 5.7, 0.8% agar, 2 mg / l IAA, 0.5 mg / l 2,4-D, 0.05 mg / l kinetin) plates. After 6 days of incubation at 25°C in the dark, the root segments were transferred to filter paper discs and placed on CIMM plates (1 / 2 MS (without vitamins), 2% glucose, 0.4 M mannitol, pH 5.7 and 0.8% agar) for 4 to 6 hours in preparation for bombardment.

[0713] bombardment

[0714] Multiple plasmid constructs were introduced into the root tissue via PDS-1000 / He particle delivery (Bio-Rad; PDS-1000 / He system #1652257), a procedure that required several preparative steps as outlined below.

[0715] Gold reserve preparation

[0716] 40 mg of 0.6 μm gold (Bio-Rad; Cat: 1652262) was mixed with 1 ml of 100% ethanol, pulse centrifuged to pellet, and the ethanol removed. This washing procedure was repeated two additional times.

[0717] After washing, the pellet was resuspended in 1 ml of sterile distilled water and dispensed into 1.5 ml tubes (50 μl aliquot working volume).

[0718] Magnetic bead preparation

[0719] In short, do the following:

[0720] A single tube had enough gold to bombard two trays of Arabidopsis roots (two shots per tray), so each tube was divided between four (1,100 psi) Biolistic Rupture disks (Bio-Rad; Cat: 1652329).

[0721] To maintain sample consistency and minimize overall preparation work when bombardment requires multiple plates of the same sample, tubes are combined and the volumes of DNA and CaCl2 / spermidine mixture are adjusted accordingly.

[0722] The following protocol summarizes the process for preparing one test tube of gold and should be adjusted depending on the number of test tubes of gold used.

[0723] All subsequent processes were performed in an Eppendorf thermomixer at 4°C.

[0724] Multiple plasmid DNA samples were prepared, with each tube containing 11 μg of DNA added at a concentration of 1000 ng / μl.

[0725] (1) Add 493 μl of ddH2O to 1 aliquot (7 μl) of spermidine (Sigma-Aldrich; S0266) to a final concentration of 0.1 M. Add 1250 μl of 2.5 M CaCl2 to the spermidine mixture, vortex, and place on ice.

[0726] (2) A test tube of gold prepared in advance was placed in the thermomixer and rotated at a speed of 1400 rpm.

[0727] (3) Add 11 μl of DNA to the tube, vortex and place back on the rotating thermomixer.

[0728] (4) To bind DNA / gold particles, 70 μl of spermidine-CaCl 2 mixture was added to each tube (in the thermomixer).

[0729] (5) Vortex the tubes vigorously for 15 to 30 seconds and place on ice for about 70 to 80 seconds.

[0730] (6) The mixture was centrifuged at 7000 rpm for 1 minute, and the supernatant was removed and placed on ice.

[0731] (7) Add 500 μl of 100% ethanol to each tube and resuspend the pellet by pipetting and vortexing.

[0732] (8) Centrifuge the multiple test tubes at 7000 rpm for 1 minute.

[0733] (9) The supernatant was removed, and the pellet was resuspended in 50 μl of 100% ethanol and stored on ice.

[0734] Macrocarrier preparation

[0735] The following operations are performed in a laminar flow cabinet:

[0736] (1) Sterilize and dry multiple macrocarriers (Bio-Rad; 1652335), multiple stopping screens (Bio-Rad; 1652336), and multiple macrocarrier disk racks.

[0737] (2) Laying the plurality of macro carriers flat into the plurality of macro carrier disk racks.

[0738] (3) Vortex the multiple DNA-coated gold mixtures and dispense (5 μl) onto the center of each gene gun rupture disk.

[0739] Allow the ethanol to evaporate.

[0740] PDS-1000 (Helium Particle Delivery System)

[0741] In short, do the following:

[0742] Adjust the helium tank's regulator to an incoming pressure of at least 1300 psi. Create a vacuum by pressing the vac / vent / hold switch and holding the ignition switch for 3 seconds. This ensures that the helium is vented into the system.

[0743] Multiple 1100 psi rupture disks were placed in isopropyl alcohol and mixed to remove static electricity.

[0744] (1) Place a rupture disk into the disk retaining cap.

[0745] (2) Construct a microcarrier launch assembly (with a stop screen and a gold-containing microcarrier).

[0746] (3) Place a Petri dish containing Arabidopsis root callus at a position 6 cm below the launch assembly.

[0747] (4) Set the vacuum pressure to 27 inches of mercury and open the helium valve (approximately 1100 psi).

[0748] (5) Release the vacuum; remove the microcarrier launch assembly and the rupture disk fixing cover.

[0749] (6) Bombard the same tissue (i.e., bombard each plate twice).

[0750] (7) The bombarded roots were then placed on CIM plates in the dark at 25°C for another 24 hours.

[0751] co-bombardment

[0752] When bombarding multiple combinations of multiple GEiGS plasmids, 5 μg (1000 ng / μl) of the sgRNA plasmid was mixed with 8.5 μg (1000 ng / μl) of the exchange plasmid, and 11 μl of this mixture was added to the sample. If more GEiGS plasmids were bombarded simultaneously, the concentration ratio of the multiple sgRNA plasmids to the multiple exchange plasmids used was 1:1.7, and 11 μg (1000 ng / μl) of this mixture was added to the sample. If co-bombarding with multiple plasmids unrelated to the GEiGS exchange, they were mixed in equal proportions and 11 μg (1000 ng / μl) of the mixture was added to each sample.

[0753] Plant regeneration

[0754] For shoot regeneration, a modified protocol from Valvekens et al. (Valvekens, D. et al., Proc Natl Acad Sci, USA, 1988, 85(15): 5536-5540) was used. The bombarded roots were placed on Shoot Induction Media (SIM) plates containing 1 / 2 MS (with B5 vitamins), 2% glucose, pH 5.7, 0.8% agar, 5 mg / l 2iP, and 0.15 mg / l IAA. The plates were left in a cycle of 16 hours of light at 25°C and 8 hours of darkness at 23°C. After 10 days, the plates were transferred to MS plates (containing 3% sucrose and 0.8% agar) for 1 week and then transferred to fresh, similar plates. Once the plants were regenerated, they were excised from the roots and placed on MS plates (containing 3% sucrose and 0.8% agar) until analysis.

[0755] Phenotypic analysis

[0756] As described above, for example, by observing the fluorescence and cell morphology or other phenotypes, such as growth rate / inhibition and / or apoptosis (depending on the target gene, such as resistance of Nutlin3 in the case of TP53 silencing).

[0757] Antiviral assay

[0758] The assay is based on the cytopathic effect (CPE) commonly used to determine the potency of purified interferon stocks. In the CPE assay, antiviral activity is measured based on its ability to inhibit virus-induced cytopathic effects, as measured by crystal violet live cell staining (as previously described by Rubinstein et al. (J Virol., 1981, 10:755-758)).

[0759] VSV forms multiple discrete microscopic plaques in a fixed culture of the WISH amnion cell line. Microplaque formation is rapid, reproducible, and easily quantified, occurs at temperatures ranging from 33 to 40°C, and does not require semi-solid coverage.

[0760] Allyl alcohol selection

[0761] In order to select multiple plants containing allyl alcohol, 10 days after bombardment, multiple roots were placed on SIM medium. Multiple roots were immersed in 30mM allyl alcohol (Sigma-Aldrich, USA) for 2 hours. Then the multiple roots were washed 3 times with MS medium and placed on multiple MS plates (containing 3% sucrose, 0.8% agar). The regeneration process was carried out as previously described.

[0762] Genotyping

[0763] Multiple plant tissue samples were processed and multiple amplicons were amplified according to the manufacturer's recommendations. The MyTaq Plant-PCR Kit (BioLine BIO 25056) was used for shorter internal amplifications, while the Phire Plant Direct PCR Kit (Thermo Scientific; F-130WH) was used for longer external amplifications. The multiple oligonucleotides used for these amplifications are detailed in Table 2 above. Different modifications in the miRNA loci were determined by the different enzyme digestion patterns of the multiple amplicons, as shown below:

[0764] For the modification of miR-390, the internal amplicon was 978 base pairs long, while for the external amplicon, it was 2629 base pairs long. To identify swap 7, NlaIII digestion yielded a 636 base pair fragment, while in the wt form, it was sheared into 420 and 216 base pairs long fragments. To identify swap 8, Hpy188I digestion yielded 293 and 339 base pair fragments, while in the wt form, this site was absent and a 632 base pair fragment was obtained. To identify swaps 11 and 12, BccI digestion yielded a 662 base pair fragment, while in the wt form, it was sheared into 147 and 417 base pairs long fragments.

[0765] For the miR-173 modification, the internal amplicon was 574 base pairs long, while for the nested external amplicon, it was 466 base pairs long. To identify crossover 3, digestion with BslI yielded fragments of 217 and 249 base pairs in the external amplicon and 317 and 149 base pairs in the internal amplicon. In the wt form, this site is absent and yields a 466-base-pair fragment in the external amplicon and a 574-base-pair fragment in the internal reaction. To identify crossover 4, digestion with BtsαI yielded fragments of 212 and 254 base pairs in the external amplicon and 212 and 362 base pairs in the internal amplicon. In the wt form, this site is absent and yields a 466-base-pair fragment in the external amplicon and a 574-base-pair fragment in the internal reaction. To identify crossover 9, digestion with NlaIII yielded fragments of 317 and 149 base pairs in the outer amplicon and 317 and 244 base pairs in the inner amplicon. In the wt form, this site is absent and yields a 466-base-pair fragment in the outer amplicon and a 561-base-pair fragment in the inner reaction. To identify crossover 10, digestion with NlaIII yielded fragments of 375 and 91 base pairs in the outer amplicon and 375 and 186 base pairs in the inner amplicon. In the wt form, this site is absent and yields a 466-base-pair fragment in the outer amplicon and a 561-base-pair fragment in the inner reaction.

[0766] DNA and RNA isolation

[0767] Multiple plant samples were collected into liquid nitrogen and stored at -80°C until processing. Tissue grinding was performed in multiple test tubes placed in dry ice using a plastic tissue grinder pestle (Axygen, USA). DNA and total RNA were isolated from the ground tissue using an RNA / DNA purification kit (cat.48700; Norgen Biotek Corp., Canada) according to the manufacturer's instructions. In the case of a low 260 / 230 ratio (<1.6) of the RNA fraction, the isolated RNA was precipitated overnight at -20°C with 1 μl of glycogen (cat.10814010; Invitrogen, USA) 10% V / V sodium acetate, 3M pH 5.5 (cat.AM9740, Invitrogen, USA) and 3 volumes of ethanol. The solution was centrifuged at maximum speed for 30 minutes at 4°C. The cells were then washed twice with 70% ethanol, air-dried for 15 minutes, and resuspended in nuclease-free water (cat. 10977035; Invitrogen, USA).

[0768] Reverse transcription (RT) and quantitative real-time PCR (qRT-PCR)

[0769] According to the manufacturer's manual (AMPD1; Sigma-Aldrich, USA), 1 μg of isolated total RNA was treated with DNase I. The sample was reverse transcribed according to the instruction manual of the High-Capacity cDNA Reverse Transcription Kit (cat. 4368814; Applied Biosystems, USA).

[0770] For gene expression, the cells were expressed in a CFX96 Touch TM Real-time PCR detection system (BioRad, USA) and Green JumpStart TM Taq ReadyMix TM Quantitative real-time PCR (qRT-PCR) analysis was performed on a Sigma-Aldrich (S4438, USA) and analyzed using the Bio-Rad CFX manager program (version 3.1). For analysis of AtADH1 (AT1G77120), the following primer set was used: forward GTTGAGAGTGTTGGAGAAGGAG (SEQ ID NO: 237) and reverse CTCGGTGTTGATCCTGAGAAG (SEQ ID NO: 238); for analysis of AtPDS3 (AT4G14210), the following primer set was used: forward GTACTGCTGGTCCTTTGCAG (SEQ ID NO: 239) and reverse AGGAGCACTACGGAAGGATG (SEQ ID NO: 240); for the endogenous calibration gene, the 18S ribosomal RNA gene (NC_037304) was used - forward ACACCCTGGGAATTGGTTT (SEQ ID NO: 241) and reverse GTATGCGCCAATAAGACCAC (SEQ ID NO: 242).

[0771] Example 1A

[0772] Genome Editing-Induced Gene Silencing (GEiGS) Platform

[0773] MicroRNA (miRNA) MicroRNAs (miRNAs) are small endogenous non-coding RNAs (ncRNAs) of 20 to 24 nucleotides in length that are derived from long self-complementary precursors. Mature miRNAs regulate gene expression in two ways: (i) by inhibiting translation or (ii) by degrading the coding mRNA through complete or near-complete complementarity with the target mRNA. In animals, pioneering studies of miRNAs have shown that only the seed region (the sequence at positions 2 to 8 at the 5' end) is critical for target recognition. The seed sequence is fully paired with its responsive element, primarily in the 30 untranslated regions (UTRs) of the target mRNA. Alterations in the biogenesis of miRNAs, miRNA expression levels, and miRNA regulatory networks can affect important biological pathways, such as cell differentiation and apoptosis, and have been detected in various human diseases and syndromes, particularly in cancer.

[0774] All tumors show the specific characteristics of miRNA changes in expression. For this reason, the miRNA expression profile of tumors can represent the definition of diagnosis, prognosis, patient stratification, risk groups and the effective and useful biomarkers for monitoring of therapeutic response. Equally relevant is the emerging role of miRNA in viral infection. Literature data show that the miRNA mechanism between virus and host cell interferes with each other. For example, a virus may damage the miRNA pathway of the host cell by interacting with a specific protein, may synthesize its own miRNA to modify the cell environment or regulate its own mRNA, or utilize the miRNA of the cell to its advantage. However, the miRNA of the host cell may also target viral mRNA. In many cases, solving this two-way interference (bidirectional interference) is beneficial to the virus, thereby can escape immune response and complete the replication cycle.

[0775] Therefore, the inventors are using multiple endogenous ncRNA sequences (e.g., miRNAs) redesigned by GEiGS to obtain silencing function (through homologous recombination (HR)) to specifically silence any RNA of interest. In order to replace the selected multiple sequences, HR uses longer stretches of sequence homology (located on both sides of the DSB site) to repair DNA damage, and is therefore considered to be an accurate mechanism for DSB repair (due to the need for higher sequence homology between the damaged and intact donor strands of DNA (i.e., the inserted siRNA sequence)). If the DNA template used for repair is identical to the original DNA sequence at the DSB, or it can introduce very specific mutations into the damaged DNA (e.g., exchange genes), then this process is considered to be error-free.

[0776] Example 1B

[0777] Genome editing-induced gene silencing (GEiGS)

[0778] In order to design multiple GEiGS oligonucleotides, multiple template non-coding RNA molecules (multiple precursors) need to be processed and multiple small silencing RNA molecules (multiple mature bodies (mature)) are derived. The present inventors have characterized multiple endonuclease substrates (dicer substrate) RNAs (i.e., multiple cellular RNAs bound by Dicer) that produce multiple small RNAs (i.e., multiple small RNAs bound by Argonaut 2 and Argonaut 3) that silence conjugates in humans and C. elegans, as previously described by Rybak-Wolf, A. et al. (Cell, 2014, 159: 1153 to 1167). Crossing the two data sets (endonuclease (dicer) binds multiple RNAs and Ago2, and Ago3 binds multiple small RNAs) allows the generation of a list of multiple non-coding RNAs that are multiple precursors ( Figure 10 and Figures 11A to 11E Two sources of precursors and their corresponding mature sequences were used to generate multiple GEiGS oligonucleotides. For multiple miRNAs, multiple sequences were obtained from the miRBase database (Kozomara, A. and Griffiths-Jones, S., Nucleic Acids Res, 2014, 42: D68-D73). Other types of precursors (including multiple tRNAs, multiple snRNAs, and multiple repeat sequences of various types) were obtained from a recent publication describing Dicer- and AGO-bound multiple RNAs (Rybak-Wolf, A. et al., Cell, 2014, 159: 1153-1167).

[0779] Multiple silencing targets were selected in a variety of host organisms. Multiple siRNAs against these targets were designed using the siRNArules software (Holen, T., RNA, 2006, 12: 1620-1625). Each of these siRNA molecules was used to replace the multiple mature sequences present in each precursor, thereby generating multiple "naive" GEiGS oligonucleotides. The structures of these naive sequences were adjusted to be as close as possible to the structure of the wild-type precursor using the ViennaRNA Package v2.6 (Lorenz, R. et al., ViennaRNA Package 2.0, Algorithms for Molecular Biology, 2011, 6: 26). Multiple examples of successful and unsuccessful structural maintenance can be found in the table below. Figures 12A to 12D After adjusting the structure, the number of sequences and secondary structure changes between the wild-type oligonucleotide and the modified oligonucleotide are calculated. These calculations are crucial for identifying multiple potentially functional GEiGS oligonucleotides that require minimal sequence changes relative to the wild-type ( Figures 12A to 12D ).

[0780] Multiple CRISPR / cas9 small guide RNAs (sgRNAs) targeting the multiple wild-type precursors were generated using the CasOT software (Xiao, A. et al., Bioinformatics, 2014, 30: 1180-1182). Multiple sgRNAs were selected, wherein the modification used to generate the GEiGS oligonucleotides affects the PAM region of the sgRNA, rendering it ineffective for the modified oligonucleotides.

[0781] Example 2

[0782] GEiGS with “endogenous” transgenes

[0783] A quick and reliable way to check the efficiency of GEiGS is to silence a transgene that will serve as an endogenous gene and is also a marker gene, such as GFP (green fluorescent protein). There are few methods to assess the effectiveness of GFP silencing in multiple cells, and the inventors are using FACS analysis, RT-qPCR, and microscopy to assess the effectiveness of GFP silencing in multiple cells.

[0784] GFP silencing is well characterized, and there are many available short interfering RNA sequences (siRNAs) that can effectively trigger GFP silencing. Therefore, to perform gene exchange, the inventors are using 21mer siRNA molecules designed to silence GFP. Additionally or alternatively, the inventors are using multiple published algorithms to predict which siRNA will effectively initiate gene silencing for a given gene (e.g., GFP). Because the predictions of these algorithms are not 100%, the inventors only use sequences that are the results of at least two different algorithms.

[0785] In order to use multiple siRNA sequences that will silence the GFP gene, the inventors are using the CRISPR / Cas9 system to exchange them with a known endogenous miRNA gene sequence. There are many databases of characterized miRNAs, and the inventors are selecting several known human miRNAs with different expression profiles (e.g., low constitutive expression, high expression, stress-induced, etc.). In order to exchange the endogenous miRNA sequence with siRNA, the inventors are using the HR method.

[0786] like Figure 2 As shown in , the present inventors considered two options using HR: (1) using a donor ssDNA oligonucleotide sequence of approximately 200 to 500 bases containing the exchange siRNA sequence in the middle, or (2) using multiple plasmids expressing 1Kb to 4Kb, which, except for 2 x 21bp of the miRNA and the *miRNA changed to the siRNA for GFP (500 to 2000bp upstream and downstream of the siRNA), the insert fragment is almost 100% identical to the surrounding miRNA in the genome. The transfection contains several constructs: CRISPR:Cas9 / RFP sensor for tracking and enriching multiple positively transformed cells, and multiple gRNAs guide the Cas9 to generate a DSB, which is repaired by HR depending on the insertion vector / oligonucleotide.

[0787] The insertion vector contains two consecutive regions of homology surrounding the targeted locus, which are replaced (e.g., miRNA) and modified to carry the mutation of interest (i.e., siRNA). If a plasmid is used, the targeting construct is used as a template for homologous recombination, culminating in the replacement of the miRNA with the selected siRNA. After transfection into multiple tissue culture cells, FACS is used to enrich for positive Cas9 / sgRNA transfection events, and multiple cells are scored for GFP silencing under a microscope (e.g., Figure 2). It is expected that the positively edited cells will produce siRNA sequences targeting the GFP gene and thus the GFP expression of the transgene will be silenced compared to control cells.

[0788] To demonstrate proof of concept (POC) for GFP silencing using GEiGS, multiple transgenic human cell lines expressing GFP (including U2OS, RPE1, A549 or Hela cells) are being utilized. Multiple cells are transfected using the GEiGS method and multiple cassettes to exchange multiple endogenous non-coding RNAs (e.g., miRNAs) and convert them into a non-coding RNA that is processed into multiple siRNAs targeting GFP to initiate the RNA silencing mechanism for GFP. Figures 3A to 3B As shown in , knockdown of GFP gene expression levels in multiple human cells resulted in reduced GFP expression in multiple cells expressing siGFP (i.e., multiple cells in which GFP was silenced) compared to multiple control cells ( Figure 3A ).

[0789] Example 3

[0790] GEiGS expressing exogenous transgene (GFP) in tissue culture cells

[0791] In addition to the previous example of GFP silencing (Example 2 above), another way to demonstrate the efficiency of GEiGS is to silence a marker gene (such as GFP) in a transient GFP transfection assay. Figure 4 As shown in, GEiGS is used to process multiple human cells so that the silencing specificity of endogenous miRNA is redirected by the expression of multiple small siRNA molecules targeting the GFP gene (as described in Example 2 above). Untreated multiple control group cells and multiple GEiGS-GFP cells (i.e., expressing siGFP) are then transfected with a plasmid expressing two markers (sensors) GFP+RFP (red fluorescent protein), respectively. The multiple cells that only express RFP but do not express GFP in the GEiGS process are the results of siGFP expression leading to GFP gene silencing. DNA is extracted from these cells (red, but lacking GFP expression) and the correct genome editing event is checked. In addition, the multiple cells can analyze the loss of GFP expression, for example, by GFP fluorescence detection, or q-PCR, HPLC.

[0792] Example 4

[0793] TP53- or HPRT-expressing GEiGS inhibited Nutlin3-induced or 6TG-induced cell death / growth inhibition in U2OS and RPE1 or mouse embryonic stem (mES) cells

[0794] To demonstrate proof-of-concept (POC) GEiGS in multiple human cells, the inventors are investigating U2OS, RPE1, or mouse embryonic stem cells. U2OS are fast-growing and easily and efficiently transfected cells. These cells are derived from osteosarcoma, a bone cancer. RPE1 are epithelial cells derived from normal retina (i.e., not from a diseased or pathological culture) and have normal and active TP53, just like mES cells.

[0795] TP53 is a tumor suppressor protein that directly or indirectly induces apoptotic cell death in response to oncogenic stress. The consequences of DNA damage depend on the cell type and the severity of the damage. Mild DNA damage can be repaired with or without cell cycle arrest. More severe, irreparable DNA damage can lead to the emergence of cells harboring multiple mutations or to the induction of senescence or cell death programs. Although it has been argued for many years that DNA damage kills multiple cells through apoptosis or necrosis, recent technological and methodological advances have helped to reveal that such damage can also activate death through autophagy or mitotic catastrophe, which may subsequently lead to apoptosis or necrosis. The molecular basis underlying this decision-making process is currently the subject of intensive investigation.

[0796] Anyone interested in cancer research is now well aware of TP53 and its relevance to nearly every aspect of tumor biology. TP53 is undoubtedly one of the most extensively studied genes and proteins. Early studies demonstrated that transactivation-defective mutants of p53 can induce apoptosis, suggesting a transcription-independent role for p53 in apoptosis. DNA damage leads to mitochondrial translocation of TP53. TP53 binds to the Bcl-2 family protein Bcl-xL to influence cytochrome c release. TP53 directly activates the proapoptotic Bcl-2 protein Bax in the absence of other proteins, increasing mitochondrial permeability and contributing to the apoptotic program. TP53 can simultaneously release proapoptotic multidomain proteins and BH3-only proteins, which are sequestered by Bcl-xL. In addition, TP53 can directly mediate the mechanism of mitochondrial apoptosis by promoting Bax oligomerization and binding to Bcl-xL instead of Bax. The TP53-Bcl-xL interaction releases Bax, and the released Bax forms multiple oligomers in the mitochondrial membrane, leading to cytochrome c release and apoptosis (the proline-rich domain of TP53 (aa 62-91 in mice) is required for this effect) (Jerry et al., Science, 2004, 303(5660):1010-4). TP53 also acts as a transcription factor that promotes the expression of multiple pro-apoptotic genes (e.g., BAX, PUMA, and NOXA).

[0797] like Figure 5 As shown in, the inventors are modifying multiple RPE1 cells to express siRNA for TP53, and these cells show the inhibition of cell death when exposed to Nutlin3 or chemotherapy (for example, Camptothecin (CPT), etoposide (etoposide), Olaparib (olaparib) etc.). One of the multiple assays that the inventors are utilizing is the crystal violet assay, in which the staining of multiple cells can compare cell number (density) and morphology, which are different between healthy and dying cells. Multiple cell clones resistant to cell death are verified to be able to perform correct genome editing and express relevant TP53 siRNA. In addition, the multiple cells can analyze the loss of TP53 expression, for example, by GFP fluorescence detection or q-PCR, HPLC.

[0798] Tioguanine, also known as thioguanine or 6-thioguanine (6-TG), is a drug commonly used to treat acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), and chronic myeloid leukemia (CML). Tioguanine is an antimetabolite, a purine analog of guanine, that acts by damaging DNA and RNA. 6-Thioguanine is a naturally occurring monothio analog of the purine base guanine. 6-thioguanine is converted into 6-thioguanosine monophosphate (TGMP) by hypoxanthine-guanine phosphoribosyltransferase (HGPRTase / HPRT). High concentrations of TGMP may accumulate in cells through inosine monophosphate dehydrogenase (IMP dehydrogenase) and hinder the synthesis of guanine nucleotides. TGMP is converted into thioguanosine diphosphate (TGDP) and thioguanosine triphosphate (TGTP) by phosphorylation. Deoxyribosyl analogs are simultaneously formed by ribonucleotide reductase. TGMP, TGDP, and TGTP are collectively referred to as 6-thioguanine nucleotides (6-TGN). 6-TGN is cytotoxic to cells by: (1) incorporation into DNA during the cell's synthesis phase (S phase); and (2) by inhibiting the GTP-binding protein (G protein) Rac1, which regulates the Rac / Vav pathway. Another effect may come from the incorporation of 6-thioguanine into RNA. This creates a modified RNA chain that cannot be read by the ribosome.

[0799] In short, loss or reduction of HPRT gene expression renders the plurality of cells resistant to 6TG. Therefore, the present inventors are modifying HPRT gene expression by expressing siRNA against HPRT and analyzing downregulation of HPRT by resistance to 6TG.

[0800] Example 5

[0801] GEiGS of pro-apoptotic genes (BAX, PUMA, NOXA) inhibit chemotherapy-induced cell death in human cancer cells

[0802] In this experiment, the inventors used multiple U2OS cells. To generate cells resistant to chemotherapeutic agents (e.g., CPT, etoposide, olaparib, etc.), the inventors first used siRNAs that could target apoptosis genes (e.g., BAX, PUMA, and NOXA, which are known as pro-apoptotic genes).

[0803] like Figure 6 As shown in , the present inventors are using GEiGS to process multiple U2OS cells to express siRNA targeting multiple apoptosis genes. It is expected that multiple modified cells expressing siRNA are resistant to chemotherapy-induced cell death (e.g., CPT, etoposide, olaparib, etc.). After transfection with multiple GEiGS boxes+RFP sensors, multiple transfected cells are enriched with FACS, and multiple cells are exposed to chemotherapeutics. In the control group, all cells are sensitive and die or enter senescence (using Dapi staining for easy detection under a microscope, a few cells have large nuclei). It is expected that multiple clones with resistance to cell death and / or senescence will positively express edited siRNA, and are confirmed to have correct genome editing modification and expression of related siRNA. In addition, the multiple cells can analyze the loss of expression of multiple pro-apoptotic genes (BAX, PUMA and NOXA), for example, by GFP fluorescence detection or q-PCR, HPLC.

[0804] Example 6

[0805] Immunizing human cells with GEiGS to fight viral infections

[0806] To demonstrate that GEiGS is a reliable human immunization method capable of knocking down exogenous pathogenic genes, the inventors provide an example of viral gene silencing. Lentiviral systems are highly effective at delivering genetic material to entire model organisms and nearly all mammalian cells (including non-dividing, non-growing cells), as well as to difficult-to-transfect cell types (including neurons, primary cells, and stem cells). Lentiviral transduction efficiency approaches 100%, depending on the multiplicity of infection (MOI), making it an ideal expression vector system.

[0807] Multiple control group cells infected with lentivirus expressing GFP showed GFP expression under the microscope (such as Figure 7A plurality of GEiGS-GFP cells engineered to express siRNA targeting the GFP gene (as shown in Example 2 above) are expected to show reduced GFP levels (as shown in Example 3). Figure 7 Generating multiple GEiGS cells with no or low GFP gene expression after infection with viral-GFP (e.g., Lenti-GFP) would demonstrate that exogenous gene silencing has been achieved and that GEiGS is an effective method for immunizing multiple human cells against RNA from invasive infections (e.g., viruses).

[0808] There are few simple options for evaluating the effectiveness of silencing the GFP gene in these cells, and the inventors are using FACS analysis, RT-qPCR, microscopy, and / or immunoblotting. Therefore, to perform gene exchange, the inventors designed 21mer siRNA molecules (as described in Example 2 above). The inventors are using a public algorithm to predict which siRNA will effectively initiate gene silencing for a given gene (as described in Example 2 above).

[0809] Example 7

[0810] Immunization of human cells with viral infection by silencing an exogenous viral gene (cell viability assay)

[0811] To demonstrate that GEiGS is a reliable human immunotherapy method capable of knocking down multiple exogenous genes, in addition to the example using lentivirus expressing GFP (Example 6 above), the present inventors are using wild-type RNA virus infection and scoring for cell survival. The present inventors provide an example of vesicular stomatitis virus (VSV) gene silencing.

[0812] VSV is an RNA virus of the Rhabdoviridae family that can infect a wide variety of cell types and is therefore a common laboratory virus used to study the properties of Rhabdoviridae viruses and investigate viral evolution. VSV is an arbovirus whose replication occurs in the cytoplasm. The VSV genome is a single molecule of negative-sense RNA, 11,161 nucleotides in length, encoding five major proteins: G protein (G), large protein (L), phosphoprotein, matrix protein (M), and nucleoprotein. In healthy human cells, the virus is unable to reproduce (possibly due to the interferon response), but in many cancer cells (which have a reduced interferon response), VSV can grow and, therefore, lyse the cancer cells. As described above in the "General Materials and Experimental Procedures" section, a functional antiviral assay based on the cytopathic effect (CPE) was used to determine cell survival. This method allows for the assessment and comparison of cell survival and viability. By staining the cells, one can compare cell number, density, and morphology, which differ between healthy and dying cells.

[0813] To identify effective siRNAs targeting multiple VSV genes, a preliminary experiment was conducted to transfect different siRNAs targeting multiple viral genes. siRNAs that inhibit VSV-induced cell death were used with GEiGS to program human WISH cells to express these siRNAs. Compared to GEiGS cells, which are expected to be resistant to viral infection, control cells infected with VSV exhibited a cytopathic effect (measured by crystal violet).

[0814] Example 8

[0815] GEiGS expressing the pro-apoptotic FAS gene attenuates 5-FU-induced apoptosis in HCT116 cells

[0816] Pedro et al. (Pedro et al., Biochimica et Biophysica Acta, 2007, 1772:40-47) have previously demonstrated that silencing of FAS expression by RNA interference attenuates 5-FU-induced apoptosis in HCT116 human colorectal cancer cells expressing wild-type p53.

[0817] Multiple HCT116 cells were treated with GEiGS to express siRNA targeting the FAS gene. HCT116 control group and GEiGS positive cells (expressing FAS siRNA) were treated with 5-FU (e.g., 1 to 8 μM) (e.g., 8 to 48 hours). Cell viability was assessed by XTT and Trypan Blue dye exclusion method. Apoptosis was assessed by changes in nuclear morphology and caspase 3 activity. 5-FU has cytotoxicity in multiple HCT116 cells, but when siRNA is used to inhibit Fas, it is expected that 5-FU-mediated nuclear fragmentation and caspase 3 activity will be significantly reduced.

[0818] Example 9

[0819] Generation of plants with modified endogenous miRNAs to target different genes

[0820] Minimal modifications (in their recognition sequence) in the genomic locus of a miRNA (which matures into a miRNA) can lead to a new system for regulating multiple new genes in a non-transgenic manner. Therefore, an Agrobacterium-free transient expression method was used to introduce these modifications by bombarding multiple Arabidopsis roots and further analyzing their regeneration. The inventors have chosen to target two genes in Arabidopsis plants, PDS3 and ADH1.

[0821] Carotenoids play an important role in numerous physiological processes in various plants, and silencing the phytoene desaturase gene (PDS3), which encodes one of the key enzymes in the carotenoid biosynthesis pathway, produces an albino / bleached phenotype. Consequently, plants with reduced PDS3 expression exhibit reduced chlorophyll levels, up to complete albinism and dwarfism.

[0822] Alcohol dehydrogenase (ADH1) comprises a group of dehydrogenases that catalyze the interconversion of various alcohols into various aldehydes or ketones while simultaneously reducing NAD+ or NADP+. The primary metabolic function of this enzyme is the breakdown of alcoholic toxicants within various tissues. Plants with reduced ADH1 expression exhibit increased tolerance to allyl alcohol. Thus, plants with reduced ADH1 expression are resistant to the toxic effects of allyl alcohol, and their regeneration is therefore selective for allyl alcohol.

[0823] Two mature miRNAs were selected for modification, namely miR-173 and miR-390, which have previously been shown to be expressed throughout plant development (Zielezinski A et al., BMC Plant Biology, 2015, 15: 144). In order to introduce the modifications, a two-component system was used. First, using the CRISPR / CAS9 system, a shear was generated in the miR-173 and miR-390 loci by designing multiple specific guide RNAs (Table 2 above) to promote homologous DNA repair (HDR) in the sites. Secondly, a donor sequence (with the desired modification of the miRNA sequence) was introduced as a template for the HDR to target the newly assigned multiple genes (Table 2 above). In addition, because the secondary structure of the primary transcript (pri-miRNA) of the miRNA is important for the correct biogenesis and activity of the mature miRNA, further modifications were introduced into the complementary strand in the pri-miRNA and analyzed in mFOLD (www(dot)unafold(dot)rna(dot)Albany(dot)edu) for structural protection (data not shown). In total, two guides were designed for each miRNA locus, and two different donor sequences (modified miRNA sequences) were designed for each gene (Table 2).

[0824] Example 10

[0825] Bombardment and plant regeneration

[0826] Multiple GEiGS constructs were bombarded into multiple pre-prepared roots (as discussed in detail in the Materials and Experimental Procedures section above) and regenerated. Multiple plants were screened by the bleaching phenotype of multiple PDS3 transformants and the survival rate of multiple ADH1 transformants under allyl alcohol treatment. To verify the exchange compared to no exchange (i.e., retaining wild type), these plants were then screened by insertion of multiple specific primers spanning the modified region, followed by restriction enzyme digestion ( Figure 13 ).

[0827] Example 11

[0828] Genotypic validation of phenotypic selection

[0829] As described above, a proof-of-concept (POC) of the gene editing system was established using the well-known phenotypic traits, phytoene dehydrogenase (PDS3) and alcohol dehydrogenase (ADH1) as multiple targets.

[0830] As mentioned above, multiple plants that ADH1 expression reduces show increased tolerance to allyl alcohol. Therefore, in the culture medium containing 30mM allyl alcohol, regenerate the plant through bombardment (modified miRNA is with targeting ADH1), and compare it with the regeneration rate of control group plant. Compared with 51 control group plants on allyl alcohol culture medium, there are 118 plants that GEiGS#3+SWAP11 allyl alcohol are selected to survive (data not shown). In selected GEiGS#3+SWAP11, there are 5 demonstrations comprising the donor (data not shown). In the plant processed by the multiple donors, regenerating a large amount of plants may also be due to the transient expression in the bombardment process.

[0831] Therefore, the bleaching phenotype ( Figure 13 ) and allyl alcohol selection ( Figure 14 ) for PDS3 and ADH1 selection, providing an ideal method for genotyping and selection of transformed plants.

[0832] The 4 kb exchange region was evaluated primarily by differentiation of specific amplicons from multiple internal primers and the original wild-type insert by restriction endonuclease digestion of the variant.

[0833] ADH1( Figure 14 ) shows that when compared to restrictive and non-restrictive donor plasmids, allyl alcohol selected plants have a comparative genotype with the expected restriction pattern of the donor. PDS3 ( Figure 13 ) shows a comparison of the phenotypes of multiple bombardment samples with and without donors and their respective differential restriction enzyme digestion patterns when compared to restrictive and non-restrictive donor plasmids. These results provide a clear correlation between the PDS3 albino / bleached phenotype and the expected restriction pattern. External PCR was then performed, combining specific internal and external primers within the exchange region (outside and specific to the genomic region) to perform the exchange (data not shown). To assess the presence of heterozygous, homozygous, or donor exchanges, further verification of the exchange was obtained by Sanger sequencing of the multiple PCR amplicons (data not shown).

[0834] Example 12

[0835] Modified miRNAs reduce the expression of their novel target genes

[0836] To verify the potential of the modified miRNAs in the GEiGS system to downregulate the expression of their newly designated targets, gene expression analysis was performed using qRT-PCR (quantitative real-time PCR). RNA was extracted and reverse transcribed from the positively identified regenerated plants and compared to regenerated plants that were processed in parallel but without the introduction of the relevant modification constructs. In the case where miR-173 was modified to target PDS3 (GEiGS#4+SWAP4), an average decrease of 83% ( Figure 15 Similar gene expression changes were observed in plants modified with miR-390 to target ADH1 (GEiGS#3+SWAP11), accounting for 82% of the levels in control plants ( Figure 16 Taken together, these results demonstrate the multiple gene editing approach of modifying multiple endogenous miRNAs to successfully target multiple novel genes and reduce their expression by replacing the target recognition sequences in the miRNA transcripts in the endogenous loci.

[0837] Although the present invention has been described in conjunction with specific embodiments thereof, it will be apparent that many substitutions, modifications and variations will be apparent to those skilled in the art. It is therefore intended to encompass all such substitutions, modifications and variations that fall within the spirit and broad scope of the appended claims.

[0838] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Claims

1. A method for modifying a gene encoding or being processed into a non-coding RNA molecule that does not have RNA silencing activity in a eukaryotic cell, provided that the eukaryotic cell is not a plant cell, characterized in that: The method includes: introducing a DNA editing agent into the eukaryotic cell, the DNA editing agent conferring a silencing specificity of the non-coding RNA molecule against a target RNA of interest, thereby modifying the gene encoding or being processed into the non-coding RNA molecule.

2. A method for modifying a gene encoding or being processed into an RNA silencing molecule directed against a target RNA in a eukaryotic cell, provided that the eukaryotic cell is not a plant cell, characterized in that: The method includes: introducing a DNA editing agent into the eukaryotic cell, the DNA editing agent redirecting a silencing specificity of the RNA silencing molecule against a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.

3. The method according to claim 1, characterized in that: The gene encoding or being processed into the non-coding RNA molecule is endogenous to the eukaryotic cell.

4. The method according to claim 2, wherein: The gene encoding the RNA silencing molecule is endogenous to the eukaryotic cell.

5. The method according to any one of claims 1 or 3, characterized in that: The modification of the gene encoding or being processed into the non-coding RNA molecule includes: conferring at least 45% complementarity of the non-coding RNA molecule against the target RNA of interest.

6. The method according to any one of claims 2 or 4, characterized in that: The modification of the gene encoding the RNA silencing molecule includes: conferring at least 45% complementarity of the RNA silencing molecule against the second target RNA.

7. The method according to any one of claims 1, 3 or 5, characterized in that: The silencing specificity of the non-coding RNA molecule is determined by measuring an RNA or protein level of the target RNA of interest.

8. The method according to any one of claims 2, 4 or 6, characterized in that: The silencing specificity of the RNA silencing molecule is determined by measuring an RNA or protein level of the second target RNA.

9. The method according to any one of claims 1 to 8, characterized in that: The silencing specificity of the non-coding RNA molecule or the RNA silencing molecule is determined phenotypically.

10. The method according to claim 9, characterized in that: The determination phenotypically is achieved by determining at least one phenotype selected from the group consisting of a cell size, a growth rate / inhibition, a cell shape, a cell membrane integrity, a tumor size, a tumor shape, a pigmentation of an organism, an infection parameter, and an inflammation parameter.

11. The method according to any one of claims 1 to 10, characterized in that: The silencing specificity of the non-coding RNA molecule or the RNA silencing molecule is determined genotypically.

12. The method according to claim 11, characterized in that: A phenotype is determined before a genotype.

13. The method according to claim 11, wherein: A genotype is determined before a phenotype.

14. The method according to any one of claims 1 to 13, characterized in that: The non-coding RNA molecule or the RNA silencing molecule is processed from a precursor.

15. The method according to any one of claims 1 to 14, characterized in that: The non-coding RNA molecule or the RNA silencing molecule is an RNA interference (RNAi) molecule.

16. The method according to claim 15, characterized in that: The RNAi molecule is selected from the group consisting of a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a Piwi-interacting RNA (piRNA), and a trans-acting siRNA (tasiRNA).

17. The method according to any one of claims 1, 3, 5, 7 or 9 to 14, characterized in that: The non-coding RNA molecule is selected from the group consisting of a small nuclear RNA (snRNA), a small nucleolar RNA (snoRNA), a long non-coding RNA (lncRNA), a ribosomal RNA (rRNA), a transfer RNA (tRNA), a repeat-derived RNA, and a transposable element RNA.

18. The method according to claim 15 or 16, characterized in that: The RNAi molecule is modified to preserve the structural originality and to be recognized by multiple cellular RNAi factors.

19. The method according to any one of claims 1 to 18, characterized in that: The modification of the gene is affected by a modification selected from the group consisting of a deletion, an insertion, a point mutation, and combinations thereof.

20. The method according to claim 19, wherein: The modification is in a stem region of the non-coding RNA molecule or the RNA silencing molecule.

21. The method according to claim 19, wherein: The modification is in a loop region of the non-coding RNA molecule or the RNA silencing molecule.

22. The method according to claim 19, characterized in that: The modification is in an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

23. The method according to claim 19, wherein: The modification is in a stem region and a loop region of the non-coding RNA molecule or the RNA silencing molecule.

24. The method according to claim 19, wherein: The modification is in a stem region, a loop region, and an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.

25. The method according to any one of claims 19 to 24, characterized in that: The modification includes a modification of up to 200 nucleotides.

26. The method according to any one of claims 19 to 25, characterized in that: The method further includes introducing a plurality of donor oligonucleotides into the eukaryotic cell.

27. The method according to any one of claims 1 to 26, characterized in that: The DNA editing agent includes at least one gRNA operably linked to a plant-expressible promoter.

28. The method according to any one of claims 1 to 27, characterized in that: The DNA editing agent does not include an endonuclease.

29. The method according to any one of claims 1 to 27, characterized in that: The DNA editing agent includes an endonuclease.

30. The method according to any one of claims 1 to 29, characterized in that: The DNA editing agent includes a DNA editing system selected from the group consisting of a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), and CRISPR.

31. The method according to any one of claims 29 or 30, characterized in that: The endonuclease includes Cas9.

32. The method according to any one of claims 1 to 31, characterized in that: The DNA editing agent is administered to the cell in the form of DNA, RNA, or RNP.

33. The method according to any one of claims 1 to 32, characterized in that: The DNA editing agent is linked to a reporter for monitoring expression in a eukaryotic cell.

34. The method according to claim 33, characterized in that: The reporter is a fluorescent protein.

35. The method according to any one of claims 1 to 34, characterized in that: The target RNA of interest or the second target RNA is endogenous to the eukaryotic cell.

36. The method according to claim 35, characterized in that: The target RNA of interest or the second target RNA is associated with a cancer.

37. The method according to any one of claims 1 to 34, characterized in that: The target RNA of interest or the second target RNA is exogenous to the eukaryotic cell.

38. The method according to claim 37, characterized in that: The target RNA of interest or the second target RNA is associated with an infectious disease.

39. The method according to any one of claims 1 to 38, characterized in that: The eukaryotic cell is obtained from a eukaryote selected from the group consisting of a mammal, an insect, a nematode, a bird, a reptile, a fish, a crustacean, a fungus, and an alga.

40. The method according to any one of claims 1 to 39, characterized in that: The eukaryotic cell is a mammalian cell.

41. The method according to claim 40, characterized in that: The mammalian cell includes a human cell.

42. The method according to any one of claims 1 to 41, characterized in that: The eukaryotic cell is a totipotent stem cell.

43. A method for treating an infectious disease in a subject in need thereof, characterized in that: The method includes modifying a gene encoding or being processed into a non-coding RNA molecule or encoding or being processed into an RNA silencing molecule according to the method of any one of claims 1 to 42, wherein the target RNA of interest is associated with the onset or development of the infectious disease, thereby treating the infectious disease in the subject.

44. A method for treating a single-gene recessive genetic disease in a subject in need thereof, characterized in that: The method includes: modifying a gene that encodes or is processed into a non-coding RNA molecule or that encodes or is processed into an RNA silencing molecule according to the method of any one of claims 1 to 42, wherein the target RNA of interest is associated with the monogenic recessive disease, thereby treating the monogenic recessive disease in the subject.

45. A method for treating an autoimmune disease in a subject in need thereof, characterized in that: The method includes: modifying a gene that encodes or is processed into a non-coding RNA molecule or that encodes or is processed into an RNA silencing molecule according to the method of any one of claims 1 to 42, wherein the target RNA of interest is associated with the autoimmune disease, thereby treating the autoimmune disease in the subject.

46. A method for treating a cancerous disease in a subject in need thereof, characterized in that: The method includes: modifying a gene that encodes or is processed into a non-coding RNA molecule or that encodes or is processed into an RNA silencing molecule according to the method of any one of claims 1 to 42, wherein the target RNA of interest is associated with the cancerous disease, thereby treating the cancerous disease in the subject.

47. A method for enhancing the efficacy and / or specificity of a chemotherapeutic agent in a subject in need thereof, characterized in that: The method includes: modifying a gene that encodes or is processed into a non-coding RNA molecule or that encodes or is processed into an RNA silencing molecule according to the method of any one of claims 1 to 42, wherein the target RNA of interest is associated with enhancing the efficacy and / or specificity of a chemotherapeutic agent, thereby enhancing the efficacy and / or specificity of a chemotherapeutic agent in the subject.

48. A method for inducing apoptosis in a subject in need thereof, characterized in that: The method includes: modifying a gene that encodes or is processed into a non-coding RNA molecule or that encodes or is processed into an RNA silencing molecule according to the method of any one of claims 1 to 42, wherein the target RNA of interest is associated with apoptosis, thereby inducing apoptosis in the cells of the subject.

49. A method for producing a eukaryotic non-human organism, provided that the organism is not a plant, characterized in that: At least some of the cells of the organism include a modified gene that encodes or is processed into a non-coding RNA molecule, the non-coding RNA molecule including a silencing specificity for a target RNA of interest, the method including modifying a gene according to the method of any one of claims 1 to 42, thereby producing the eukaryotic non-human organism.

Images