Improving productivity and activity of rhizomucor miehei lipase

Abstract

Lipase variants of rhizomucor miehei lipase are described herein. The lipase has a peptide sequence having at least 80% sequence similarity to SEQ ID NO: 2 and having an F94 mutation of SEQ ID NO: 2. Also described is a method of increasing the expression level of a rhizomucor miehei lipase having SEQ ID NO: 2 by introducing an F94 mutation of SEQ ID NO: 2 to produce a rhizomucor miehei lipase variant comprising a peptide sequence having at least 80% similarity to SEQ ID NO: 2 and having an F94 mutation of SEQ ID NO: 2; and the rhizomucor miehei lipase variant is expressed in a protein production system. The lipases described herein are useful for hydrolyzing an ester by providing a mixture containing a lipase variant and an ester; and a reaction product is formed under proper reaction conditions.

Description

Technical Field

[0001] The present invention relates to variants of Rhizomucor miehei lipase (RML). Background Art

[0002] Triacylglycerol lipase (EC 3.1.1.3) is a hydrolase that can cleave carboxylic ester bonds to release carboxylic acids. Under conditions of low water content, the reverse reaction is favored, enabling lipase to carry out esterification and transesterification reactions according to the substrates present. Lipases have such a wide range of functions that they can be used in numerous industrial applications.

[0003] For industrial enzymes, their expression levels in production hosts are one of the key considerations in production. Previous attempts to increase expression levels have included optimization of signal peptides, propeptides, gene copy numbers, and co-expression of protein folding chaperones (Huang et al., 2020; Huang et al., 2014; Xu et al., 2023). Summary of the Invention

[0005] In a first aspect, there is provided a lipase comprising a peptide sequence having at least 80% sequence similarity to SEQ ID NO:2 and having the F94 mutation of SEQ ID NO:2. In an embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 85%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 90%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 95%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 96%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 97%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 98%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 99%. Sequence similarity can be determined by comparing the number of common amino acid residues in the RML variant with SEQ ID NO:2. Thus, the lipase contains a peptide sequence having the F94 mutation and possibly other additional components.

[0006] Preferably, the F94 mutation is the substitution of phenylalanine with a hydrophobic amino acid. In an embodiment, the F94 mutation is selected from the group consisting of: F94A, F94I, F94L, F94M, F94V, F94W, and F94Y. Preferably, the F94 mutation is selected from the group consisting of: F94A, F94M, F94W, and F94Y. More preferably, the F94 mutation is F94W or F94Y.

[0007] In an embodiment, the peptide sequence consists essentially of sequences selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9. In an embodiment, the peptide sequence consists of sequences selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9.

[0008] In a second aspect, there is provided a method for increasing the expression level of Rhizomucor miehei lipase having SEQ ID NO:2, the method comprising: introducing an F94 mutation of SEQ ID NO:2 to produce a Rhizomucor miehei lipase variant comprising a peptide sequence having at least 80% similarity to SEQ ID NO:2 and having the F94 mutation of SEQ ID NO:2; and expressing the Rhizomucor miehei lipase variant in a protein production system.

[0009] Preferably, the F94 mutation is the substitution of phenylalanine with a hydrophobic amino acid. In an embodiment, the F94 mutation is selected from the group consisting of: F94A, F94I, F94L, F94M, F94V, F94W, and F94Y. Preferably, the F94 mutation is F94W or F94Y.

[0010] In an embodiment, the protein production system comprises one of the following expression hosts: Pichia pastoris, Escherichia coli, Aspergillus niger, Aspergillus oryzae. Preferably, the protein production system comprises Pichia pastoris or Aspergillus oryzae.

[0011] In a third aspect, there is provided a method for hydrolyzing an ester, the method comprising providing a mixture comprising an ester and the lipase according to the first aspect; and forming a reaction product under suitable reaction conditions.

[0012] Preferably, the ester comprises a carboxylic acid component having 4 or more carbons. Brief Description of the Drawings

[0014] Figure 1 Shows the concentrations of RML WT and variants expressed in Pichia pastoris using shake flasks. All values were determined using the Bradford assay and are expressed as mean ± SD (n = 2). Detailed Description

[0015] In the description herein, numerous specific details are set forth in order to provide a thorough understanding of various exemplary embodiments of the present invention. However, those skilled in the art will understand that embodiments of the present invention may be practiced without some or all of these specific details. Embodiments described in the context of one of the methods or apparatuses are similarly effective for other methods or apparatuses. Similarly, embodiments described in the context of a method are similarly effective for an apparatus, and vice versa.

[0016] Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs.

[0017] As used herein, the articles “a,” “an,” and “the” used in reference to a feature or element include references to one or more of the feature or element. As used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items. As used herein, terms such as “first,” “second,” and “third,” etc. are used merely as labels and are not intended to impose a numerical requirement on their objects.

[0018] In the case of a disclosed combination, each sub-combination of the elements of the combination is also specifically disclosed and within the scope of the present invention. Conversely, when different elements or groups of elements are disclosed, their combinations are also disclosed. When any element of an invention is disclosed as having a plurality of alternatives, instances of the invention in which each alternative is individually excluded or excluded in any combination with other alternatives are hereby disclosed; more than one element of the invention may have such exclusions, and all combinations of elements having such exclusions are disclosed herein.

[0019] When a numerical range is recited, it is to be understood that each intermediate integer value and each fraction thereof between the upper and lower limits recited in the range are also specifically disclosed, as well as each sub-range therebetween. The upper and lower limits of any range may independently be included in or excluded from the range, and ranges in which neither, either, or both of the limits are included are also included in the present invention. When the values being discussed are self-limiting, such as when a component may be present at a concentration of 0 to 100%, or when the pH of an aqueous solution may be in the range of 1 to 14, those self-limiting values are specifically disclosed. When a numerical value is explicitly recited, it is to be understood that values that are approximately the same amount or quantity as the recited value are also within the scope of the present invention, as are ranges based thereon.

[0020] Although each of these terms has a different meaning, the terms "comprising / including", "consisting of", and "consisting essentially of" may be used interchangeably throughout this application. The term "having" has the same meaning as "comprising / including" and may be substituted with the term "consisting of" or "consisting essentially of". The term "consisting essentially of" means that certain other components may be present, namely those that do not substantially affect the basic characteristics of the lipase or lipase variant in the context herein.

[0021] The terms "polypeptide" and "protein" are used interchangeably herein and refer to a polymer of amino acids, regardless of the length of the polymer; thus, peptides, oligopeptides, and proteins are all included within the definition of polypeptide. Similarly, the term does not specify or exclude chemical or post-expression modifications of the polypeptides of the invention, although such chemical or post-expression modifications of the polypeptides may be included or excluded in the specific embodiments. Thus, for example, covalently linked polypeptide modifications including glycosyl groups, acetyl groups, phosphate groups, lipid groups, etc. are expressly encompassed within the term polypeptide. In addition, polypeptides having such modifications may be designated as individual species to be included in or excluded from the invention. Natural or other chemical modifications (such as those listed in the examples above) may occur at any position in the polypeptide, including the peptide backbone, amino acid side chains, and amino or carboxyl termini. It should be understood that the same type of modification may be present at several sites in a given polypeptide to the same or different extents. In addition, a given polypeptide may contain many types of modifications. Polypeptides may be branched, for example, due to ubiquitination, and they may be branched or unbranched cyclic. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate or esters, formylation, γ-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, polyethylene glycolylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, tRNA-mediated amino acid addition for proteins, such as arginylation and ubiquitination. The definition also includes polypeptides containing one or more amino acid analogs (including, for example, non-naturally occurring amino acids, amino acids that are only naturally occurring in unrelated biological systems, modified amino acids from mammalian systems, etc.), polypeptides having substituted bonds, and other modifications known in the art, including both naturally occurring and non-naturally occurring.

[0022] The terms "sequence similarity", "percent sequence identity", and "percent homology" are used interchangeably herein to refer to a comparison between polynucleotides and polypeptides and are determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (which does not contain additions or deletions) to achieve optimal alignment of the two sequences. The percentage may be calculated as follows: the number of matching positions is generated by determining the number of positions at which the same nucleic acid base or amino acid residue occurs in the two sequences, the number of matching positions is divided by the total number of positions in the comparison window, and the result obtained is multiplied by 100 to yield the percent sequence identity. Any of a variety of different sequence comparison algorithms and programs known in the art are used to evaluate identity. Such algorithms and programs include, but are not limited to, TBLASTN, BLASTP, FASTA, TFASTA, CLUSTAL W, FASTDB [Pearson and Lipman, (1988), Proc. Natl. Acad. Sci. USA 85(8):2444-2448; Altschul et al., (1990), J. Mol. Biol. 215(3):403-410; Thompson et al (1994), Nucleic Acids Res. 22(2):4673-4680; Higgins et al., (1996), Meth. Enzymol. 266:383-402; Altschul et al., (1993), Nature Genetics 3:266-272; Brutlag et al (1990) Comp. App. Biosci. 6:237-24], the disclosures of which are incorporated by reference in their entirety.

[0023] It has been found that introducing mutations in the lid hinge of the RML mature peptide (SEQ ID NO:2) increases the production level of RML variants as compared to the wild type. The expression level of Rhizomucor miehei lipase (RML) variants with an amino acid mutation at position 94 to other hydrophobic residues was increased by 48% - 161% in Pichia pastoris. In addition, mutations of Trp or Tyr also significantly increased the specific activity of RML. When tested on eight different substrates, the specific activities of the variants RML F94W and RML F94Y were found to have increased by 39.6% - 185.6%. The simultaneous increase in the productivity and activity of RML F94W and RML F94Y makes these two variants particularly useful for industrial production and applications. The F94 mutation, especially the F94W and F94Y mutations, can be combined with other mutations to provide RML variants with improved expression levels, substrate selectivity, and / or lipase activity.

[0024] The RML variant contains a peptide sequence having at least 80% sequence similarity to the basal peptide sequence of SEQ ID NO:2 and having the F94 mutation of SEQ ID NO:2. Thus, the F94 mutation is one of the differences between the RML variant and wild-type RML. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 85%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 90%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 95%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 96%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 97%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 98%. In another embodiment, the similarity of the peptide sequence compared to SEQ ID NO:2 is at least 99%. The sequence similarity can be determined by comparing the number of common amino acid residues in the RML variant to SEQ ID NO:2.

[0025] In an embodiment, the peptide sequence consists essentially of the F94 mutation described herein. In an embodiment, the peptide sequence consists of the F94 mutation described herein. Thus, the F94 mutation is an essential mutation in the RML variant, but the RML variant may still contain other components.

[0026] In an embodiment, the RML variant consists essentially of the F94 mutation described herein. In an embodiment, the RML variant consists of the F94 mutation described herein.

[0027] RML Mutation and Expression

[0028] To generate RML variants, substitutions were introduced into wild-type (WT) RML using site-directed mutagenesis. Site-directed mutagenesis was performed to introduce a mutation at amino acid residue 94 of the RML mature peptide (SEQ ID NO:2) located on the lid hinge. A total of seven variants were generated, including mutations (or substitutions) with other possible hydrophobic natural amino acids (alanine (A), valine (V), isoleucine (I), leucine (L), methionine (M), tyrosine (Y), and tryptophan (W)). Other hydrophobic amino acids could also be used to substitute phenylalanine (F) at residue 94 of SEQ ID NO:2. The variants include F94A (SEQ ID NO:3), F94I (SEQ ID NO:4), F94L (SEQ ID NO:5), F94M (SEQ ID NO:6), F94V (SEQ ID NO:7), F94W (SEQ ID NO:8), and F94Y (SEQ ID NO:9). Thus, each of the lipase variants described herein has a sequence based on (or original) the SEQ ID NO:2 sequence, wherein F94 in SEQ ID NO:2 has at least one amino acid mutation or substitution. The expressed lipase variants may contain only the mature peptide.

[0029] The mutations listed above are for the RML mature peptide (SEQ ID NO:2). For the listed mutations, the first letter represents the single-letter abbreviation of the original amino acid residue in SEQ ID NO:2, the number represents the amino acid position in SEQ ID NO:2, and the second letter represents the single-letter abbreviation of the new amino acid residue.

[0030] The codon-optimized sequence of WT RML (SEQ ID No: 1) was synthesized based on its amino acid sequence (UniProtKB - P19515) for optimal expression in Pichia pastoris (also known as Komagataella pastoris). The propeptide region was modified by adding a linker sequence between two copies of the propeptide to improve expression in Pichia pastoris. The mutant RML was amplified from the pAO815W - WT RML construct using the AOX promoter (SEQ ID NO: 10) and terminator primers (SEQ ID NO: 11) paired with primers designed to replace the target site amino acid sequence (Table 1), and cloned into the HindIII and EcoRI sites of the pAO815W vector. All variants used the same forward primer RMLF94X_F' (SEQ ID NO: 12) and different specific reverse primers (SEQ ID NO: 13 to 19). The pAO815W vector was modified from pAO815 by removing the HindIII site within the 5'-AOX promoter region and reintroducing it downstream of the 5'-AOX promoter. As previously described, the resulting pAO815W - RML variant constructs were transformed into Pichia pastoris GS115 by electroporation (Wu et al., 2004). To express the RML variants, cells from a single colony were cultured overnight at 30 °C in a shake flask containing buffered glycerol complex medium (BMGY; 1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4 x 10 -5 % biotin and 1% glycerol). The next day, the cell pellet was resuspended in an equal volume of buffered methanol complex medium (BMMY; 1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4 x 10 -5 % biotin and 0.5% methanol), and the OD 600 was normalized to the slowest growing culture, i.e., between 8 - 9 per ml of BMMY. Over the next three days, methanol (0.5% v / v) was added to the culture twice a day. On day 6, the medium containing the secreted RML was collected and clarified by centrifugation. The protein concentration was determined by the Bradford assay using bovine serum albumin as a reference. The RML variants can be expressed in other host expression systems including Escherichia coli, Aspergillus niger, and Aspergillus oryzae. In an embodiment, the host expression system for the RML variants can be Pichia pastoris or Aspergillus oryzae.

[0031] Table 1: List of primers used

[0032]

[0033]

[0034] When cultured in shake flasks, the expression levels of all variants in Pichia pastoris were shown to be significantly increased. The average protein concentration of these variants ranged from 18.1 mg / ml for the lowest, RML F94I, to 31.9 mg / ml for the highest, RML F94A, while the protein concentration of RML wild type (WT) was 12.2 mg / ml( Figure 1 ). This means that the production levels of the variants were increased by 48% - 161% compared to RML WT( Figure 1 ). It is speculated that by substituting different hydrophobic residues at position 94, its interaction with the Pro209 cross - substrate binding pocket can be improved, and the stability of the lid in its closed state can be enhanced. In addition, in the crystal structure published by Moroz et al. (2019), residue 94 interacts with Tyr 77 on the pro - peptide. Therefore, this substitution of different hydrophobic residues may also alter the interaction between the pro - peptide and the mature protein, thus promoting the improvement of folding. With the improvement of structural stability and folding efficiency, this may reduce endoplasmic reticulum stress during protein synthesis, thereby increasing productivity. The increase in the expression level of the modified RML lipase is an unexpected technical advantage and effect compared to native RML and other modified RML variants.

[0035] Lipase activity assay

[0036] Subsequently, lipase activity assays were performed on these variants. Different substrates, including olive oil, castor oil, glyceryl tri - caprylate, glyceryl tri - butyrate, C12 methyl ester, C10 methyl ester, C8 methyl ester, and vinyl laurate emulsion, were used as substrates to determine the specific activities of different RML variants. The oil was homogenized with 4% (w / v) polyvinyl alcohol 30000 solution in a 1:3 ratio using a blade homogenizer to prepare the emulsion, which was used immediately. For the assay, first, 2 ml of the oil emulsion, 1.5 ml of distilled water, and 1 ml of 0.2 M Tris - HCl buffer (pH 8.0) were added to a 100 ml flat - bottom flask and incubated with shaking at 150 rpm in a 40 °C water bath. After 5 minutes, 500 μl of the enzyme solution (10 μg / ml) was added to the reaction mixture and incubated for another 15 minutes. Then, 5 ml of absolute ethanol was added to terminate the reaction. Using phenolphthalein as an indicator, the amount of free fatty acids released during the reaction was determined by titration with 50 mM NaOH.

[0037] The specific activity (U / mg) of each RML variant was calculated using the following formula:

[0038]

[0039] v: volume of NaOH required to neutralize the reaction mixture (ml)

[0040] v0: Volume of NaOH required to neutralize the blank (ml)

[0041] C: Concentration of NaOH (μmol / ml)

[0042] t: Reaction time (minutes)

[0043] A: Amount of RML added (mg)

[0044] 1 U corresponds to the release of 1 μmol of free fatty acid from the substrate hydrolysis within 1 minute.

[0045] The study found that the specific activities of RML F94W and RML F94Y were continuously improved in all eight tested substrates (i.e., olive oil, castor oil, glyceryl trioctanoate, glyceryl tributyrate, C12 methyl ester, C10 methyl ester, C8 methyl ester, and vinyl laurate). For RML F94W, the hydrolysis activity increased by 58.7% to 185.6%, with the smallest increase in glyceryl trioctanoate and the largest increase in vinyl laurate (Table 2). For RML F94Y, the smallest increase in activity was 39.6% for olive oil, and the largest increase in activity was 101.0% for C8 methyl ester (Table 2).

[0046] Regarding other variants, the mutation either maintained the hydrolysis activity or had a negative impact on the hydrolysis activity (Table 2). The results of RML F94A and RML F94M variants on different substrates were diverse, with increases and decreases in activity relative to RML WT. It is believed that since residue 94 is located in the region of the substrate-binding pocket, it may contribute to the interaction with the substrate and thus affect the enzyme's activity and substrate preference.

[0047] Table 2: Specific activities of RML WT and eight RML F94 variants against eight different substrates measured using the lipase activity assay. These values are expressed as relative percentages of the RML WT activity.

[0048]

[0049]

[0050] Thus, the RML F94 variant can be used to react with an ester under suitable conditions to form a reaction product. The ester can have a carboxylic acid component of 4 carbons or more and can be substituted or unsubstituted. Non-limiting examples of esters include fatty acid esters, vegetable oils, monoglycerides, diglycerides, and triglycerides. Non-limiting examples of vegetable oils include saturated and unsaturated oils, olive oil, castor oil, palm oil, coconut oil, canola oil, soybean oil, sunflower oil, rapeseed oil, peanut oil, and cottonseed oil. Many other vegetable oils are also known and can be used. The alcohol component of the ester can be a short-chain alcohol or glycerol, and other alcohols can also be used.

[0051] The RML F94 variants described herein show improved production levels of RML variant enzyme synthesis and result in increased cost efficiency. Some variants also exhibit improved activity against certain substrates.

[0052] sequence

[0053] Gene sequence of the mature peptide of RML WT (SEQ ID NO:1): TCCATCGACGGAGGTATTAGAGCCGCTACTTCTCAGGAAATCAACGAACTTACTTACTATACAACTTTGTCAGCTAATTCTTACTGTAGAACTGTTATTCCTGGTGCTACTTGGGATTGCATACATTGTGACGCCACTGAAGATTTAAAGATAATTAAAACCTGGTCTACTTTGATTTACGACACTAACGCTATGGTTGCTAGAGGAGATTCCGAGAAGACTATTTATATCGTGTTTAGAGGTTCTTCATCTATTCGTAATTGGATCGCTGATTTGACATTCGTTCCAGTCTCTTACCCTCCAGTTTCTGGTACTAAGGTTCACAAAGGATTTCTTGATTCTTATGGTGAAGTTCAAAACGAGTTGGTTGCTACTGTCTTGGATCAGTTTAAACAATACCCATCTTATAAGGTTGCTGTCACTGGTCACTCTTTGGGAGGTGCTACTGCCTTGCTGTGTGCTTTAGATTTATACCAGAGAGAGGAAGGATTGTCTTCAAGTAACCTATTCTTGTACACTCAAGGTCAGCCTAGAGTTGGAGATCCAGCATTTGCTAATTATGTGGTTTCTACTGGTATTCCATATAGACGTACTGTTAACGAAAGAGACATAGTACCACACTTGCCTCCAGCTGCCTTCGGATTTCTGCATGCCGGTGAAGAGTACTGGATCACAGATAATTCTCCTGAAACCGTTCAAGTGTGTACATCTGATTTAGAGACTTCCGACTGCTCTAACAGTATTGTTCCATTTACTTCAGTTCTTGATCATTTGTCTTATTTTGGAATTAACACCGGTTTGTGTACTTAA

[0054] RML WT mature peptide (SEQ ID NO:2): SIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTFVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCT

[0055] RML F94A variant (SEQ ID NO:3): SIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTAVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCT

[0056] RML F94I variant (SEQ ID NO:4): SIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTIVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCT

[0057] RML F94L variant (SEQ ID NO:5): SIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTLVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCT

[0058] RML F94M variant (SEQ ID NO:6): SIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTMVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCT

[0059] RML F94V variant (SEQ ID NO:7): SIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTVVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCT

[0060] RML F94W variant (SEQ ID NO:8): SIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTWVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCT

[0061] RML F94Y variant (SEQ ID NO:9): SIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTYVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCT

[0062] References

[0063] Holmquist,M.(2000)'αβ-Hydrolase Fold Enzymes Structures, Functions and Mechanisms', Current Protein and Peptide Science, 1(2), pp. 209-235.

[0064] Huang, J., Xia, J., Yang, Z., Guan, F., Cui, D., Guan, G., Jiang, W., and Li, Y. (2014) 'Improved production of a recombinant Rhizomucor miehei lipase expressed in Pichia pastoris and its application for conversion of microalgae oil to biodiesel', Biotechnology for Biofuels, 7(1), p. 111.

[0065] Huang, J., Zhao, Q., Chen, L., Zhang, C., Bu, W., Zhang, X., Zhang, K., and Yang, Z. (2020) 'Improved production of recombinant Rhizomucor miehei lipase by coexpressing protein folding chaperones in Pichia pastoris, which triggered ER stress', Bioengineered, 11(1), pp. 375 - 385.

[0066] Moroz, O.V., Blagova, E., Reiser, V., Saikia, R., Dalal, S., C.I., Bhatia, V.K., Baunsgaard, L., Andersen, B., Svendsen, A., and Wilson, K.S. (2019) 'Novel Inhibitory Function of the Rhizomucor miehei Lipase Propeptide and Three-Dimensional Structures of Its Complexes with the Enzyme', ACS Omega, 4(6), pp. 9964 - 9975.

[0067] Xu, R., Chen, Z., Chen, Y., Wang, X., Zhang, Y., Li, X., and Wang, F. (2023) 'Multiple strategies for high-efficiency expression of Thermomyces lanuginosus lipase in Pichia pastoris and production of biodiesel in solvent-free system', Fuel, 333, p. 126246.

Claims

1. A lipase comprising a peptide sequence having at least 80% sequence similarity with SEQ ID NO:2 and having the F94 mutation of SEQ ID NO:

2.

2. The lipase according to claim 1, wherein the F94 mutation is a substitution of phenylalanine with a hydrophobic amino acid.

3. The lipase according to claim 1, wherein the F94 mutation is selected from the group consisting of: F94A, F94I, F94L, F94M, F94V, F94W and F94Y.

4. The lipase according to claim 1, wherein the F94 mutation is selected from the group consisting of: F94A, F94M, F94W and F94Y.

5. The lipase according to claim 1, wherein the F94 mutation is F94W or F94Y.

6. The lipase according to any one of claims 1 to 5, wherein the peptide sequence consists essentially of a sequence selected from the group consisting of: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:

9.

7. The lipase according to claim 6, wherein the peptide sequence consists of a sequence selected from the group consisting of: SEQ IDNO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:

9.

8. A method for increasing the expression level of Rhizomucor miehei lipase with SEQ ID NO:2, the method comprising: introducing The F94 mutation of SEQ ID NO:2 to produce a Rhizomucor miehei lipase variant, the Rhizomucor miehei lipase variant comprising a peptide sequence having at least 80% similarity with SEQ ID NO:2 and having the F94 mutation of SEQ ID NO:2; and expressing the Rhizomucor miehei lipase variant in a protein production system.

9. The method according to claim 8, wherein the F94 mutation is a substitution of phenylalanine with a hydrophobic amino acid.

10. The method according to claim 8, wherein the F94 mutation is selected from the group consisting of: F94A, F94I, F94L, F94M, F94V, F94W and F94Y.

11. The method according to claim 8, wherein the F94 mutation is F94W or F94Y.

12. The method according to any one of claims 8 to 11, wherein the protein production system comprises one of the following expression hosts: Pichia pastoris, Escherichia coli, Aspergillus niger and Aspergillus oryzae.

13. The method according to claim 12, wherein the protein production system comprises Pichia pastoris or Aspergillus oryzae.

14. A method for hydrolyzing an ester, the method comprising providing a mixture comprising the ester and a lipase according to any one of claims 1 to 7; and forming a reaction product under suitable reaction conditions.

15. The method according to claim 14, wherein the ester comprises a carboxylic acid component having 4 or more carbon atoms.

Images