Bicyclic terpene ester compound, preparation method and application

Abstract

The invention belongs to the technical field of biological medicine, discloses a bicyclic terpenoid ester compound, a preparation method and application, and particularly relates to a bicyclic terpenoid ester compound separation and purification method and alpha-glucosidase inhibitory activity of the bicyclic terpenoid ester compound, and the bicyclic terpenoid ester compound separation and purification method comprises the steps of colletotrichum fasciculatum large-scale fermentation, methanol ultrasonic extraction, vacuum concentration and ethyl acetate extraction. According to the method, the bicyclic terpenoid ester compounds in the colletotrichum fasciatum are separated and purified through the steps of normal phase column chromatography, high performance liquid chromatography separation and purification and the like, and various modern spectrum analysis technologies such as nuclear magnetic resonance spectrum, high resolution mass spectrum, infrared spectrum, ultraviolet-visible spectrum and circular dichroism spectrum are combined, so that the content of the bicyclic terpenoid ester compounds in the colletotrichum fasciatum is improved. The bicyclic terpenoid ester compound is obtained from a colletotrichum fasciculatum solid fermentation product, and the alpha-glucosidase inhibitory activity of the compound is determined. The compound is obtained by being separated from a solid rice fermentation product of a colletotrichum dematium strain, and the colletotrichum dematium strain is separated from the root part of dianthus dematium. The compound has relatively strong inhibitory activity on alpha-glucosidase, has an IC50 value of 16.8 [mu] M, and can be used for preparing hypoglycemic drugs.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a method for separating and purifying bicyclic terpene ester compounds in Colletotrichum fasciculata and an application thereof in preparing hypoglycemic drugs. Background Art

[0002] Diabetes mellitus (DM) has become one of the most prevalent and challenging health problems worldwide. DM is a chronic metabolic disease characterized by insufficient insulin secretion or insulin resistance, caused by environmental and genetic factors. Its primary manifestations are chronic, uncontrolled elevated blood sugar levels, accompanied by a range of complications, such as renal failure, cardiovascular disease, and vision loss. Clinical symptoms include polydipsia, polyuria, weight loss, and fatigue. Based on different pathogenesis and clinical manifestations, it can be divided into four types, the most common of which are type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM). The International Diabetes Federation (IDF) predicts that by 2045, approximately 700 million people worldwide will be affected by diabetes, with type 2 diabetes mellitus (T2DM) accounting for over 90%. Research shows that T2DM is a chronic metabolic disease characterized by impaired carbohydrate metabolism, often manifested as insulin resistance (IR) and hyperglycemia. The treatment of diabetes has long focused on maintaining normal blood sugar levels, but currently, there is no effective medication to cure diabetes.

[0003] Studies have found that α-glucosidase (α-glucosidase, EC.3.1.20) can catalyze the hydrolysis of α-glucosyl groups from the non-reducing end. α-glucosidase is widely present in microorganisms, plants, animals and human tissues. It is a carbohydrate hydrolase that can catalyze the hydrolysis of disaccharides (maltose and sucrose) into monosaccharides (glucose and fructose), and plays a key role in regulating the body's sugar metabolism. By reducing the activity of α-glucosidase, the body's absorption of glucose can be delayed, achieving the effect of lowering postprandial and fasting blood sugar. α-glucosidase inhibitors (AGI) are the first-line drugs for the clinical prevention and treatment of type 2 diabetes. They can be mainly divided into two categories: natural plant sources and chemical synthesis. Commonly used ones include acarbose and voglipose. Acarbose is a non-insulinogenic oral hypoglycemic drug, but it has serious gastrointestinal side effects, such as gastrointestinal flatulence, soft stools and abdominal discomfort. The AGI drugs currently widely used in clinical practice are: (1) Acarbose is a pseudotetrasaccharide produced by bacterial fermentation. It competitively inhibits the digestion and absorption of carbohydrates to lower blood sugar levels; (2) Voglibose is a derivative of N-substituted mycophenolate amine. It reduces the decomposition of disaccharides into monosaccharides and reduces the formation of D-glucose, thereby inhibiting and delaying the absorption of carbohydrates, reducing postprandial hyperglycemia and delaying the occurrence of subsequent diseases; (3) Miglitol is a pseudomonosaccharide derived from 1-deoxynojirimycin. It competitively inhibits digestive enzymes in the small intestine and delays the digestion and absorption of oligosaccharides. However, due to its complex preparation process, high long-term use costs, and multiple side effects, it has been a hot topic for scholars at home and abroad to find low-toxic and highly effective AGIs from natural plants. Therefore, it is of great significance to find natural, safe, highly effective, and low-side-effect α-glucosidase inhibitors. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a bicyclic terpene ester compound from Colletotrichum dematium, a preparation method and application thereof, which has a strong inhibitory effect on α-glucosidase, IC 50 The value was 16.8 μM.

[0005] It should be noted that Dianthus barbatus is a perennial herbaceous plant of the Caryophyllaceae family and the genus Dianthus, and is now mainly used as an ornamental plant. At present, there have been no reports on the secondary metabolites of the symbiotic fungi of this plant. Colletotrichum sp. is considered to be a major plant pathogen worldwide, and it is well known that it can cause plant anthracnose. Although Colletotrichum sp. is a plant pathogenic fungus, studies have found that they can produce rich secondary metabolites, and these compounds exhibit various biological activities and functions in in vitro biological tests, such as cytotoxic sterols, isocoumarins and alkaloid derivatives; ergasterol derivatives, demethylated monocerins and fusarentin 6-methyl ether with antibacterial activity, which exhibit free radical scavenging activity and inhibit the formation of superoxide anion radicals; in addition, a sesquiterpenoid compound, colletotrichine A, exhibits good acetylcholinesterase inhibitory activity, and its IC 50 The value is 28 μg / mL. Therefore, the present invention studies and isolates a bicyclic terpene ester compound from Colletotrichum dematium with good α-glucosidase inhibitory activity.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] The first technical purpose of the present invention is to provide a bicyclic terpene ester compound, the chemical structural formula of which is:

[0008]

[0009] The compound is named: siccanoyl-(2Z,4E)-hexa-2,4-dienoate.

[0010] It should be noted that the physicochemical properties of the bicyclic terpene ester compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate of the present invention are:

[0011] The molecular formula is: C 31 H 44 O5, white powder.

[0012] [α] D 15 =-15.8 (c=0.6, MeOH);

[0013] UV(MeOH):λ max (logε):261(6.71)nm;

[0014] IR(KBr):νmax =3362,2979,2922,1699,1647,1403,1169,1022,993,839cm -1 ;

[0015] HR-ESI-MS: m / z 519.3074[M+Na] + (calcd.for C 31 H 44 O5Na,519.3081).

[0016] 1 H-NMR spectrum and 13 C-NMR spectrum data are shown in Table 1; infrared spectrum is shown in Appendix Figure 13 .

[0017] The second technical purpose of the present invention is to provide a method for preparing the bicyclic terpene ester compound as described above, wherein the bicyclic terpene ester compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate is isolated from the solid fermentation product of Colletotrichum dematium.

[0018] Furthermore, the solid fermentation product of Colletotrichum dematium is obtained by culturing the seed liquid of Colletotrichum dematium on a solid rice culture medium.

[0019] Furthermore, the solid rice culture medium is used to carry out large-scale fermentation culture of Colletotrichum dematium, and the specific steps are as follows:

[0020] S1. Solid rice culture medium preparation: Add 40 g of rice and 60 mL of deionized water to 230 500 mL conical flasks, seal with a breathable membrane, and sterilize in an autoclave (121°C, 30 min). Cool and set aside.

[0021] S2. PDB medium preparation: Add 1.05 g potato dextrose broth and 30 mL deionized water to eight 50 mL Erlenmeyer flasks. Seal the flasks with a breathable membrane and sterilize them in an autoclave (121°C, 30 min). Then, sterilize all the flasks in a clean bench under UV light for 15 min.

[0022] S3. Seed solution preparation: Inoculate the bacterial cake of Colletotrichum dematium into PDB medium, with an inoculation area of ​​about 1cm per bottle. 2The bacterial cake was labeled and cultured in a constant temperature shaker for 5 days (28°C, 120 rpm);

[0023] S4. Under sterile conditions, 400 μL of seed solution was inoculated into each of 230 500 mL conical flasks of solid rice culture medium and statically cultured at a constant temperature of 28°C for 56 days.

[0024] In the above-mentioned method for preparing bicyclic terpene ester compounds, the solid fermentation product of Colletotrichum dematium is ultrasonically extracted three times with an equal volume of methanol, the three extracts are combined, and after reduced pressure concentration, it is extracted five times with an equal volume of ethyl acetate, and the five extracts are combined to obtain an ethyl acetate phase extract;

[0025] The ethyl acetate extract was eluted by silica gel column chromatography with chloroform-acetone (volume ratio, 100:0, 100:1, 50:1, 20:1, 9:1, 5:1) gradient to obtain fractions A to H; among them, fraction F was purified by Sephadex column LH-20 (solvent: methanol) was used for elution to obtain fractions F1 to F6; fraction F3 was eluted by silica gel column chromatography with chloroform-methanol (volume ratio, 60:0, 55:1, 40:1, 35:1, 30:1, 25:1, 15:1, 10:1) gradient elution to obtain fractions F3.1 to F3.5; fraction F3.4 was separated by preparative high performance liquid chromatography using a gradient solvent system of methanol-water (20%-60%, 15 mL / min, detection wavelength set at 210 and 254 nm) to obtain compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate (t R =15.7min,25.9mg).

[0026] The third technical purpose of the present invention is to provide a use of the bicyclic terpene ester compound as described above in the preparation of hypoglycemic drugs.

[0027] The fourth technical purpose of the present invention is to provide a hypoglycemic drug, which contains the bicyclic terpene ester compound described in the present invention.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] 1) The present invention obtains a bicyclic terpene ester compound from Colletotrichum dematium for the first time, and tests the bicyclic terpene ester compound from Colletotrichum dematium for in vitro α-glucosidase inhibition activity. The results show that the bicyclic terpene ester compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate from Colletotrichum dematium has a strong inhibitory effect on α-glucosidase, IC 50 The value was 16.8 μM, which was 118 times that of acarbose (IC 50 =1996.6 μM). Enzyme reaction kinetics showed that the compound is an irreversible inhibitor of α-glucosidase.

[0030] 2) The present invention performed molecular docking to evaluate the potential binding mode of the compound to α-glucosidase. Figure 16 As shown, hydrogen bonds between the 5′-OH group and ILE-290, and between the 20′-carbonyl group and ALA-288 / HIS-287, perfectly position the compound within the hydrophobic active cavity, with a binding energy of -6.852 kcal / mol. Molecular docking results suggest that the mechanism of action of the bicyclic terpene ester siccanoyl-(2Z,4E)-hexa-2,4-dienoate may involve binding to specific residues within the active region of α-glucosidase, thereby effectively recognizing protein-ligand interactions.

[0031] 3) The bicyclic terpene ester compounds of the present invention have strong α-glucosidase inhibitory activity and can be used as hypoglycemic drugs with good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0033] Figure 1 is the structural formula of the bicyclic terpene ester compound of the present invention;

[0034] Figure 2 The key to the bicyclic terpene ester compounds of the present invention is 1 H- 1 H COSY and HMBC correlation diagrams;

[0035] Figure 3is the key NOESY correlation diagram of the bicyclic terpene ester compound of the present invention;

[0036] Figure 4 The experimental ECD and calculated ECD correlation diagram of the bicyclic terpene ester compounds of the present invention are shown in FIG.

[0037] Figure 5 The bicyclic terpene ester compound of the present invention 1 H-NMR spectrum;

[0038] Figure 6 The bicyclic terpene ester compound of the present invention 13 C-NMR spectrum;

[0039] Figure 7 The bicyclic terpene ester compound of the present invention 1 H- 1 H COSY spectrum;

[0040] Figure 8 is the HSQC spectrum of the bicyclic terpene ester compound of the present invention;

[0041] Figure 9 is the HMBC spectrum of the bicyclic terpene ester compound of the present invention;

[0042] Figure 10 is the NOESY spectrum of the bicyclic terpene ester compound of the present invention;

[0043] Figure 11 is the HRESIMS spectrum of the bicyclic terpene ester compound of the present invention;

[0044] Figure 12 is the UV spectrum of the bicyclic terpene ester compound of the present invention;

[0045] Figure 13 is the infrared spectrum of the bicyclic terpene ester compound of the present invention;

[0046] Figure 14 This is a graph showing the inhibitory effect of the bicyclic terpene ester compounds of the present invention on α-glucosidase;

[0047] Figure 15 is a diagram showing the kinetics of the enzymatic reaction of the bicyclic terpene ester compounds of the present invention to α-glucosidase;

[0048] Figure 16 This is a three-dimensional molecular docking model diagram of the bicyclic terpene ester compound of the present invention. DETAILED DESCRIPTION

[0049] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0050] It should be noted that the experimental materials are as follows:

[0051] Culture medium:

[0052] Solid rice medium: 40.00 g rice, 60.00 mL water, pH natural; medium was autoclaved at 121°C for 30 min before use.

[0053] Experimental reagents:

[0054] Methanol, acetone, and chloroform are all industrial-grade reagents and are used after redistillation; ethyl acetate and petroleum ether are analytical-grade reagents; organic solvents such as chromatographic acetonitrile, DMSO, and chromatographic methanol are of analytical or chromatographic grade depending on the actual situation.

[0055] Preparation of thin layer chromatography (TLC) vanillin sulfuric acid color developer: 80 mL of concentrated sulfuric acid was slowly added to 200 g of ice while stirring. Then 5 g of vanillin (vanillin) was placed in 100 mL of anhydrous ethanol and stirred until dissolved. The dissolved vanillin anhydrous ethanol solution was added to ice water.

[0056] Experimental instruments:

[0057] Nuclear magnetic resonance: Agilent DD2400-MR (TMS internal standard); High performance liquid chromatography-high resolution mass spectrometry: ABSciex Triple 4600; polarimeter Rudolph Autopol III MCP5300; high performance liquid chromatographs: Waters 1525, Agilent 1260 and Arc HPLC analytical type; infrared spectrometer: PerkinElmer Frontier (potassium bromide tablet method); ultraviolet spectrometer: Shimadzu UV-2550; circular dichroism spectrometer: Chirascan CD; medium and low pressure liquid chromatograph: Büchi Flash Systems X-10; Microplate Reader: Synergy neo2; Fungal Incubator: BSD-TX345; Rotary Evaporator: Büchi Rotavapor R-100; Circulating Water Multi-Purpose Vacuum Pump: SHB-Ⅲ (Zhengzhou Great Wall Science & Technology Industry & Trade Co., Ltd.); Low-Temperature Coolant Circulating Pump: DLSB-10 / 20 (Zhengzhou Great Wall Science & Technology Industry & Trade Co., Ltd.); Clean Bench: SW-OJ-2F (Suzhou Antai Air Technology Co., Ltd., Sujing Group); Vertical Steam Sterilizer: BKQ-B12011 (Shanghai Boxun Industrial Co., Ltd. Medical Equipment Factory). Liquid chromatography columns: Waters XBridge C18 column (19 mm × 250 mm, 5 μm), Waters XBridge C18 column (10 × 250 mm, 5 μm), XBridge C18 column (4.6 × 250 mm, 5 μm); column chromatography silica gel (100–200 mesh, 200–300 mesh, and 300–400 mesh) and thin-layer chromatography silica gel (silica gel H) were all produced by Qingdao Ocean Chemical Plant; hydroxypropyl dextran gel Sephadex LH-20 was produced by GE Healthcare Life Sciences, and RP-C18 reverse-phase silica gel was produced by YMC.

[0058] Example 1: A bicyclic terpene ester compound from Colletotrichum dematium and a method for its separation and purification

[0059] The bicyclic terpene ester compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate of the present invention is isolated from the solid fermentation product of a strain of Colletotrichum dematium. The strain of Colletotrichum dematium is isolated from the root of Dianthus palpebratus. The strain is identified as Colletotrichum dematium by fungal ITS rDNA strain identification. The ITS sequence is: CCTGCGGAGGGATCATTACTGAGTTACCGCTCTATAACCCTTTGTGAACATACCTAACTGTTGCTTCGGCGGGCAGGGGGTCCCCTCGGGGACGCCCTCCCGGCCACGCCCTTCGCGGGGCGAGGCGCCCGCCGGAGGATACCAAACTCTATTTTAACGACGTTTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACG CAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCT GCTTGGTGTTGGGGCCCTACGGTTGACGTAGGCCCTTAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACTAACGTCTCGCATTGGGATTCGAAGGGACTCTTGCCGTAAAACCCC.

[0060] The preservation and activation culture conditions for Colletotrichum dematium are as follows: The strain is preserved using PDA slant culture medium. To activate the strain, the strain is inoculated onto a PDA plate and incubated at 28°C for 7 days until the plate is covered with mycelium. The PDA plate medium contains 200g of potato, 20g of glucose, and 16g of agar powder per liter. 1. Large-Scale Fermentation of Colletotrichum dematium:

[0061] The strain was fermented on a large scale using solid rice culture medium. The specific steps are as follows:

[0062] S1. Solid rice culture medium preparation: Add 40 g of rice and 60 mL of deionized water to 230 500 mL conical flasks, seal with a breathable membrane, and sterilize in an autoclave (121°C, 30 min). Cool and set aside.

[0063] S2. PDB medium preparation: Add 1.05 g potato dextrose broth and 30 mL deionized water to eight 50 mL Erlenmeyer flasks. Seal the flasks with a breathable membrane and sterilize them in an autoclave (121°C, 30 min). Then, sterilize all the flasks in a clean bench under UV light for 15 min.

[0064] S3. Seed solution preparation: Inoculate the bacterial cake of Colletotrichum dematium into PDB medium, with an inoculation area of ​​about 1cm per bottle. 2 The bacterial cake was labeled and cultured in a constant temperature shaker for 5 days (28°C, 120 rpm);

[0065] S4. Under sterile conditions, 400 μL of seed solution was inoculated into each of 230 500 mL conical flasks of solid rice culture medium and statically cultured at a constant temperature of 28°C for 56 days.

[0066] 2. The specific extraction and separation methods are as follows:

[0067] After large-scale fermentation finishes, in all 500mL Erlenmeyer flasks, add equal-volume methanol, stop fermentation, solid rice culture medium-methanol solution is moved in the 30L plastic bucket, use Buchner funnel suction filtration after using large-scale sonicator ultrasonic extraction 30min, filter residue is transferred back in the plastic bucket and adds methyl alcohol to repeat top step and extract 2 times again, merge whole extracts, extracting solution steams with large-scale rotary evaporator concentrating under reduced pressure until without methyl alcohol, measure and spin out methanol alcohol content, if alcohol content is greater than 80% (v / v), methyl alcohol is reusable, after concentrating, obtains crude extract.The crude extract that is dissolved in water is extracted 5 times with equal-volume ethyl acetate again, gets supernatant and concentrates through rotary evaporation and has obtained ethyl acetate phase extractum. The ethyl acetate extract was eluted by silica gel column chromatography with chloroform-acetone (volume ratio, 100:0, 100:1, 50:1, 20:1, 9:1, 5:1) gradient elution to obtain fractions A to H; among them, fraction F was eluted by Sephadex LH-20 (solvent: methanol) to obtain fractions F1 to F6; fraction F3 was eluted by silica gel column chromatography with chloroform-methanol (volume ratio, 60:0, 55:1, 40:1, 35:1, 30:1, 25:1, 15:1, 10:1) gradient elution to obtain fractions F3.1 to F3.5; fraction F3.4 was separated by preparative high performance liquid chromatography using a gradient solvent system of methanol-water (20%-60%, 15 mL / min) to obtain the compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate (tR =15.7min,25.9mg).

[0068] The chemical structure of the bicyclic terpene ester compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate is as follows:

[0069]

[0070] It should be noted that the bicyclic terpene ester compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate used in the following experiments was prepared in Example 1.

[0071] Example 2: Determination of physical and chemical properties of compounds:

[0072] The physicochemical properties of the bicyclic terpene ester compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate are as follows:

[0073] The molecular formula is: C 31 H 44 O5, white powder.

[0074] [α] D 15 =-15.8 (c=0.6, MeOH);

[0075] UV(MeOH):λ max (logε):261(6.71)nm;

[0076] IR(KBr):ν max =3362,2979,2922,1699,1647,1403,1169,1022,993,839cm -1 ;

[0077] HR-ESI-MS: m / z 519.3074[M+Na] + (calcd.for C 31 H 44 O5Na,519.3081);

[0078] 1 H-NMR (400 MHz, CDCl3) and 13 C-NMR (100 MHz, CDCl3) detailed data are shown in Table 1; NMR and mass spectrometry are shown in Figure 5-11 , infrared spectrum is attached Figure 13 .

[0079] Table 1 Bicyclic terpene ester compounds siccanoyl-(2Z,4E)-hexa-2,4-dienoate 1 H, 13 CNMR data (CDCl3)

[0080]

[0081] Example 3: Test on the inhibitory activity of bicyclic terpene ester compounds from Colletotrichum dematium on α-glucosidase:

[0082] The compounds siccanoyl-(2Z,4E)-hexa-2,4-dienoate and acarbose were dissolved in DMSO solution, with acarbose serving as a positive control. Three parallel wells were used as controls in each group. A sample group containing 20 μL of the compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate, 60 μL of 10 mM PBS (pH = 7), and 20 μL of enzyme stock solution (0.8 units / mL PBS) was incubated at 37°C for 15 minutes. Next, 20 μL of 4-nitrophenyl α-D-glucoside (2.5 mM) was added, and the mixture was incubated at 37°C for 20 minutes. Finally, 80 μL of Na2CO3 (0.2 M) was added to terminate the reaction, and the absorbance was measured at 405 nm using a microplate reader. The α-glucosidase inhibition rate can be calculated according to the following formula:

[0083]

[0084] Among them A C 、A S and A B Represent the absorbance values ​​of the control group, sample group and blank group of the reaction system respectively. The experimental results are expressed as IC 50 The values ​​are expressed as . The Lineweaver-Burk double reciprocal curve was used to study the α-glucosidase inhibition. The compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate was introduced into a 96-well plate at a concentration of 16.8 μM and dissolved in PBS. The sample group contained 20 μL of test compound and 140 μL of potassium phosphate solution. To start the reaction, 20 μL of enzyme stock solution (at concentrations of 0, 0.4, 0.8, 1.2, 1.6 and 2 U / mL in PBS) was added to each well plate. After incubation at 37°C for 15 minutes, 20 μL of 4-nitrophenyl α-D-glucoside dissolved in PBS was added and reacted for 5 minutes. The test was repeated six times for a total of 30 minutes.

[0085] The enzyme inhibitory activity of the bicyclic terpene ester siccanoyl-(2Z,4E)-hexa-2,4-dienoate was analyzed by in vitro bioassay. The compound has a strong inhibitory effect on α-glucosidase, IC 50 The value was 16.8 μM, which was 118 times that of acarbose (IC 50 =1996.6μM)( Figure 14 ).

[0086] The enzyme reaction kinetics showed that the compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate is an irreversible inhibitor of α-glucosidase ( Figure 15 ).

[0087] In addition, the present invention also performed molecular docking to evaluate the potential binding mode of the compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate to α-glucosidase. Figure 16 As shown, hydrogen bonds between the 5′-OH group and ILE-290, and between the 20′-carbonyl group and ALA-288 / HIS-287, perfectly position siccanoyl-(2Z,4E)-hexa-2,4-dienoate in the hydrophobic active cavity, with a binding energy of -6.852 kcal / mol. Molecular docking results suggest that the mechanism of action of siccanoyl-(2Z,4E)-hexa-2,4-dienoate may involve binding to specific residues within the active region of α-glucosidase, thereby effectively identifying protein-ligand interactions.

[0088] In summary, for the treatment of diabetes, the bicyclic terpene ester compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate prepared by the present invention can be developed as a potential lead compound.

[0089] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A bicyclic terpene ester compound, characterized in that: The structural formula of the compound is: The molecular formula of the compound is C 31 H 44 O5, named: siccanoyl-(2Z,4E)-hexa-2,4-dienoate.

2. A method for preparing a bicyclic terpene ester compound according to claim 1, characterized in that: The bicyclic terpene ester compound siccanoyl-(2Z, 4E)-hexa-2, 4-dienoate is isolated from the solid fermentation product of Colletotrichum dematium.

3. The method for preparing the bicyclic terpene ester compound according to claim 2, wherein: The solid fermentation product of Colletotrichum dematium is prepared by culturing the seed liquid of Colletotrichum dematium on a solid rice culture medium.

4. The method for preparing the bicyclic terpene ester compound according to claim 3, wherein The large-scale fermentation culture of Colletotrichum dematium using solid rice culture medium is carried out in the following specific steps: S1, solid rice culture medium preparation: add 40g rice and 60mL deionized water to 230 500mL Erlenmeyer flasks, seal with breathable membrane, sterilize in autoclave, and cool for use; S2. PDB medium preparation: Add 1.05 g potato dextrose broth and 30 mL deionized water to eight 50 mL Erlenmeyer flasks. Seal the flasks with a breathable membrane and sterilize them in an autoclave. Then, place all flasks in a clean bench and sterilize them under UV light for 15 min. S3. Seed solution preparation: Inoculate the bacterial cake of Colletotrichum dematium into PDB medium, with an inoculation area of about 1cm per bottle. 2 The bacterial cake was labeled and cultured in a constant temperature shaker at 28°C and 120 rpm for 5 days; S4. Under sterile conditions, 400 μL of seed solution was inoculated into 230 500 mL conical flasks of solid rice culture medium and statically cultured at a constant temperature of 28°C for 56 days.

5. The method for preparing the bicyclic terpene ester compound according to claim 4, wherein: The solid fermentation product of Colletotrichum dematium was ultrasonically extracted three times with an equal volume of methanol, the three extracts were combined, concentrated under reduced pressure, and then extracted five times with an equal volume of ethyl acetate, and the five extracts were combined to obtain an ethyl acetate phase extract; The ethyl acetate phase extract was eluted by silica gel column chromatography with a chloroform-acetone gradient ratio of 100:0, 100:1, 50:1, 20:1, 9:1, and 5:1 to obtain fractions A to H. Fraction F was eluted by a Sephadex LH-20 dextran gel column using methanol as the solvent to obtain fractions F1 to F6. Fraction F3 was eluted by silica gel column chromatography with a chloroform-methanol gradient ratio of 60:0, 55:1, 40:1, 35:1, 30:1, 25:1, 15:1, and 10:1 to obtain fractions F3.1 to F3.

5. Fraction F3.4 was separated by preparative high performance liquid chromatography using methanol-water with a gradient solvent system to obtain the compound siccanoyl-(2Z,4E)-hexa-2,4-dienoate.

6. Use of the bicyclic terpene ester compound according to claim 1 in the preparation of hypoglycemic drugs.

7. A hypoglycemic drug, characterized in that: The medicine contains the bicyclic terpene ester compound as claimed in claim 1.

Images