Quadruple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit for detecting poultry leg disease virus, primer probe combination and application thereof

By designing a quadruple fluorescent RT-PCR kit and primer-probe combination, the problem of simultaneous and rapid detection of multiple poultry leg disease viruses in existing technologies has been solved. This enables the specific and sensitive detection of multiple viruses in a single reaction, making it suitable for rapid diagnosis and control in the poultry industry.

CN121852618APending Publication Date: 2026-04-14HEXU (ZHENGZHOU) BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610220380.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-24
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate simultaneous detection of multiple avian leg disease viruses, especially avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus, and Marek's disease virus, in a single reaction, and also suffer from cross-reactivity and insufficient sensitivity.

Method used

A quadruple fluorescent RT-PCR kit and primer-probe combination were designed, containing specific primers and fluorescently labeled probes, which can simultaneously detect multiple viruses in a single reaction, distinguish signals through different fluorescent channels, and achieve simultaneous detection of multiple nucleic acids by combining hot-start DNA polymerase and reverse transcription active enzyme.

Benefits of technology

It enables simultaneous, rapid, and specific detection of multiple poultry leg disease viruses, improving detection throughput and efficiency, simplifying the operation process, and enhancing the accuracy and sensitivity of detection. It is suitable for pathogen screening in breeding sites and laboratories.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852618A_ABST
    Figure CN121852618A_ABST
Patent Text Reader

Abstract

The invention provides a quadruple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit for detecting poultry leg disease viruses, a primer probe combination and application of the quadruple fluorescent RT-PCR kit and the primer probe combination, and belongs to the technical field of biological detection services. According to the quadruple fluorescent RT-PCR detection method and the kit provided by the invention, the detection of four common poultry leg disease pathogens can be simultaneously completed in a single reaction, so that the detection flux and efficiency are greatly improved; the method has good specificity and sensitivity, can effectively distinguish mixed infection, is simple and convenient to operate and intuitive in result interpretation, facilitates rapid and accurate pathogen screening and monitoring in a breeding site and a laboratory, and provides reliable technical support for early diagnosis and accurate prevention and control of poultry leg diseases and healthy development of the breeding industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biological detection service technology, and in particular to a quadruple fluorescent RT-PCR kit, primer and probe combination, and their applications for detecting avian leg disease viruses. Background Technology

[0002] Leg diseases in poultry are a common category affecting poultry health and production performance. Clinically, they mainly manifest as leg weakness, lameness, and paralysis. In severe cases, they can lead to stunted growth, increased mortality, and significant economic losses to the poultry industry. The pathogens causing these diseases are complex and diverse, with viral pathogens including avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus, and Marek's disease virus. These viruses can all damage the poultry's motor nervous system or joint tissues, leading to leg dysfunction, and their clinical manifestations are similar, making accurate differentiation difficult based solely on clinical symptoms.

[0003] Currently, laboratory detection methods for the aforementioned viruses mainly include virus isolation and identification, reverse transcription polymerase chain reaction (RT-PCR), and enzyme-linked immunosorbent assay (ELISA). Virus isolation, as the traditional "gold standard," is time-consuming and requires stringent experimental conditions. While conventional RT-PCR is faster, it primarily targets single pathogens and is ill-suited to the prevalence of mixed infections. Serological methods such as ELISA may be limited by cross-reactivity or antibody production time windows, resulting in shortcomings in early diagnosis and virus typing. With the expansion of poultry farming and the increasing rate of mixed pathogen infections, developing a detection technology capable of simultaneously, rapidly, and accurately identifying multiple poultry leg disease viruses has become an urgent need in the field of poultry disease control. Summary of the Invention

[0004] The purpose of this invention is to provide a quadruple fluorescent RT-PCR kit, primer and probe combination, and their application for detecting avian leg disease viruses, which solves the technical problem that existing methods for detecting avian leg disease viruses cannot simultaneously, rapidly, sensitively, and specifically identify avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus, and Marek's disease virus.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides a primer-probe combination for the simultaneous detection of avian leg disease viruses, comprising: Primer ARV-F with the sequence shown in SEQ ID NO.1, primer ARV-R with the sequence shown in SEQ ID NO.2, and probe ARV-P with the sequence shown in SEQ ID NO.3; Primer NDV-F with the sequence shown in SEQ ID NO.4, primer NDV-R with the sequence shown in SEQ ID NO.5, and probe NDV-P with the sequence shown in SEQ ID NO.6; Primer AEV-F with the sequence shown in SEQ ID NO.7, primer AEV-R with the sequence shown in SEQ ID NO.8, and probe AEV-P with the sequence shown in SEQ ID NO.9; Primer MDV-F with the sequence shown in SEQ ID NO.10, primer MDV-R with the sequence shown in SEQ ID NO.11, and probe MDV-P with the sequence shown in SEQ ID NO.12.

[0007] The present invention also provides a quadruple fluorescent RT-PCR kit for detecting avian leg disease viruses, comprising the above-mentioned primer and probe combination.

[0008] Preferably, the 5' end of the ARV-P is labeled with a FAM fluorescent reporter group and the 3' end is labeled with a BHQ1 quencher group.

[0009] Preferably, the NDV-P is labeled with a HEX fluorescent reporter group at its 5' end and a BHQ1 quencher group at its 3' end.

[0010] Preferably, the 5' end of the AEV-P is labeled with a ROX fluorescent reporter group and the 3' end is labeled with a BHQ2 quencher group.

[0011] Preferably, the MDV-P is labeled with a CY5 fluorescent reporter group at its 5' end and a BHQ3 quencher group at its 3' end.

[0012] Preferably, it also contains 2×PCR Buffer, a mixed enzyme with reverse transcription activity and hot-start DNA polymerase activity, and DEPC water.

[0013] The present invention also provides a method for detecting a virus causing leg diseases in poultry, wherein the detection method is applied to poultry. The detection method includes using the above-mentioned quadruple fluorescent RT-PCR kit to perform detection, obtaining detection results, and evaluating whether the virus is present in avian leg disease based on the detection results.

[0014] Preferably, the detection method includes the following steps: S1. Extract nucleic acid from the sample to be tested; S2. Prepare a quadruple fluorescent RT-PCR reaction solution containing all components of the kit, and add the nucleic acid as a template; S3. Perform fluorescent RT-PCR amplification reaction. The reaction procedure includes reacting at 45℃~55℃ for 20~40 minutes, pre-denaturing at 90℃~95℃ for 2~5 minutes, and then performing 40~50 cycles. Each cycle includes holding at 90℃~95℃ for 10~20 seconds and holding at 55℃~65℃ for 20~40 seconds while collecting the fluorescence signal. S4. Determine whether the sample contains avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus and / or Marek's disease virus based on the fluorescence signal; The fluorescence signal described in step S3 is collected in the FAM, HEX, ROX, and CY5 channels; In step S4, the criteria for determining a sample to be positive are that the Ct value of the corresponding detection channel is ≤40 and an S-shaped amplification curve appears.

[0015] The present invention also provides the application of the above-mentioned primer-probe combination or quadruple fluorescent RT-PCR kit in the preparation of products, systems or devices for the detection of avian leg disease viruses.

[0016] The beneficial effects of this invention are: The quadruple fluorescent RT-PCR detection method and kit provided by this invention can simultaneously detect four common poultry leg disease pathogens in a single reaction, significantly improving detection throughput and efficiency. This method has good specificity and sensitivity, can effectively distinguish mixed infections, and is simple to operate and provides intuitive results interpretation. It is conducive to rapid and accurate pathogen screening and monitoring in breeding sites and laboratories, providing reliable technical support for the early diagnosis, precise prevention and control of poultry leg diseases and the healthy development of the aquaculture industry. Attached Figure Description

[0017] Figure 1 For detecting specific amplification curves; Figure 2 Amplification curves for ARV detection sensitivity; Figure 3 Amplification curve for NDV detection sensitivity; Figure 4 Amplification curves for AEV detection sensitivity; Figure 5 This is a curve showing the sensitivity of MDV detection. Detailed Implementation

[0018] This invention provides a primer-probe combination for the simultaneous detection of avian leg disease viruses. This combination comprises multiple pairs of specific primers and corresponding fluorescently labeled probes, designed to achieve simultaneous nucleic acid detection of multiple target pathogens in a single reaction.

[0019] Specifically, the primer-probe combination includes: primer ARV-F with the sequence shown in SEQ ID NO.1, primer ARV-R with the sequence shown in SEQ ID NO.2, and probe ARV-P with the sequence shown in SEQ ID NO.3; primer NDV-F with the sequence shown in SEQ ID NO.4, primer NDV-R with the sequence shown in SEQ ID NO.5, and probe NDV-P with the sequence shown in SEQ ID NO.6; primer AEV-F with the sequence shown in SEQ ID NO.7, primer AEV-R with the sequence shown in SEQ ID NO.8, and probe AEV-P with the sequence shown in SEQ ID NO.9; primer MDV-F with the sequence shown in SEQ ID NO.10, primer MDV-R with the sequence shown in SEQ ID NO.11, and probe MDV-P with the sequence shown in SEQ ID NO.12.

[0020] In this invention, primers ARV-F and ARV-R, and probe ARV-P, are designed to target specific conserved gene regions of avian reovirus (ARV). The preferred target is the M1 gene fragment of ARV. Primers NDV-F and NDV-R, and probe NDV-P, are designed to target specific conserved gene regions of Newcastle disease virus (NDV), with the preferred target being the NDV fusion protein (F) gene. Primers AEV-F and AEV-R, and probe AEV-P, are designed to target specific conserved gene regions of avian infectious encephalomyelitis virus (AEV), with the preferred target being the AEV VP1 gene. Primers MDV-F and MDV-R, and probe MDV-P, are designed to target specific conserved gene regions of Marek's disease virus (MDV), with the preferred target being the MDV Meq gene. The design of the primers and probes described above ensures high specificity of binding to their respective target nucleic acid sequences and avoids cross-reactions with non-target sequences or the other four target viral sequences. These oligonucleotide sequences can be obtained using solid-phase synthesis methods known in the art, such as commissioning a professional bioengineering company to synthesize them. The synthesized primers and probes are usually purified by methods such as high-performance liquid chromatography (HPLC) or polyacrylamide gel electrophoresis (PAGE) to ensure their quality.

[0021] Furthermore, to improve the multiplicity and accuracy of detection, the probes mentioned above are all modified with different fluorescent reporter and quencher groups. Specifically, the 5' end of the ARV-P is labeled with a FAM fluorescent reporter group and the 3' end with a BHQ1 quencher group. The 5' end of the NDV-P is labeled with a HEX (or VIC) fluorescent reporter group and the 3' end with a BHQ1 quencher group. The 5' end of the AEV-P is labeled with a ROX (or Texas Red) fluorescent reporter group and the 3' end with a BHQ2 quencher group. The 5' end of the MDV-P is labeled with a CY5 fluorescent reporter group and the 3' end with a BHQ3 quencher group. The selected specific reporter groups have different maximum excitation and emission wavelengths, thus allowing independent monitoring of the amplification of multiple targets through different optical channels within the same reaction tube.

[0022] Based on the aforementioned core primer-probe combination, this invention also provides a quadruple fluorescent RT-PCR kit for detecting avian leg disease viruses. This kit contains the key components required to implement the detection method of this invention. Preferably, the kit contains the aforementioned primer-probe combination.

[0023] In addition to the core primers and probes, a complete fluorescent RT-PCR reaction requires several auxiliary components. Therefore, in a preferred embodiment, the kit also includes 2×PCR Buffer, a mixed enzyme with reverse transcription (RT) and hot-start DNA polymerase activity, and nuclease-free water (such as DEPC water). The 2×PCR Buffer is typically a concentrated reaction buffer, containing, but not limited to, Tris-HCl, KCl, (NH4)2SO4, MgCl2 or MgSO4, dNTPs (dATP, dCTP, dGTP, dTTP), and stabilizers to provide suitable ionic strength and pH for nucleic acid amplification. The mixed enzyme is an enzyme mixture that optimizes the combination of reverse transcriptase and hot-start DNA polymerase. Its function is to first reverse transcribe the RNA template to generate cDNA in the same reaction program, followed by PCR amplification of the cDNA, thereby achieving one-step RT-PCR, simplifying the operation and reducing the risk of contamination. DNA polymerases with hot-start capability are inhibited at room temperature and activated only after undergoing an initial high-temperature step. This helps prevent background increases caused by non-specific primer annealing or extension during reaction system preparation, thus improving reaction specificity. DEPC water is nuclease-free water treated with diethyl pyrocarbonate (DEPC) and autoclaved to remove residual DEPC. It is used to dissolve and dilute various components, ensuring no exogenous nuclease contamination.

[0024] This invention also provides a method for detecting avian leg disease viruses. The detection target of the method is poultry, including but not limited to chickens, ducks, geese, turkeys, and other poultry and related poultry samples. The detection method includes using the aforementioned quadruple fluorescent RT-PCR kit to perform detection, obtaining detection results, and evaluating whether the sample contains the target avian leg disease virus based on the detection results.

[0025] More specifically, in a preferred embodiment, the detection method includes the following steps: S1. Extract nucleic acid from the sample to be tested. The sample to be tested may be derived from avian tissues (such as leg joints, sciatic nerve, brain tissue, etc.), joint contents, cloacal swabs, or cell cultures. Nucleic acid extraction can be performed using conventional methods in the art, such as commercially available column-based or magnetic bead-based DNA / RNA extraction kits (such as the Hexu Biotechnology DNA / RNA extraction kit mentioned in subsequent examples). The extracted nucleic acid should be used immediately for detection or stored at -20°C to -70°C for later use.

[0026] S2. Prepare a quadruple fluorescent RT-PCR reaction solution containing all components of the kit, and add the nucleic acid extracted in step S1 as a template. The total volume of the reaction solution can be adjusted as needed, for example, 20 μL, 25 μL, or 50 μL. The amount and final concentration of each component (such as 2×PCR Buffer, primers, probes, mixed enzymes, template, and nuclease-free water) should be adjusted according to the optimized ratio. For example, the final concentration of primers and probes can be adjusted in the range of 0.1 μM to 0.5 μM, preferably 0.15 μM to 0.25 μM, and more preferably about 0.2 μM.

[0027] S3. Perform the fluorescent RT-PCR amplification reaction. Place the prepared reaction system in a real-time quantitative PCR instrument for the reaction. The reaction program typically includes the following stages: The first stage is the reverse transcription stage, with a temperature range of 45℃ to 55℃ and a reaction time of 20 to 40 minutes; a further preferred temperature range is 48℃ to 52℃ and a time of 25 to 35 minutes; the most preferred condition is a reaction at 50℃ for 30 minutes. The second stage is the pre-denaturation stage, used to activate the hot-start enzyme and completely denature the template, with a temperature range of 90℃ to 95℃ and a time of 2 to 5 minutes; a further preferred temperature range is 92℃ to 95℃ and a time of 3 to 4 minutes; the most preferred condition is pre-denaturation at 95℃ for 3 minutes. The third stage is the PCR amplification cycling stage, with the number of cycles set to 40 to 50 cycles, a further preferred number of 42 to 48 cycles, and the most preferred number of 45 cycles. Each cycle typically includes two steps: a denaturation step, with a temperature range of 90°C to 95°C, held for 10 to 20 seconds, preferably 92°C to 95°C for 12 to 18 seconds, and most preferably 95°C for 15 seconds; and an annealing / extension and fluorescence signal collection step, with a temperature range of 55°C to 65°C, held for 20 to 40 seconds, preferably 58°C to 62°C for 25 to 35 seconds, and most preferably 60°C for 30 seconds, during which fluorescence signals are collected simultaneously. The fluorescence signals described in step S3 need to be collected in specific detection channels corresponding to the reporter groups of each probe, namely the FAM channel, HEX (or VIC) channel, ROX channel, and CY5 channel. The instrument's optical system needs to be calibrated beforehand to ensure the sensitivity and specificity of each channel.

[0028] S4. Result Analysis and Judgment. Based on the signals collected from each fluorescence channel during amplification, an amplification curve is generated. Using instrument software or by manually setting a threshold, the Ct value (cycle threshold) for each sample in each channel is calculated. The standard for determining a sample as positive for a virus is typically set as follows: the Ct value of the corresponding detection channel is less than or equal to a preset cut-off value, and the amplification curve exhibits a typical "S"-shaped exponential growth phase. The cut-off value can be determined based on validation data from a large number of negative and positive samples; for example, it can be set to Ct value ≤ 40, more preferably Ct value ≤ 38, and most preferably Ct value ≤ 35. If the Ct value of a channel is greater than the cut-off value or no typical "S"-shaped amplification curve is observed (appearing as a straight line or a slightly sloping line), the virus is judged to be negative.

[0029] Finally, this invention also provides the application of the above-described primer-probe combination or the above-described quadruple fluorescent RT-PCR kit in the preparation of products, systems, or devices for the detection of avian leg disease viruses. In this invention, the term "product for the detection of avian leg disease viruses" is a broad concept, encompassing any commercially available product containing the core components of the primer-probe combination or kit described in this invention. For example, the product could be a premix containing the primer-probe combination, i.e., all reaction components except the template are pre-mixed, and the user only needs to add the template nucleic acid; it could also be a kit containing all individually packaged components (such as individual primer-probe tubes, enzyme mixtures, buffer solutions, etc.). Furthermore, the product could also be a detection device integrated on a solid-phase carrier, such as a microfluidic chip, which pre-embeds the primers and probes of this invention for automated and miniaturized nucleic acid detection.

[0030] The term "system" generally refers to a combination of hardware and / or software components assembled to complete a specific detection process. For example, an avian pathogen detection system may include an integrated system comprising: an automated sample nucleic acid extractor, a liquid handling workstation for preparing the reaction solution of the reagent kit of the present invention, a real-time quantitative PCR instrument, and a computer with installed data analysis software. The software may be specifically programmed to automatically analyze the data generated by the quadruple fluorescent RT-PCR of the present invention and output a report containing detection results for four viruses.

[0031] The term "equipment" primarily refers to the instruments and devices used to perform the key steps in the detection method of this invention. The most crucial piece of equipment is a real-time quantitative PCR system, which possesses multi-channel fluorescence detection capabilities and can run the reaction program described in this invention, collecting fluorescence signals from channels such as FAM, HEX, ROX, and CY5. Other related equipment includes nucleic acid extractors for sample pretreatment, pipettes or automated dispensing devices for preparing the reaction system, etc.

[0032] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0033] The main sequences involved in the embodiments are as follows: Primer pairs ARV-F and ARV-R and probe ARV-P for detecting avian reovirus; primer pairs NDV-F and NDV-R and probe NDV-P for detecting Newcastle disease virus; primer pairs AEV-F and AEV-R and probe AEV-P for detecting avian infectious encephalomyelitis virus; and primer pairs MDV-F and MDV-R and probe MDV-P for detecting Marek's disease virus. The primer pairs and probe sequences are as follows: ARV-F:GGCCTATCTAGCCACACC, as shown in SEQ ID NO.1; ARV-R:ACACATCTTGGAGGTCGA, as shown in SEQ ID NO.2; ARV-P:FAM-TGTGCTAGGAGTCGGTTCTCGCATTAC-BHQ1; as shown in SEQ ID NO.3; The ARV-P probe is labeled with a FAM fluorescent reporter group at its 5' end and a BHQ1 quencher group at its 3' end. NDV-F: GACTCAACTCTTGGGCATACA, as shown in SEQ ID NO.4; NDV-R: TGAGGTGTCAAGCTCTTCTAT, as shown in SEQ ID NO.5; NDV-P: HEX-CAGTCGGGAACCTAAATAATATGCGTGC-BHQ1, as shown in SEQ ID NO.6; The NDV-P probe is labeled with a HEX fluorescent reporter group at the 5' end and a BHQ1 quencher group at the 3' end; AEV-F: GAATTAGCTCCTGGTAAACCTCG, as shown in SEQ ID NO.7; AEV-R: TATTATCGCAACACCCTCAGG, as shown in SEQ ID NO.8; AEV-P: ROX-ACTGACATGCAGTACACATTCCAGATACC-BHQ2, as shown in SEQ ID NO.9; The AEV-P probe is labeled with a ROX group at the 5' end and a BHQ2 quencher group at the 3' end; MDV-F: GGAGCCGGAGAGGTTTTATG, as shown in SEQ ID NO.10; MDV-R: AATCTGGCCCGAATACAAGG, as shown in SEQ ID NO.11; MDV-P: CY5-CGTCTTACCGAGGATCCCGAACAG-BHQ3, as shown in SEQ ID NO.12; The NDV-P probe is labeled with a CY5 group at the 5' end and a BHQ3 quencher group at the 3' end.

[0034] Avian reovirus M1 gene sequence: GGCCTATCTAGCCACACCTGTGCTAGGAGTCGGTTCTCGCATTACCGCCTTAGATCGTACTATTGATGCTATCACGTTGAAACCTCGAATCGACCTCCAAGATGTGT, as shown in SEQ ID NO. 13; Newcastle disease virus F gene sequence: AGACTCAACTCTTGGGCATACAAGTGAATTTGCCCTCAGTCGGGAACTTAAATAATATGCGTGCCACCTATTTGGAGGCCTTATCTGTATGTCCAACTAAAGGATATGCTTCAGATCTTCCCCGAAAGTAGTTACACAAGTCGGTTCTGGGATAGAAGAGCTTGACACCTC, as shown in SEQ ID NO. 14; Avian infectious encephalomyelitis virus VP1 gene sequence: GAATTAGCTCCTGGTAAACCTCGACATACAGTGGACTACATGGATCTGTATAAGTTCATGGGGCGTGCCCATTACTTGTGGGGACATAAATTCACCAAAACTGACATGCAGTACACATTCCAGATACCATTAAGTCCCATTAAAGA GGGCTTTGTGACGGGCACACTTAGGTGGTTTTTAAGTCTTTTCCAACTGTGTCGTGGTTCTCGACATTACCATGACATTTGCAGGAAAAACTAATGTGGATGGCATTGTGTACTTTGTGCCTGAGGGTGTGCGATAATA, such as SEQ Shown as IDNO.15; Marek's virus MEQ gene sequence: GGAGCCGGAGAGGCTTTATGCTCGTCTTACCGAGGATCCCGAACAGGATTCCTTGTATTCGGGCCAGATT, as shown in SEQ ID NO. 16.

[0035] The ARV, NDV, AEV, MDV, avian infectious bronchitis virus (IBV), avian infectious bursal disease virus (IBDV), avian infectious laryngotracheitis virus (ILTV), avian influenza virus (AIV), and avian leukosis virus (ALV) standards used in the examples were all purchased from Luoyang Putai Biotechnology Co., Ltd. A total of 121 clinical samples suspected of being infected with ARV, NDV, AEV, and MDV were collected from clinical settings. The nucleic acid extraction kit was from Hexu (Zhengzhou) Biotechnology Co., Ltd.; the real-time PCR instrument was from Xi'an Tianlong Technology Co., Ltd.; and the Universal Multiplex One Step RT-qPCR Probe Kit was purchased from Yisheng Biotechnology Co., Ltd.

[0036] Example This embodiment provides a set of primer pairs and probes for simultaneous detection of avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus, and Marek's disease virus. Specifically, the primer pairs ARV-F and ARV-R and the probe ARV-P are for detecting avian reovirus; the primer pairs NDV-F and NDV-R and the probe NDV-P are for detecting Newcastle disease virus; the primer pairs AEV-F and AEV-R and the probe AEV-P are for detecting avian infectious encephalomyelitis virus; and the primer pairs MDV-F and MDV-R and the probe MDV-P are for detecting Marek's disease virus. The specific sequences of the primer pairs and probes are described above.

[0037] Operating steps: The quadruple fluorescent RT-PCR reaction solution was prepared in 20 μL as shown in Table 1 below: Table 1. Specific composition of the reaction solution

[0038] Nucleic acid was extracted from the sample using a commercially available nucleic acid extraction kit, and the extracted nucleic acid sample was stored at -20°C.

[0039] Sample loading and instrument testing: Add 25 μL of the single reaction system (20 μL reaction solution + 5 μL nucleic acid template), centrifuge the PCR tube at 2000 rpm for 2 min in a mini centrifuge, and then test it on the PCR machine. Set the reaction program: 50℃ for 30 min; 95℃ for 3 min; 45 cycles (95℃ for 15 s, 60℃ for 30 s), and select FAM, HEX, ROX, and CY5 channels.

[0040] The results are shown in Table 2: Table 2 Result Judgment Method

[0041] In this embodiment, the primers and probes were designed and synthesized based on the genomes of avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus, and Marek's disease virus listed in NCBI. Primer design software was used to design multiplex fluorescent PCR primers and probes according to their conserved regions. The detection probes were labeled with a fluorescent luminescent group at the 5' end and a quenching group at the 3' end. All primers and probes were synthesized by Sangon Biotech Co., Ltd.

[0042] The positive plasmids used in this embodiment were obtained by searching for the gene sequences of avian reovirus M1, Newcastle disease virus F, avian infectious encephalomyelitis virus VP1, and Marek's disease virus Meq in GenBank, designing and ligating them into the pUC57 vector, and then synthesizing them at Sangon Biotech Co., Ltd. The specific sequences are described above.

[0043] Specificity and sensitivity testing of the quadruple real-time RT-PCR kit: Preparation of positive and negative controls: The synthesized positive plasmids pUC57-ARV, pUC57-NDV, pUC57-AEV, and pUC57-MDV were diluted to 80 ng / μL according to the amount of plasmid. Then, the copy number / μl was calculated using the formula: copy number / μl = (6.02 × 10⁻⁶). 23 )×(ng / μl×10 -9 ) / (DNA length × 660); Calculate the copy number of each positive plasmid, and dilute the positive plasmids pUC57-ARV, pUC57-NDV, pUC57-AEV, and pUC57-MDV to 10-1. 5 The copies / μL were then mixed in a 1:1:1:1 ratio to obtain the positive control. The negative control was replaced with DEPC water.

[0044] (1) Detection specificity Preparation of the real-time RT-PCR reaction system: 20 μL of reaction solution per tube. RNA from one strain of avian reovirus, one strain of Newcastle disease virus, one strain of avian infectious encephalomyelitis virus, one strain of Marek's disease virus, one strain of avian infectious bronchitis virus, one strain of avian infectious bursal disease virus, one strain of avian infectious laryngotracheitis virus, one strain of avian influenza virus, and one strain of avian leukosis virus, along with healthy chicken tissue, were selected as templates.

[0045] The detection reaction conditions are set as follows: First stage, 50℃ / 30min; second stage, 95℃ / 5min; third stage, 95℃ / 15s, 60℃ / 30s (collect fluorescence), 45 cycles, with the fluorescence channels selected as FAM, HEX, ROX, and CY5.

[0046] The specific amplification curve for detection is shown below. Figure 1 As shown; The results showed that only FAM fluorescence detection curves appeared in the channel corresponding to the avian reovirus RNA template, only HEX fluorescence detection curves appeared in the channel corresponding to the Newcastle disease virus RNA template, only ROX fluorescence detection curves appeared in the channel corresponding to the avian infectious encephalomyelitis virus RNA template, and only CY5 fluorescence detection curves appeared in the channel corresponding to the Marek's disease virus RNA template. No amplification was observed in any of the four channels for detecting avian infectious bronchitis virus, avian infectious bursal disease virus, avian infectious laryngotracheitis virus, avian influenza virus, and avian leukosis virus.

[0047] The results show that the primers and probes provided in this invention are highly specific for detecting avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus and Marek's disease virus by the quadruple fluorescent RT-PCR method, and there is no cross-reaction between them. This method can effectively identify and detect these four common avian leg disease viruses.

[0048] (2) Detection sensitivity Eight different concentrations of avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus, and Marek's disease virus cDNA templates were set up for amplification under optimal conditions by real-time quantitative RT-PCR.

[0049] The original concentration of the extracted cDNA template was determined, and it was diluted to 1 ng / μL according to the specified ratio, and then further diluted 10-fold to a concentration of 10:10. 7 ng / μL, 10 6 ng / μL, 10 5 ng / μL, 10 4 ng / μL, 10 3 ng / μL, 10 2 ng / μL, 10 1 ng / μL, 10 0 ng / μL; take 5μL as reaction template and perform real-time quantitative RT-PCR amplification according to the above sample addition method.

[0050] The detection sensitivity amplification curve is shown below. Figures 2-5 As shown.

[0051] The results show that the primer and probe combination designed in this invention can ensure the sensitivity of detection. The detection sensitivity of the avian reovirus detection primer and probe is 10. 1 ng / μL; the detection sensitivity of the Newcastle disease virus detection primers and probes is 10 ng / μL for a final RNA concentration. 2 ng / μL; The detection sensitivity of the primers and probes for avian infectious encephalomyelitis virus detection is 10 ng / μL. 1ng / μL; the detection sensitivity of the Marek's virus detection primers and probes is 10 ng / μL. 1 ng / μL.

[0052] Applications in the detection of actual samples 1. Sample collection: One hundred samples of poultry tissue and joint contents were collected, sealed in an ice-filled incubator, and delivered to the laboratory within 24 hours. Process or store at -70°C.

[0053] 2. Sample Preparation Tissue sample: After mincing and mixing with surgical scissors, take 0.5g and place it in a grinding tube containing 3mL PBS / sterile water and grind thoroughly. Centrifuge 1 mL of the homogenate at 10,000 rpm for 1 min, and collect the supernatant for later use.

[0054] Joint contents sample: Take 1 mL of joint contents sample, centrifuge at 5000 rpm for 1 min, and collect the supernatant for later use.

[0055] 3. Nucleic acid extraction Nucleic acid extraction was performed on the pretreated sample supernatant using the Hexu Bio DNA / RNA Extraction Kit (column method). The extracted RNA must be amplified by RT-PCR within 2 hours and stored at -70℃ for extended periods.

[0056] 4. Test Results 121 samples were tested using a quadruple fluorescent RT-PCR kit for avian leg disease viruses. The test results are shown in Table 3.

[0057] Table 3. Results of Clinical Quadruple RT-PCR Detection

[0058] The results showed that among the 121 samples detected by the quadruple real-time fluorescent RT-PCR method of this invention, the positive detection rates were 21.49% for avian reovirus, 15.70% for Newcastle disease virus, 7.44% for avian infectious encephalomyelitis virus, and 12.40% for Marek's disease virus; the remaining samples were negative, and no cross-infected samples were detected. The results of this RT-PCR method were 100% consistent with the gene sequencing results. This indicates that the quadruple real-time fluorescent RT-PCR method established in this invention has high sensitivity and good clinical application effects.

[0059] As demonstrated by the above embodiments, this invention provides a quadruple fluorescent RT-PCR kit and detection method for the simultaneous detection of avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus, and Marek's disease virus. This method exhibits good specificity, producing corresponding fluorescent signals only for the target viruses and showing no cross-reactivity with other common avian pathogens. It also possesses high detection sensitivity, enabling reliable detection of low-load viral nucleic acids. Clinical sample validation shows that the detection results of this method are highly consistent with gene sequencing results, making it suitable for the simultaneous single-tube detection and identification of multiple viruses in actual samples, demonstrating good application feasibility.

[0060] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer-probe combination for simultaneous detection of avian leg disease viruses, characterized in that, Include: Primer ARV-F with the sequence shown in SEQ ID NO.1, primer ARV-R with the sequence shown in SEQ ID NO.2, and probe ARV-P with the sequence shown in SEQ ID NO.3; Primer NDV-F with the sequence shown in SEQ ID NO.4, primer NDV-R with the sequence shown in SEQ ID NO.5, and probe NDV-P with the sequence shown in SEQ ID NO.6; Primer AEV-F with the sequence shown in SEQ ID NO.7, primer AEV-R with the sequence shown in SEQ ID NO.8, and probe AEV-P with the sequence shown in SEQ ID NO.9; Primer MDV-F with the sequence shown in SEQ ID NO.10, primer MDV-R with the sequence shown in SEQ ID NO.11, and probe MDV-P with the sequence shown in SEQ ID NO.

12.

2. A quadruple fluorescent RT-PCR kit for detecting avian leg disease viruses, characterized in that, It includes the primer-probe combination as described in claim 1.

3. The quadruple fluorescent RT-PCR kit according to claim 2, characterized in that, The ARV-P is labeled with a FAM fluorescent reporter group at its 5' end and a BHQ1 quencher group at its 3' end.

4. The quadruple fluorescent RT-PCR kit according to claim 2, characterized in that, The NDV-P is labeled with a HEX fluorescent reporter group at its 5' end and a BHQ1 quencher group at its 3' end.

5. The quadruple fluorescent RT-PCR kit according to claim 2, characterized in that, The AEV-P is labeled with a ROX fluorescent reporter group at its 5' end and a BHQ2 quencher group at its 3' end.

6. The quadruple fluorescent RT-PCR kit according to claim 2, characterized in that, The MDV-P is labeled with a CY5 fluorescent reporter group at its 5' end and a BHQ3 quencher group at its 3' end.

7. The quadruple fluorescent RT-PCR kit according to any one of claims 2 to 6, characterized in that, It also contains 2×PCR Buffer, a mixed enzyme with reverse transcription and hot-start DNA polymerase activity, and DEPC water.

8. A method for detecting a virus causing leg diseases in poultry, characterized in that, The detection method is used to detect poultry; The detection method includes using the quadruple fluorescent RT-PCR kit according to any one of claims 2 to 7 to perform detection, obtain detection results, and evaluate whether the virus is present in the avian leg disease based on the detection results.

9. The detection method according to claim 8, characterized in that, The detection method includes the following steps: S1. Extract nucleic acid from the sample to be tested; S2. Prepare a quadruple fluorescent RT-PCR reaction solution containing all components of the kit, and add the nucleic acid as a template; S3. Perform fluorescent RT-PCR amplification reaction. The reaction procedure includes reacting at 45℃~55℃ for 20~40 minutes, pre-denaturing at 90℃~95℃ for 2~5 minutes, and then performing 40~50 cycles. Each cycle includes holding at 90℃~95℃ for 10~20 seconds and holding at 55℃~65℃ for 20~40 seconds while collecting the fluorescence signal. S4. Determine whether the sample contains avian reovirus, Newcastle disease virus, avian infectious encephalomyelitis virus, and Marek's disease virus based on the fluorescence signal; The fluorescence signal described in step S3 is collected in the FAM, HEX, ROX, and CY5 channels; In step S4, the criteria for determining a sample to be positive are that the Ct value of the corresponding detection channel is ≤40 and an S-shaped amplification curve appears.

10. The use of the primer-probe combination of claim 1 or the quadruple fluorescent RT-PCR kit of any one of claims 2 to 7 in the preparation of products, systems or devices for the detection of avian leg disease viruses.