Primer probe combination, reagent, method and application for detecting brucella vaccine strain RB51

Abstract

This invention provides a primer-probe combination, reagents, methods, and applications for detecting Brucella vaccine strain RB51, belonging to the field of pathogen detection technology. The primer-probe combination for detecting Brucella vaccine strain RB51 of this invention includes a forward primer RB51-F, a reverse primer RB51-R, and a probe RB51-P; the forward primer RB51-F is shown in SEQ ID NO:1, the reverse primer RB51-R is shown in SEQ ID NO:2, and the probe RB51-P is shown in SEQ ID NO:3. The fluorescent PCR and digital PCR detection methods established based on the primer-probe combination of this invention have high sensitivity, good specificity, fast detection speed, and high throughput, enabling rapid detection of Brucella vaccine strain RB51, making differential diagnosis more accurate, economical, efficient, and convenient.

Description

Technical Field

[0001] This invention belongs to the field of pathogen detection technology, and particularly relates to a primer-probe combination, reagent, method and application for detecting Brucella vaccine strain RB51. Background Technology

[0002] Brucellosis, commonly known as brucellosis, is a zoonotic infectious disease caused by Brucella bacteria. Brucella has a wide host range, infecting livestock such as cattle and sheep, wild animals, and humans. It causes late-term abortion and endometritis in female animals, and orchitis and epididymitis in male animals. Control of brucellosis mainly relies on vaccination, isolation and culling of positive animals, and purification measures. Currently, my country uses attenuated live vaccines including Brucella bovis strain A19, Brucella swine strain S2, and Brucella ovis strain M5. Brucella bovis strain RB51 is a rough vaccine strain, which, compared to smooth vaccines, has higher safety and lower virulence. More importantly, the rough vaccine strain does not contain the O-chain antigen on its outer membrane, reducing interference with serological diagnosis. It has a unique advantage in distinguishing between naturally infected and immunized animals, and can still monitor and control wild-type virus infection after vaccination.

[0003] Serological detection techniques, such as the Rose Bengal plate agglutination test, tube agglutination test, and enzyme-linked immunosorbent assay (ELISA), are susceptible to interference from various factors. They not only struggle to differentiate between vaccine-immunized and naturally occurring antibodies but also fail to accurately distinguish specific antibodies against different Brucella strains, thus limiting diagnostic accuracy. Currently, molecular biological diagnostic techniques such as PCR, fluorescent PCR, and digital PCR are widely used in clinical practice due to their speed, accuracy, and efficiency. Fluorescent PCR, especially real-time quantitative PCR using fluorescent probes, exhibits excellent performance in terms of specificity, sensitivity, and stability, enabling multi-target detection. Digital PCR, developed based on fluorescent PCR, is an ultra-high sensitivity detection technique with even higher sensitivity and accuracy, stronger inhibitor resistance, and the ability to achieve absolute nucleic acid quantification and trace pathogen detection. Currently, there are no domestic articles or patents regarding fluorescent PCR or digital PCR detection methods for Brucella vaccine strain RB51. Therefore, researching a diagnostic method for Brucella vaccine strain RB51 is crucial, providing essential technical tools for precise prevention and eradication of brucellosis. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a primer-probe combination, reagent, method and application for detecting Brucella vaccine strain RB51, which can detect the DNA of Brucella RB51 strain and distinguish it from the DNA of other Brucella strains and vaccine strains.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention provides a primer-probe combination for detecting Brucella vaccine strain RB51, the primer-probe combination comprising forward primer RB51-F, reverse primer RB51-R and probe RB51-P; The forward primer RB51-F is shown in SEQ ID NO:1, the reverse primer RB51-R is shown in SEQ ID NO:2, and the probe RB51-P is shown in SEQ ID NO:3.

[0006] Preferably, the 5' end of the probe RB51-P is labeled with a fluorescent group, and the 3' end of RB51-P is labeled with a quenching group.

[0007] The present invention also provides a reagent for detecting Brucella vaccine strain RB51, comprising the aforementioned primer-probe combination.

[0008] The present invention also provides a kit for detecting Brucella vaccine strain RB51, comprising the aforementioned reagent.

[0009] The present invention also provides the application of the primer-probe combination, the reagent, or the kit described herein in the preparation of products for detecting Brucella vaccine strain RB51.

[0010] This invention also provides a method for detecting Brucella vaccine strain RB51 for non-diagnostic purposes, including a fluorescent PCR detection method, a triple fluorescent PCR detection method, and a digital PCR detection method.

[0011] Preferably, the fluorescent PCR detection method / triple fluorescent PCR detection method includes the following steps: (1) Extract DNA from the sample to be tested; (2) Use the primer and probe combination to amplify the DNA of the sample to be tested in step (1) using fluorescent PCR / triple fluorescent PCR; (3) The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the negative control. The judgment criteria for the fluorescent PCR are as follows: if the sample to be tested has no Ct value or the Ct value is >35 and there is no specific amplification curve, the result is judged as Brucella RB51 nucleic acid negative; if the Ct value of the FAM channel of the sample to be tested is ≤35 and a specific amplification curve appears, the result is judged as Brucella RB51 nucleic acid positive. The criteria for the triple fluorescent PCR are as follows: if the sample has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as Brucella negative; if the Ct value of the general type, A19 and RB51 probe channels of the sample is ≤ 35 and all show specific amplification curves, the result is judged as Brucella RB51 nucleic acid positive; if the Ct value of the general type and A19 probe channels of the sample is ≤ 35 and specific amplification curves are shown, but the RB51 probe channel has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as Brucella A19 nucleic acid positive; the negative control is nuclease-free water.

[0012] Preferably, the final concentrations of the forward primer RB51-F, the reverse primer RB51-R, and the probe RB51-P in the primer-probe combination of the fluorescent PCR detection method are all 0.2~0.4 μmol / L; The triple fluorescent PCR detection method also includes a primer-probe combination for the universal TY strain and a primer-probe combination for the vaccine strain A19. The universal TY primer-probe combination includes the forward primer TY-F, the reverse primer TY-R, and the probe TY-P; The forward primer TY-F is shown in SEQ ID NO:5, the reverse primer TY-R is shown in SEQ ID NO:6, and the probe TY-P is shown in SEQ ID NO:7; The primer-probe combination for the vaccine strain A19 includes a forward primer A19-F, a reverse primer A19-R, and a probe A19-P; The forward primer A19-F is shown in SEQ ID NO:8, the reverse primer A19-R is shown in SEQ ID NO:9, and the probe A19-P is shown in SEQ ID NO:10; In the triple fluorescent PCR detection method, the final concentrations of the forward primer RB51-F, the reverse primer RB51-R, the probe RB51-P, the forward primer TY-F, the reverse primer TY-R, the probe TY-P, and the forward primer A19-F, the reverse primer A19-R, and the probe A19-P are all 0.2~0.4 μmol / L. The reaction program for the fluorescent PCR / triple fluorescent PCR is as follows: 95℃ for 30 s; 95℃ for 10 s, 50~60℃ for 30 s, for 30~45 cycles.

[0013] Preferably, the digital PCR detection method includes the following steps: (1) Extract DNA from the sample to be tested; (2) The DNA of the sample to be tested in step (1) is amplified by digital PCR using the primer and probe combination described above; the negative control is nuclease-free water.

[0014] Preferably, the final concentrations of the forward primer RB51-F, the reverse primer RB51-R, and the probe RB51-P in the primer-probe combination of the digital PCR detection method are all 0.2~0.6 μmol / L; The reaction program for the digital PCR is as follows: 95℃ for 30 s; 95℃ for 15 s, 54~60℃ for 30 s, for 30~45 cycles.

[0015] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention achieves the goal of rapid detection of Brucella vaccine strain RB51, making differential diagnosis more accurate, economical, efficient and convenient.

[0016] 2. High sensitivity: The fluorescence PCR and digital PCR detection methods provided by this invention have a limit of detection of 3.0 × 10⁻⁶ for RB51 nucleic acid. 1 copies / μL and 1.0 copies / μL.

[0017] 3. High specificity: The fluorescent PCR and digital PCR detection methods provided by this invention only generate corresponding fluorescent amplification signals for the Brucella vaccine strain RB51 genome. There is no cross-reactivity with other Brucella strains (A19 strain, A19ΔvirB12 gene deletion strain, S19 strain, Rev.1 strain, S2 strain, M5 strain, RM6 strain, BA0711 strain) as well as bovine Pasteurella multocida, Clostridium emphysema, Mycoplasma bovis HB150 strain, bovine enterovirus, bovine viral diarrhea virus NM01 strain, foot-and-mouth disease virus OHM / 02 strain, bovine nodular dermatitis virus, and other bovine-related pathogens.

[0018] 4. High detection speed and high throughput: The fluorescent PCR detection method provided by this invention can complete the entire amplification and detection process within 1 hour after the sample is added, and depending on the number of detection wells of the fluorescent PCR instrument, it can simultaneously detect 96 to 384 samples at one time. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the RB51 primer and probe design region; Figure 2 The graph shows the optimization results of RB51 primer and probe concentrations (where A: primer concentration optimization results; B: probe concentration optimization results). Figure 3 yes Taq Figure 1; Results of optimization of annealing temperature for Man fluorescent PCR; Figure 4This is an electrophoresis result of RB51 positive plasmid preparation (lane 1: 2000 bp marker; lane 2: RB51 amplification product (152 bp)). Figure 5 yes Taq Man fluorescence PCR sensitivity test results (where 1: working standard 1; 2: working standard 2; 3: working standard 3; 4: working standard 4; 5: working standard 5; 6: working standard 6; 7: working standard 7; 8: working standard 8; 9: negative control). Figure 6 yes Taq Mann fluorescence PCR standard curve results (where 1: working standard 1; 2: working standard 2; 3: working standard 3; 4: working standard 4; 5: working standard 5; 6: working standard 6; 7: working standard 7; 8: working standard 8). Figure 7 yes Taq The results of the Man fluorescent PCR specificity test are shown in the figure (where 1: positive plasmid pMD-RB51; 2: Brucella RB51 strain; 3: Brucella A19 strain; 4: Brucella A19ΔvirB12 gene deletion strain; 5: Brucella S19 strain; 6: Brucella Rev.1 strain; 7: Brucella S2 strain; 8: Brucella M5 strain; 9: Brucella RM6 strain; 10: Brucella BA0711 strain; 11: Bovine Pasteurella multocida; 12: Clostridium emphysemae; 13: Bovine Mycoplasma HB150 strain; 14: Bovine enterovirus; 15: Bovine viral diarrhea virus NM01 strain; 16: Foot-and-mouth disease virus OHM / 02 strain; 17: Bovine nodular dermatitis virus; 18: negative control). Figure 8 It is triple Taq Figure 1 shows the optimization results of primer concentrations for Man fluorescent PCR (where A: optimization results of RB51 primer concentration; B: optimization results of TY primer concentration; C: optimization results of A19 primer concentration). Figure 9 It is triple Taq The results of optimizing the concentration of Man fluorescent PCR probes are shown in the figure (where A: RB51 probe concentration optimization result; B: TY probe concentration optimization result; C: A19 probe concentration optimization result). Figure 10 It is triple Taq Figure 1 shows the optimization results of annealing temperature for Man fluorescent PCR (where A: optimization results of RB51 annealing temperature; B: optimization results of TY annealing temperature; C: optimization results of A19 annealing temperature). Figure 11 It is triple TaqThe results of the Man fluorescent PCR specificity test are shown in the figure (where 1.1, 1.2, 1.3: Brucella RB51 strain; 2.1, 2.2: Brucella A19 strain; 3.1, 3.2: Brucella A19ΔvirB12 gene deletion strain; 4.1, 4.2: Brucella S19 strain; 5: Brucella Rev.1 strain; 6: Brucella S2 strain; 7: Brucella M5 strain; 8: Brucella RM6 strain; 9: Brucella BA0711 strain; 10: Bovine Pasteurella multocida; 11: Clostridium emphysemae; 12: Bovine Mycoplasma HB150 strain; 13: Bovine enterovirus; 14: Bovine viral diarrhea virus NM01 strain; 15: Foot-and-mouth disease virus OHM / 02 strain; 16: Bovine nodular dermatitis virus; 17: Negative control). Figure 12 This is a graph showing the optimized working concentration of fluorescent probes for digital PCR detection (where A3 and B3 have a working probe concentration of 0.20 μmol / L; C3 and D3 have a working probe concentration of 0.33 μmol / L; A4 and B4 have a working probe concentration of 0.47 μmol / L; and C4 and D4 have a working probe concentration of 0.60 μmol / L). Figure 13 This is a graph showing the optimization results of annealing temperature for the digital PCR detection method (where A2, B2: annealing temperature 54℃; C2, D2: annealing temperature 56℃; A3, B3: annealing temperature 58℃; C3, D3: annealing temperature 60℃). Figure 14 This is a graph showing the results of the sensitivity test of the digital PCR detection method (where A2, B2: working standard d1; C2, D2: working standard d2; A3, B3: working standard d3; C3, D3: working standard d4; A4, B4: working standard d5; C4, D4: working standard d6). Figure 15 This is a graph showing the standard curve results of the digital PCR detection method (where 1: working standard d1; 2: working standard d2; 3: working standard d3; 4: working standard d4; 5: working standard d5). Figure 16 This is a graph showing the results of the specificity test of the digital PCR detection method (where A2: Brucella RB51 strain; B2: Brucella A19 strain; C2: Brucella Rev.1 strain; D2: Brucella S2 strain; A3: Brucella M5 strain; B3: Brucella RM6 strain; C3: Brucella BA0711 strain; D3: Pasteurella multocida; A4: Mycoplasma bovis HB150 strain; B4: Bovine viral diarrhea virus NM01 strain; C4: Foot-and-mouth disease virus OHM / 02 strain; D4: Negative control). Detailed Implementation

[0020] The present invention provides a primer-probe combination for identifying Brucella vaccine strain RB51, the primer-probe combination comprising forward primer RB51-F, reverse primer RB51-R and probe RB51-P; The forward primer RB51-F is shown in SEQ ID NO:1, specifically 5'-TCCTCGATTGCAGACAGGTTC-3', the reverse primer RB51-R is shown in SEQ ID NO:2, specifically 5'-CCGTACAGATTTCACATAAGCCT-3', and the probe RB51-P is shown in SEQ ID NO:3, specifically 5'-TCCATCCGCACACTACTCACACC-3'.

[0021] In this invention, the probe RB51-P is labeled with a fluorescent color-producing modifying group. The 5' end of the probe RB51-P is labeled with a fluorescent group, and the 3' end of RB51-P is labeled with a quenching group. The fluorescent group can be selected from, but is not limited to, common fluorescent groups such as FAM (5 / 6-carboxyfluorescein), VIC (green fluorescent protein), TET (tetrachloro-6-carboxyfluorescein), JOE (2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein), HEX (hexachloro-6-methylfluorescein), Cy3, TAMRA (6-carboxytetramethylrhodamine), ROX (carboxy-X-rhodamine), Texas Red, Cy5 (cyanine dye), and FITC (fluorescein isothiocyanate). The principle for selecting the fluorescent group of the probe in the primer composition for duplex PCR detection is that the two fluorescence colors are different. The quenching group can be selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, and MGB.

[0022] The present invention also provides a reagent for detecting Brucella vaccine strain RB51, comprising the aforementioned primer-probe combination.

[0023] The present invention also provides a kit for detecting Brucella vaccine strain RB51, comprising the aforementioned reagent.

[0024] The present invention also provides the application of the primer-probe combination, the reagent, or the kit described herein in the preparation of products for detecting Brucella vaccine strain RB51.

[0025] This invention also provides a method for detecting Brucella vaccine strain RB51 for non-diagnostic purposes, including a fluorescent PCR detection method, a triple fluorescent PCR detection method, and a digital PCR detection method.

[0026] In this invention, the fluorescent PCR detection method / triple fluorescent PCR detection method includes the following steps: (1) Extract DNA from the sample to be tested; (2) Use the primer and probe combination to amplify the DNA of the sample to be tested in step (1) using fluorescent PCR / triple fluorescent PCR; (3) The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the negative control; the judgment criteria of the fluorescent PCR are: if the sample to be tested has no Ct value or Ct value > 35 and no specific amplification curve, the result is judged as Brucella RB51 nucleic acid negative; if the sample to be tested has FAM channel Ct value ≤ 35 and a specific amplification curve appears, the result is judged as Brucella RB51 nucleic acid positive. The criteria for the triple fluorescent PCR are as follows: if the sample has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as Brucella negative; if the Ct values ​​of the universal, A19 and RB51 probe channels of the sample are all ≤ 35 and all show specific amplification curves, the result is judged as Brucella RB51 nucleic acid positive; if the Ct value of the universal and A19 probe channels of the sample is ≤ 35 and a specific amplification curve is shown, but the RB51 probe channel has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as Brucella A19 nucleic acid positive; the negative control is nuclease-free water.

[0027] In this invention, the final concentrations of the forward primer RB51-F, the reverse primer RB51-R, and the probe RB51-P in the primer-probe combination of the fluorescent PCR detection method are preferably 0.2~0.4 μmol / L, and more preferably 0.25 μmol / L.

[0028] In this invention, the triple fluorescent PCR detection method further includes a primer-probe combination of the universal TY type and a primer-probe combination of the vaccine strain A19. The universal TY primer-probe combination includes the forward primer TY-F, the reverse primer TY-R, and the probe TY-P; The forward primer TY-F is shown in SEQ ID NO:5, specifically 5'-CGCTCGCGCGGTGGAT-3'; the reverse primer TY-R is shown in SEQ ID NO:6, specifically 5'-CTTGAAGCTTGCGGACAGTCACC-3'; and the probe TY-P is shown in SEQ ID NO:7, specifically 5'-ACGACCAAGCTGCATGCTGTTGTCGATG-3'. The primer-probe combination for the vaccine strain A19 includes a forward primer A19-F, a reverse primer A19-R, and a probe A19-P; The forward primer A19-F is shown in SEQ ID NO:8, specifically 5'-GCGGCTTTTCTATCACGGTATTC-3'; the reverse primer A19-R is shown in SEQ ID NO:9, specifically 5'-CATGCGCTATGATCTGGTTACG-3'; and the probe A19-P is shown in SEQ ID NO:10, specifically 5'-ACACGCCCTAGAACGCCTTTCGGA-3'. In the triple fluorescence PCR detection method, the final concentrations of the forward primer RB51-F, the reverse primer RB51-R, and the probe RB51-P, the forward primer TY-F, the reverse primer TY-R, and the probe TY-P, and the forward primer A19-F, the reverse primer A19-R, and the probe A19-P are preferably 0.2~0.4 μmol / L; the final concentration of the forward primer RB51-F, the reverse primer RB51-R, and the probe RB51-P is preferably 0.25 μmol / L; the final concentration of the forward primer TY-F, the reverse primer TY-R, and the probe TY-P is preferably 0.35 μmol / L; and the final concentration of the forward primer A19-F, the reverse primer A19-R, and the probe A19-P is preferably 0.4 μmol / L. The preferred reaction program for the fluorescent PCR / triple fluorescent PCR is: 95℃ for 30 s; 95℃ for 10 s, 50~60℃ for 30 s, 30~45 cycles, and more preferably 95℃ for 30 s; 95℃ for 10 s, 58℃ for 30 s, 40 cycles.

[0029] In this invention, the digital PCR detection method includes the following steps: (1) Extract DNA from the sample to be tested; (2) The DNA of the sample to be tested in step (1) is amplified by digital PCR using the primer and probe combination described above; the negative control is nuclease-free water.

[0030] In this invention, the final concentrations of the forward primer RB51-F and the reverse primer RB51-R, and the final concentration of the probe RB51-P in the primer-probe combination of the digital PCR detection method are both 0.2~0.6 μmol / L, preferably 0.33 μmol / L; the reaction program of the digital PCR is: 95℃ for 30 s; 95℃ for 15 s, 54~60℃ for 30 s, 30~45 cycles, preferably 95℃ for 30 s; 95℃ for 15 s, 58℃ for 30 s, 40 cycles.

[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0032] Example 1

[0033] Primer and probe combinations, fluorescent PCR reaction system, and method construction for detecting Brucella vaccine strain RB51

[0034] 1.1 Primer and probe screening and design

[0035] Brucella strains exhibit high genomic homology. To effectively distinguish RB51 from other Brucella strains, MEGA 6 software was used to analyze and compare the whole genome sequences of prevalent Brucella strains and vaccine strains in the GenBank database. Specific loci 965807–965958 in the RB51 genome (GenBank accession number: CP046720.1) were identified. Specific primer pairs RB51-F / RB51-R and probe RB51-P were designed using Oligo 7 software to establish... Taq Man fluorescent PCR primer and probe protocol.

[0036] Primer and probe design region RB51 (see) Figure 1 The specific sequence of the design is as follows: Primer and probe set for detecting Brucella RB51 vaccine strain: Forward primer RB51-F: 5'-TCCTCGATTGCAGACAGGTTC-3' (SEQ ID NO:1); Reverse primer RB51-R: 5'-CCGTACAGATTTCACATAAGCCT-3' (SEQ ID NO:2); Probe RB51-P: 5'-TCCATCCGCACACTACTCACACC-3' (SEQ ID NO:3).

[0037] The detection probe RB51-P is labeled with a carboxyfluorescein group (FAM) at its 5' end and with a quencher group (BHQ1) at its 3' end. Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0038] 1.2 Optimization of primer and probe concentrations, determination of reaction procedure and reaction system

[0039] The upstream and downstream primers and probes of RB51 were diluted to 10 μmol / L using ddH2O. The final concentration ranges of primers and probes in the reaction system were set to 0.20, 0.25, 0.30, 0.35, and 0.40 μmol / L. The final concentration ranges of probes were set to 0.20, 0.25, 0.30, 0.35, and 0.40 μmol / L. Each primer-probe combination was subjected to fluorescent PCR using a matrix method. The primer-probe combination with the minimum Ct value and the best amplification curve was screened to determine the optimal primer and probe concentrations.

[0040] like Figure 2 As shown, the optimal amplification curve for RB51 primers was observed at a concentration of 0.5 μL. With a fixed primer concentration of 0.5 μL, the optimal amplification curve was observed with a 0.5 μL RB51 probe concentration.

[0041] Optimization results: Fluorescent PCR reaction system: RB51-F / R 0.5 μL (0.25 μmol / L), RB51-P 0.5 μL (0.25 μmol / L); 2×Premix Ex Taq Add 10.0 μL of Probe qPCR, 1.0 μL of DNA template, and finally add ddH2O to make up to 20.0 μL.

[0042] Reaction program optimization: Annealing temperatures were set to 50, 52, 54, 56, 58, and 60℃, with six experimental groups. Simultaneously, the number of cycles was optimized while maintaining the annealing temperature, with 40 cycles set to determine the optimal fluorescent PCR reaction program. Based on... Figure 3 The optimization results showed that the optimal amplification curve appeared when the annealing temperature was set to 58℃.

[0043] Reaction program: 95℃ for 30 s; 95℃ for 10 s, 58℃ for 30 s, 40 cycles.

[0044] 1.3 Fluorescent PCR Detection Method for Brucella Vaccine Strain RB51

[0045] The fluorescent PCR detection method for Brucella vaccine strain RB51 includes the following steps: (1) Sample processing: DNA was extracted directly from the sample using commercial nucleic acid extraction reagents, and the obtained nucleic acid samples were stored at -20℃ for later use; (2) Preparation of the fluorescent PCR reaction system: Dilute the upstream and downstream primers and probe of RB51 to 10 μmol / L using ddH2O. Fluorescent PCR reaction system: 0.5 μL each of RB51-F / R (final concentration 0.25 μmol / L), 0.5 μL of RB51-P (final concentration 0.25 μmol / L); 2×Premix Ex Taq Add 10.0 μL of Probe qPCR, 1.0 μL of DNA template, and finally add ddH2O to make up to 20.0 μL.

[0046] (3) Fluorescent PCR amplification: Set the reaction program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle. (4) Result determination: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control; if the sample to be tested has no Ct value or Ct value > 35 and no specific amplification curve, the result is judged as Brucella RB51 nucleic acid negative; if the sample to be tested has a FAM channel Ct value ≤ 35 and a specific amplification curve appears, the result is judged as Brucella RB51 nucleic acid positive.

[0047] 1.4 Preparation of Positive Plasmid Standards

[0048] (1) Preparation of positive plasmids

[0049] Brucella vaccine strain RB51 was derived from a commercially available vaccine manufactured by Choong Ang Vaccine Laboratory Co., Ltd. in South Korea. DNA template for RB51 was extracted using a commercially available DNA extraction kit according to the instructions, and then subjected to routine PCR amplification. The specific steps are as follows: Reaction system preparation: Each tube contains 25 μL of reaction solution and includes Premix. Taq ™ (Ex) Taq 12.5 μL of 10 pmol / μL RB51-F / R (Version 2.0 plusdye), 1.0 μL each of RB51-F / R, and 2.0 μL of the corresponding RB51 DNA template were added to the reaction tube. Finally, ddH2O was added to bring the total volume to 25 μL. (Note: The Premix...) Taq ™ (Ex) Taq The™ Version 2.0 plus dye assay reagent (Cat#:RR902A) was purchased from TaKaRa Biotechnology Co., Ltd., and the RB51 primer pair was synthesized by Sangon Biotech (Shanghai) Co., Ltd. Reaction conditions were set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 40 cycles; final extension at 72℃ for 5 min; stored at 4℃.

[0050] PCR products were subjected to 1.0% agarose gel electrophoresis (see...). Figure 4 The target fragment was recovered and ligated into the pMD19-T vector, transformed into DH5α Escherichia coli, and positive strains identified by PCR were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were consistent with expectations, confirming the strain as a positive case, and its plasmid was extracted as the positive plasmid.

[0051] Plasmid pMD-RB51 contains a gene fragment from the 965807 to 965958 nt length of the Brucella vaccine strain RB51 genome. The sequence of this fragment is as follows: 5'-TCCTCGATTGCAGACAGGTTCTAGACCTATATTACGGCAAACTAAAGGGTAAGATAAAGACAAAGATAGTCGGTGTGAGTAGTGTGCGGATGGACCCATCCCATCGATGGCAGGCCAAGTACGAAAATAAGGCTTATGTGAAATCTGTACGG-3' (SEQ ID NO: 4); (2) Preparation of positive plasmid standards The OD of positive plasmids was determined using an ultra-micro ultraviolet spectrophotometer. 260nm / OD 280nm The ratio and concentration (unit: ng / μL) are calculated using the formula: Plasmid copy number (copies / μL) = (Plasmid concentration × 10^6) / (Cosmid concentration × 10^6) -9 ×6.02×10 23 Calculate its copy number by dividing the number of copies by 660 × plasmid length.

[0052] The RB51 positive plasmid OD was determined. 260nm / OD 280nm The ratio was 1.97, the initial concentration was 149.4 ng / μL, and the copy number was 4.79 × 10⁻⁶. 10 The copy number of the above plasmid was diluted to 3.00 × 10⁻⁶ copies / μL with ddH₂O. 10 After being diluted 10-fold with copies / μL, standards were prepared as follows: Working standard sample 1 contains 3.00 × 10 8 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard sample 2 contains 3.00 × 10 7 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard sample 3 contains 3.00 × 10 6 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard sample 4 contains 3.00 × 10 5 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard sample 5 contains 3.00 × 10 4 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard sample 6 contains 3.00 × 10 3 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard sample 7 contains 3.00 × 10 2 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard sample 8 contains 3.00 × 10 1 Copies / μL of the non-infectious DNA fragment of the positive plasmid RB51.

[0053] 1.5 Sensitivity Test

[0054] The primers and probes screened in section 1.2 were used to prepare the reaction system. A series of working standards and negative controls (composed of nuclease-free water) were tested, and a standard curve was plotted. The specific steps are as follows: (1) Preparation of fluorescent PCR reaction system: The RB51 forward primer, reverse primer and probe were diluted to 10 μmol / L with ddH2O; each reaction tube contained 20 μL of Premix Ex Taq 10.0 μL of Probe qPCR, 0.5 μL of RB51-F, 0.5 μL of RB51-R, 0.5 μL of RB51-P, 1.0 μL of RB51 DNA template, and finally add ddH2O to make up to 20.0 μL; (2) Amplification of the fluorescent PCR reaction system: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s (FAM fluorescence signal was collected at the end of each cycle), for a total of 40 cycles; (3) The result is determined in the same way as in 1.3.

[0055] The sensitivity of this method for detecting RB51 was evaluated using working standards 1-8 and a negative control. The results are as follows: Figure 5 As shown. Working standards 1-8 showed FAM signals and typical amplification curves, while the negative control showed no amplification curve. This indicates that the limit of detection for RB51 using this method is working standard 8, and the sensitivity is 3.00 × 10⁻⁶. 1 copies / μL. A standard curve was plotted using working standards 1-8, as shown below. Figure 6 As shown, the linear equation of the standard curve is: y = -3.392 x +45.315, R 2 =0.997, amplification efficiency Eff%=97.145%.

[0056] The above results indicate that this method has high sensitivity for detecting RB51, and there is a good linear relationship between template concentration and detection value within the detection range.

[0057] 1.6 Repeatability Test

[0058] The primers and probes designed in section 1.2 were used to prepare the reaction system. Three repeated fluorescence PCR tests were performed on working standards 1, 3, and 5 prepared in section 1.4, and the inter-batch coefficient of variation (Ct) was calculated. For each repeated fluorescence PCR test, the Ct values ​​were calculated using the formula: Ct% = (Standard Deviation SD / Mean) × 100%. The specific steps are as follows: (1) Preparation of fluorescent PCR reaction system: Dilute RB51 forward primer, reverse primer and probe to 10 μmol / L with ddH2O; each tube contains 20 μL of reaction solution, 2×Premix Ex Taq 10.0 μL of Probe qPCR, 0.5 μL of RB51-F, 0.5 μL of RB51-R, 0.5 μL of RB51-P, 1.0 μL of RB51 DNA template, and finally add ddH2O to make up to 20.0 μL; (2) Amplification of the fluorescent PCR reaction system: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s (FAM fluorescence signal was collected at the end of each cycle), for a total of 40 cycles; (3) Judgment of results: Same as 1.3.

[0059] The working standard 1, working standard 3 and working standard 5 were repeatedly tested, and the results are shown in Table 1.

[0060] Table 1. Intra-assay and inter-assay repeatability tests of the RB51 fluorescent PCR method.

[0061] As shown in Table 1, the intra-batch and inter-batch repeatability of working standard 1, working standard 3 and working standard 5 are 0.54%≤intra-batch coefficient of variation≤0.61% and 0.47%≤inter-batch coefficient of variation≤1.04%, indicating that the method has good repeatability.

[0062] 1.7 Specificity Test

[0063] (1) Verify the specificity of this method using other Brucella strains and bovine-related pathogens. The primers and probes screened in section 1.2 were used to prepare the reaction system, and other Brucella strains (A19 strain, A19ΔvirB12 gene deletion strain, S19 strain, Rev.1 strain, S2 strain, M5 strain, RM6 strain, BA0711 strain), Bovine Pasteurella multocida, Clostridium perfringens, Bovine Mycoplasma HB150 strain, Bovine Enterovirus, Bovine Viral Diarrhea Virus NM01 strain, Foot-and-Mouth Disease Virus OHM / 02 strain, Bovine Nodular Dermatitis Virus, as well as a positive control (components: pMD-RB51 positive plasmid template and RB51 strain) and a negative control (component: nuclease-free water). Fluorescent PCR reaction system preparation: 2×Premix Ex Taq Add 10.0 μL of Probe qPCR, 0.5 μL of RB51-F, 0.5 μL of RB51-R, 0.5 μL of RB51-P, and 1.0 μL of the DNA template from the sample to be tested. Finally, add ddH2O to bring the total volume to 20.0 μL. (2) Sources of materials: Brucella RB51 strain was derived from a commercial vaccine produced by Choong Ang Vaccine Laboratory Co., Ltd. in South Korea; Brucella A19, S19, Rev.1, S2, and RM6 strains were derived from commercial vaccines produced by Jinyu Baoling Biopharmaceutical Co., Ltd.; Brucella A19ΔvirB12 gene deletion strain and M5 strain were derived from commercial vaccines produced by Tiankang Pharmaceutical Co., Ltd.; Brucella BA0711 strain was derived from a commercial vaccine produced by Chongqing Aolong Biological Products Co., Ltd.; Bovine Pasteurella multocida inactivated vaccine, emphysematous gangrene inactivated vaccine, bovine mycoplasma inactivated vaccine (HB150 strain), bovine viral diarrhea virus inactivated vaccine (NM01 strain), and foot-and-mouth disease virus inactivated vaccine (OHM / 02 strain) were all produced by Jinyu Baoling Biopharmaceutical Co., Ltd.; Bovine enterovirus and bovine nodular dermatitis virus were preserved by Guangxi Animal Disease Prevention and Control Center.

[0064] (3) The specific steps are as follows: 1.7.1 Preparation of Specific Samples: After processing, bacterial and viral samples were directly extracted using the commercially available TaKaRa MiniBEST Bacteria Genomic DNA Extraction kit or TaKaRa MiniBEST Viral RNA / DNA Extraction kit. The kits were sourced from Baori Biotechnology Co., Ltd. The obtained nucleic acid samples were stored at -20℃ for later use. The prepared RB51 DNA template was diluted appropriately for use as a positive control.

[0065] 1.7.2 Detection of specific samples: (1) The preparation of the reaction solution is as described in section 1.2 for the preparation of the fluorescent PCR reaction system; (2) Amplification of the fluorescent PCR reaction system: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s (FAM fluorescence signal was collected at the end of each cycle), for a total of 40 cycles; (3) Judgment of results: Same as 1.3.

[0066] Experimental results: such as Figure 7 As shown in the figure, the positive control RB51 DNA and pMD-RB51 positive plasmid template only showed typical amplification curves with FAM signals, while the negative control showed no amplification signal, thus confirming the validity of the experiment. Other Brucella strains (A19 strain, A19ΔvirB12 gene deletion strain, S19 strain, Rev.1 strain, S2 strain, M5 strain, RM6 strain, BA0711 strain), Pasteurella multocida, Clostridium emphysema, Mycoplasma bovis HB150 strain, bovine enterovirus, bovine viral diarrhea virus NM01 strain, foot-and-mouth disease virus OHM / 02 strain, and bovine nodular dermatitis virus samples tested in this experiment all showed no amplification signal. The results indicate that this method has good specificity and no cross-reactivity with related bacterial and viral samples.

[0067] Example 2

[0068] Triple fluorescent PCR primer-probe combination, reaction system, and method construction for detecting Brucella vaccine strains A19 and RB51

[0069] 2.1 Triple fluorescent PCR primer and probe combination

[0070] A multiplex fluorescent PCR detection method was established using the Brucella universal type (TY) and A19 (S19) vaccine strain identification primer and probe set from "Diagnostic Techniques for Animal Brucellosis" (GB / T 18646-2025), combined with the RB51 primer and probe combination from Example 1.

[0071] The specific sequences of the primer and probe sets for the universal TY strain and vaccine strain A19 are as follows: (1) Universal primer and probe set for detecting Brucella: Forward primer TY-F: 5'-CGCTCGCGCGGTGGAT-3' (SEQ ID NO:5); Reverse primer TY-R: 5'-CTTGAAGCTTGCGGACAGTCACC-3' (SEQ ID NO: 6); Probe TY-P: 5'-ACGACCAAGCTGCATGCTGTTGTCGATG-3' (SEQ ID NO:7).

[0072] (2) Primer and probe set for detecting Brucella A19 vaccine strain and its gene-deleted vaccine, S19 vaccine strain: Forward primer A19-F: 5'-GCGGCTTTTCTATCACGGTATTC-3' (SEQ ID NO:8); Reverse primer A19-R: 5'-CATGCGCTATGATCTGGTTACG-3' (SEQ ID NO: 9); Probe A19-P: 5'-ACACGCCCTAGAACGCCTTTCGGA-3' (SEQ ID NO:10).

[0073] The detection probes TY-P and RB51-P were labeled with an indole dicarbonanocyanine fluorescein group (Cy5) at their 5' ends, A19-P with a phosphoramidite fluorescein group (VIC) at their 5' ends, and TY-P, RB51-P, and A19-P with a quencher group (MGB) at their 3' ends. Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0074] 2.2 Optimization of triple fluorescent PCR primer and probe concentrations, determination of reaction procedure and reaction system

[0075] The TY and A19 upstream and downstream primers and probes of 2.1 were diluted to 10 μmol / L using ddH2O. The final concentration range of primers in the reaction system was set to 0.20, 0.25, 0.30, 0.35, and 0.40 μmol / L, and the final concentration range of probes was set to 0.20, 0.25, 0.30, 0.35, and 0.40 μmol / L. Each primer-probe combination was subjected to singlet fluorescent PCR reaction using the matrix method. The primer-probe combination with the minimum Ct value and the best amplification curve was screened to determine the optimal primer and probe concentrations.

[0076] The reaction program was determined by setting the annealing temperatures to 50, 52, 54, 56, 58, and 60°C, and setting up 6 experimental groups. The number of cycles was optimized with the annealing temperature determined, and the number of cycles was set to 40 to determine the optimal singlet fluorescent PCR reaction program.

[0077] Optimization of reaction conditions: Based on the optimal singlet fluorescent PCR reaction conditions and combined with the RB51 primer-probe combination and reaction system in Example 1, a multiplex fluorescent PCR reaction system and program were established and optimized. The corresponding primers and probes from the optimized singlet fluorescent PCR system were mixed and added to the same system for fluorescent PCR reaction. The ratio of primer pairs in the mixed primers and the probe concentration were adjusted based on the Ct value, fluorescence value, and changes in the amplification curve of the triplet fluorescent PCR amplification results. Multiplex fluorescent PCR amplification was then performed using the optimized reaction system and program.

[0078] Optimization results: Figure 8 and Figure 9 The optimization results show that the optimal amplification curves for triple fluorescent PCR primer additions were found to be 0.5 μL, 0.7 μL, and 0.8 μL for RB51, TY, and A19, respectively. With fixed primer additions, the optimal amplification curves were observed with probe additions of 0.5 μL, 0.7 μL, and 0.8 μL for RB51, TY, and A19, respectively. The triple fluorescent PCR reaction system was as follows: TY-F / R 0.7 μL (0.35 μmol / L), TY-P 0.7 μL (0.35 μmol / L); RB51-F / R 0.5 μL (0.25 μmol / L), RB51-P 0.5 μL (0.25 μmol / L); A19-F / R 0.8 μL (0.40 μmol / L), A19-P 0.8 μL (0.40 μmol / L); 2×Premix Ex Taq ™ (Probe qPCR) 10.0 μL, DNA template 1.0 μL, and finally add ddH2O to make up to 20.0 μL. According to Figure 10 Optimization results showed that when the annealing temperature for triple fluorescent PCR was set to 58℃, RB51, TY, and A19 all exhibited optimal amplification curves.

[0079] Reaction program: 95℃ for 30 s; 95℃ for 10 s, 58℃ for 30 s, 40 cycles.

[0080] 2.3 Triple fluorescence PCR detection method

[0081] The triple fluorescent PCR detection method for Brucella A19 and RB51 includes the following steps: (1) Sample processing: The nucleic acid of the sample to be tested was extracted directly using a commercial DNA extraction kit, and the obtained nucleic acid sample was stored at -20℃ for later use; (2) Preparation of fluorescent PCR reaction system: The upstream and downstream primers and probes of each Brucella were diluted to 10 μmol / L using ddH2O. Multiplex fluorescent PCR reaction system: TY-F / R 0.7 μL (final concentration 0.35 μmol / L), TY-P 0.7 μL (final concentration 0.35 μmol / L); RB51-F / R 0.5 μL (final concentration 0.25 μmol / L), RB51-P 0.5 μL (final concentration 0.25 μmol / L); A19-F / R 0.8 μL (final concentration 0.40 μmol / L), A19-P 0.8 μL (final concentration 0.40 μmol / L); 2×Premix Ex Taq Add 10.0 μL of Probe qPCR, 1.0 μL of DNA template, and finally add ddH2O to make up to 20.0 μL.

[0082] (3) Fluorescent PCR amplification: Set the reaction program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle. (4) Result determination: The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the normal negative control. If the sample to be tested has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as Brucella negative. If the sample to be tested has Ct values ​​≤ 35 in both FAM and Cy5 channels and a specific amplification curve appears, the result is judged as Brucella RB51 nucleic acid positive. If the sample to be tested has Ct values ​​≤ 35 in both VIC and Cy5 channels and a specific amplification curve appears, and the FAM channel has no Ct value and no specific amplification curve, the result is judged as Brucella A19 (S19) nucleic acid positive.

[0083] 2.4 Triple fluorescent PCR specificity test

[0084] (1) The specificity of this method was verified using the sample materials from 1.7 in Example 1. The reaction system was prepared using the triple fluorescent PCR primers and probes selected in 2.2, and other Brucella strains (A19 strain, A19ΔvirB12 gene deletion strain, S19 strain, Rev.1 strain, S2 strain, M5 strain, RM6 strain, BA0711 strain), Bovine Pasteurella multocida, Clostridium perfringens, Bovine Mycoplasma HB150 strain, Bovine Enterovirus, Bovine Viral Diarrhea Virus NM01 strain, Foot-and-Mouth Disease Virus OHM / 02 strain, Bovine Nodular Dermatitis Virus, as well as the positive control (RB51 strain) and the negative control (containing nuclease-free water). Fluorescent PCR reaction system preparation: 2×Premix Ex TaqAdd 10.0 μL of Probe qPCR, 0.7 μL of TY-F, 0.7 μL of TY-R, and 0.7 μL of TY-P; 0.5 μL of RB51-F, 0.5 μL of RB51-R, and 0.5 μL of RB51-P; 0.8 μL of A19-F, 0.8 μL of A19-R, and 0.8 μL of A19-P, along with 1.0 μL of the DNA template from the sample to be tested. Finally, add ddH2O to bring the total volume to 20.0 μL. (2) The specific steps are as follows: 2.4.1 Preparation of specific samples: As in 1.7.1 of Example 1, the RB51 DNA template was prepared and diluted appropriately for use as a positive control.

[0085] 2.4.2 Detection of specific samples: 1) The reaction solution is prepared as described in section 2.3 for the preparation of the fluorescent PCR reaction system; 2) Fluorescent PCR reaction system amplification: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s (at the end of each cycle, FAM, Cy5, and VIC fluorescence signals were collected), for a total of 40 cycles; 3) Result determination: Same as 2.3.

[0086] Experimental results: such as Figure 11 As shown in the figure, the positive control RB51 DNA template showed typical amplification curves with FAM and Cy5 signals, while the negative control showed no amplification signal, confirming the validity of the experiment. In this experiment, Brucella strains A19, A19ΔvirB12 gene deletion strain, and S19 all showed typical amplification curves with VIC and Cy5 signals; other Brucella strains (Rev.1, S2, M5, RM6, and BA0711) only showed typical amplification curves with Cy5 signals; no amplification signals were observed in the nucleic acid samples of Pasteurella multocida, Clostridium perfringens, Mycoplasma bovis HB150, bovine enterovirus, bovine viral diarrhea virus NM01, foot-and-mouth disease virus OHM / 02, and bovine nodular dermatitis virus. The results indicate that this method has good specificity and no cross-reactivity with related bacterial and viral samples.

[0087] 2.5 Detection of field samples

[0088] (1) Clinical samples: 10 milk samples from cows vaccinated with RB51 vaccine, from a vaccinated dairy farm in Pakistan; 20 milk samples from cows vaccinated with A19 vaccine, from a vaccinated dairy farm in Inner Mongolia; 10 abortion swab samples from cows clinically diagnosed with brucellosis, from a cow farm with an outbreak; and 60 vaginal swab samples from clinically healthy but unvaccinated cows, from a brucellosis-free dairy farm in Nanning.

[0089] (2) The specific steps are as follows: 2.5.1 Nucleic acid extraction: Same as 1.7.1 in Example 1.

[0090] 2.5.2 Detection of field samples: 1) The reaction solution is prepared as described in section 2.3 for the preparation of the fluorescent PCR reaction system; 2) Fluorescent PCR reaction system amplification: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s (at the end of each cycle, FAM, Cy5, and VIC fluorescence signals were collected), for a total of 40 cycles; 3) Result determination: Same as 2.3.

[0091] Experimental results are shown in Table 2.

[0092] Table 2. Results of field sample testing

[0093] This method tested 10 milk samples from cows immunized with the RB51 vaccine. One sample showed clear amplification curves in the FAM, Cy5, and VIC channels with a Ct value ≤35, and was therefore considered positive for RB51 nucleic acid. Twenty milk samples from cows immunized with the A19 vaccine were also tested. Four of these samples showed clear amplification curves in the Cy5 and VIC channels with a Ct value ≤35, but no clear amplification curve in the FAM channel with no Ct value or a Ct value >35, and were therefore considered positive for A19 nucleic acid. Ten brucellosis-infected bovine abortion product samples were tested. All ten samples showed a clear amplification curve in the Cy5 channel with a Ct value ≤35, but the FAM and VIC channels showed no clear amplification curves and no Ct value or a Ct value >35. These samples were therefore considered positive for Brucella nucleic acid, except for RB51 and A19 (S19). Sixty vaginal swab samples from clinically healthy, non-immunized bovines were also tested. All samples showed no clear amplification curves in all channels and no Ct value or a Ct value >35, indicating Brucella negativity. All positive PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were verified by BLAST comparison in Genebank. The verification results for all samples were consistent with the results of the fluorescent PCR detection.

[0094] As can be seen from the above embodiments, the primer and probe combination for detecting Brucella vaccine strain RB51 of the present invention can be used alone or in combination with other primer and probe combinations for the detection and identification of Brucella vaccine strain RB51. It has high sensitivity, good specificity, fast detection speed and high throughput, making the differential diagnosis more accurate, economical, efficient and convenient.

[0095] Example 3

[0096] Construction of digital PCR reaction system and method for detecting Brucella vaccine strain RB51

[0097] 3.1 Optimization of primer and probe concentrations, determination of reaction procedure and reaction system

[0098] The upstream and downstream primers and probe of RB51 were diluted to 10 μmol / L using ddH2O. The final concentration range of primers in the reaction system was set to 0.33 μmol / L, and the final concentration range of probes was set to 0.20, 0.33, 0.47, and 0.60 μmol / L. Digital PCR reactions were performed, and the optimal probe concentration was determined by screening for the concentration with the greatest difference in fluorescence amplitude between positive droplet signals (blue) and negative droplet signals (gray) and the highest number of positive droplets.

[0099] Experimental results: such as Figure 12 As shown, when the final probe concentration was 0.33 μmol / L, the difference in fluorescence amplitude between the positive droplet signal (blue) and the negative droplet signal (gray) was the greatest, and the number of positive droplets was the highest.

[0100] Optimization results: Fluorescent PCR reaction system: RB51-F / R 0.5μL (0.33μmol / L), RB51-P 0.5μL (0.33μmol / L); 2×Taq Probe qPCR-Multiplex Mastermix 7.5μL, DNA template 1.0μL, and finally add ddH2O to make up to 15.0μL.

[0101] Reaction program optimization: The annealing temperatures were set to 54°C, 56°C, 58°C, and 60°C, respectively. The optimal fluorescent PCR reaction program was determined using the above method.

[0102] Experimental results: such as Figure 13 As shown, when the annealing temperature is set to 58°C, the difference in fluorescence amplitude between the positive droplet signal (blue) and the negative droplet signal (gray) is the greatest, and the number of positive droplets is the highest.

[0103] Reaction program: 95℃ for 30 s; 95℃ for 10 s, 58℃ for 30 s, 40 cycles.

[0104] 3.2 Digital PCR Detection Method for Brucella Vaccine Strain RB51

[0105] The fluorescent PCR detection method for Brucella vaccine strain RB51 specifically includes the following steps: (1) Sample processing: DNA was extracted directly from the sample using commercial nucleic acid extraction reagents, and the obtained nucleic acid samples were stored at -20℃ for later use; (2) Preparation of digital PCR reaction system: 0.5 μL each of RB51-F / R (final concentration 0.33 μmol / L), 0.5 μL of RB51-P (final concentration 0.33 μmol / L); 7.5 μL of 2×Taq Probe qPCR-Multiplex Mastermix, 1.0 μL of DNA template, and finally add ddH2O to make up to 15.0 μL.

[0106] (3) Digital PCR amplification: Set the reaction program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle.

[0107] 3.3 Sensitivity Test

[0108] Using the reaction system established in 3.1, the serially diluted RB51 positive plasmid (prepared in 1.4) was detected and a standard curve was plotted. The specific steps are as follows: (1) Preparation of positive plasmid standards The copy number of the RB51 positive plasmid (prepared in 1.4) was diluted to 1.00 × 10⁻⁶ using ddH₂O. 10 After being diluted 10-fold with copies / μL, standards were prepared as follows: Working standard d1 contains 1.00 × 10⁻⁶ 4 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard d2 contains 1.00 × 10⁻⁶ 3 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard d3 contains 1.00 × 10⁻⁶ 2 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard d4 contains 1.00 × 10⁻⁶ 1 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard d5 contains 1.00 × 10⁻⁶ 0 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; Working standard d6 contains 1.00 × 10⁻⁶ -1 Copies / μL of the positive plasmid RB51 non-infectious DNA fragment; (2) Preparation of digital PCR reaction system: 0.5 μL each of RB51-F / R (final concentration 0.33 μmol / L), 0.5 μL of RB51-P (final concentration 0.33 μmol / L); 7.5 μL of 2×Taq Probe qPCR-Multiplex Mastermix, 1.0 μL of DNA template, and finally add ddH2O to make up to 15.0 μL.

[0109] (3) Digital PCR amplification: Set the reaction program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle.

[0110] The sensitivity of this method for detecting RB51 was evaluated using working standards d1~d6. The experimental results are as follows: Figure 14 As shown in the figure, working standards d1-d5 showed FAM signals, while working standard d6 showed no FAM signal. The results indicate that the limit of detection for RB51 using this method is working standard d5, and the sensitivity is 1.00 × 10⁻⁶. 0 copies / μL. A standard curve was plotted using working standards d1~d6, as shown below. Figure 15 As shown, the linear equation of the standard curve is: y = -0.9033 x +9.3130, R 2 =0.995.

[0111] The above results demonstrate that this method has extremely high sensitivity in detecting RB51, and exhibits a good linear relationship between template concentration and detection value within the detection range.

[0112] 3.4 Repeatability Test

[0113] Using the reaction system established in section 3.1, three replicate digital PCR tests were performed on working standards 2, 3, and 4 prepared in section 1.4. The coefficient of variation was calculated as CV% = (standard deviation SD / mean Mean) × 100%. The specific steps are as follows: (1) Preparation of digital PCR reaction system: 0.5 μL each of RB51-F / R (final concentration 0.33 μmol / L), 0.5 μL of RB51-P (final concentration 0.33 μmol / L); 7.5 μL of 2×Taq Probe qPCR-Multiplex Mastermix, 1.0 μL of DNA template, and finally add ddH2O to make up to 15.0 μL.

[0114] (2) Digital PCR amplification: Set the reaction program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle.

[0115] The working standard d2, working standard d3 and working standard d4 were repeatedly tested, and the results are shown in Table 3.

[0116] Table 3. Repeatability Test of RB51 Digital PCR Method

[0117] As shown in Table 3, the repeatability of working standard d2, working standard d3 and working standard d4 is 0.92% ≤ coefficient of variation ≤ 4.35%, indicating that the method has good repeatability.

[0118] 3.5 Specificity test

[0119] (1) Verify the specificity of this method using other Brucella strains and bovine-related pathogens. The reaction system was prepared using the primers and probes screened in 3.2, and other Brucella strains (A19, Rev.1, S2, M5, RM6, BA0711), Bovine Pasteurella multocida, Bovine Mycoplasma HB150, Foot-and-mouth disease virus OHM / 02, Bovine nodular dermatosis virus, as well as a positive control (RB51) and a negative control (containing nuclease-free water). The relevant sample sources are the same as in 1.7.

[0120] (2) The specific steps are as follows: 3.5.1 Preparation of specific samples: Same as 1.7.1 in Example 1.

[0121] 3.5.2 Detection of specific samples: (1) Preparation of digital PCR reaction system: 0.5 μL each of RB51-F / R (final concentration 0.33 μmol / L), 0.5 μL of RB51-P (final concentration 0.33 μmol / L); 7.5 μL of 2×Taq Probe qPCR-Multiplex Mastermix, 1.0 μL of DNA template, and finally add ddH2O to make up to 15.0 μL.

[0122] (2) Digital PCR amplification: Set the reaction program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle.

[0123] Experimental results: such as Figure 16As shown in the figure, the total number of amplified droplets in each well exceeded 10,000 and was relatively uniform. The positive control (RB51 strain) showed FAM-positive droplets, while the negative control did not, confirming the validity of the experiment. FAM-positive droplets were not detected in the nucleic acids of other Brucella strains (A19, Rev.1, S2, M5, RM6, BA0711), Pasteurella multocida, Mycoplasma bovis HB150, Foot-and-mouth disease virus OHM / 02, and Bovine nodular dermatitis virus samples tested in this experiment. The results indicate that this method has good specificity and shows no cross-reactivity with related bacterial and viral samples.

[0124] 3.6 Field Sample Testing

[0125] (1) Clinical samples: 10 milk samples from dairy cows immunized with RB51 vaccine, which came from an immunized dairy farm in Pakistan.

[0126] (2) The specific steps are as follows: 3.6.1 Nucleic acid extraction: Same as 1.7.1 in Example 1.

[0127] 3.6.2 Detection of field samples: (1) Preparation of digital PCR reaction system: 0.5 μL each of RB51-F / R (final concentration 0.33 μmol / L), 0.5 μL of RB51-P (final concentration 0.33 μmol / L); 7.5 μL of 2×Taq Probe qPCR-Multiplex Mastermix, 1.0 μL of DNA template, and finally add ddH2O to make up to 15.0 μL.

[0128] (2) Digital PCR amplification: Set the reaction program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, for a total of 40 cycles; and collect the fluorescence signal at the end of each cycle.

[0129] Experimental results: Only 1 out of 10 clinical samples tested positive for 42 FAM-positive droplets, which can be identified as RB51 nucleic acid positive, consistent with the results of fluorescent PCR.

[0130] As can be seen from the above embodiments, the primer and probe combination for detecting Brucella vaccine strain RB51 of the present invention is not only suitable for fluorescent PCR technology, but also for digital PCR technology. It can be used for the specific detection and identification of Brucella vaccine strain RB51, and has extremely high sensitivity, good specificity and fast detection speed, making the differential diagnosis more accurate, economical, efficient and convenient.

[0131] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer-probe combination for detecting Brucella vaccine strain RB51, characterized in that, The primer-probe combination includes the forward primer RB51-F, the reverse primer RB51-R, and the probe RB51-P; The forward primer RB51-F is shown in SEQ ID NO:1, the reverse primer RB51-R is shown in SEQ ID NO:2, and the probe RB51-P is shown in SEQ ID NO:

3.

2. The primer-probe combination according to claim 1, characterized in that, The probe RB51-P has a fluorescent group labeled at its 5' end and a quenching group labeled at its 3' end.

3. A reagent for detecting Brucella vaccine strain RB51, characterized in that, Includes the primer-probe combination as described in claim 1 or 2.

4. A kit for detecting Brucella vaccine strain RB51, characterized in that, Includes the reagent described in claim 3.

5. The use of the primer-probe combination of claim 1 or 2, the reagent of claim 3, or the kit of claim 4 in the preparation of products for detecting Brucella vaccine strain RB51.

6. A method for detecting Brucella vaccine strain RB51 for non-diagnostic purposes, characterized in that, This includes fluorescent PCR detection methods, triple fluorescent PCR detection methods, and digital PCR detection methods.

7. The method according to claim 6, characterized in that, The fluorescent PCR detection method / triple fluorescent PCR detection method includes the following steps: (1) Extract DNA from the sample to be tested; (2) Perform fluorescent PCR / triple fluorescent PCR amplification on the DNA of the sample to be tested in step (1) using the primer and probe combination described in claim 1; (3) The threshold setting principle is based on the threshold line just exceeding the highest point of the amplification curve of the negative control; the judgment criteria of the fluorescent PCR are: if the sample to be tested has no Ct value or Ct value > 35 and no specific amplification curve, the result is judged as Brucella RB51 nucleic acid negative; if the sample to be tested has FAM channel Ct value ≤ 35 and a specific amplification curve appears, the result is judged as Brucella RB51 nucleic acid positive. The criteria for the triple fluorescent PCR are as follows: if the sample has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as Brucella negative; if the Ct values ​​of the universal, A19 and RB51 probe channels of the sample are all ≤ 35 and all show specific amplification curves, the result is judged as Brucella RB51 nucleic acid positive; if the Ct value of the universal and A19 probe channels of the sample is ≤ 35 and a specific amplification curve is shown, but the RB51 probe channel has no Ct value or a Ct value > 35 and no specific amplification curve, the result is judged as Brucella A19 nucleic acid positive; the negative control is nuclease-free water.

8. The method according to claim 7, characterized in that, In the primer-probe combination of the fluorescent PCR detection method, the final concentrations of the forward primer RB51-F, the reverse primer RB51-R, and the probe RB51-P are all 0.2~0.4 μmol / L. The triple fluorescent PCR detection method also includes a primer-probe combination for the universal TY strain and a primer-probe combination for the vaccine strain A19. The universal TY primer-probe combination includes the forward primer TY-F, the reverse primer TY-R, and the probe TY-P; The forward primer TY-F is shown in SEQ ID NO:5, the reverse primer TY-R is shown in SEQ ID NO:6, and the probe TY-P is shown in SEQ ID NO:7; The primer-probe combination for the vaccine strain A19 includes a forward primer A19-F, a reverse primer A19-R, and a probe A19-P; The forward primer A19-F is shown in SEQ ID NO:8, the reverse primer A19-R is shown in SEQ ID NO:9, and the probe A19-P is shown in SEQ ID NO:10; In the triple fluorescent PCR detection method, the final concentrations of the forward primer RB51-F, the reverse primer RB51-R, the probe RB51-P, the forward primer TY-F, the reverse primer TY-R, the probe TY-P, and the forward primer A19-F, the reverse primer A19-R, and the probe A19-P are all 0.2~0.4 μmol / L. The reaction procedure for the fluorescence PCR / triple fluorescence PCR detection method is as follows: 95℃ for 30 s; 95℃ for 10 s, 50~60℃ for 30 s, for 30~45 cycles.

9. The method according to claim 6, characterized in that, The digital PCR detection method includes the following steps: (1) Extract DNA from the sample to be tested; (2) The DNA of the sample to be tested in step (1) is amplified by digital PCR using the primer and probe combination described in claim 1; the negative control is nuclease-free water.

10. The method according to claim 7, characterized in that, In the primer-probe combination of the digital PCR detection method, the final concentrations of the forward primer RB51-F, the reverse primer RB51-R, and the probe RB51-P are all 0.2~0.6 μmol / L. The reaction program for the digital PCR is as follows: 95℃ for 30 s; 95℃ for 15 s, 54~60℃ for 30 s, for 30~45 cycles.

Images