Spatial transcriptomics chip, preparation method therefor, and use thereof
By employing gel layer or shrink film technology to reduce the size of DNA array dots in spatial transcriptome chips, the contradiction between high spatial resolution and high detection sensitivity has been resolved, enabling high-sensitivity analysis at single-cell and subcellular resolutions and promoting the application of spatial omics technology.
Patent Information
- Application Number
- PCT/CN2024/115164
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-08-28
- Publication Date
- 2026-03-05
AI Technical Summary
Existing spatial transcriptome chips present a trade-off between site size and spatial resolution/detection sensitivity, making it impossible to simultaneously achieve high spatial resolution and high detection sensitivity.
The size of spatial capture sequence arrays is reduced by using gel layer or shrink film technology. DNA array chips are formed on the substrate by 3D inkjet printing or photochemical in situ DNA synthesis technology, and DNA sequences are captured by gel layer or shrink film. The volume or area is then reduced proportionally to improve spatial resolution and detection sensitivity.
It achieves high detection sensitivity at single-cell and even subcellular resolution, meeting the need for precise analysis of cellular spatial expression patterns and cell-cell interactions, and promoting the application of spatial omics technology in the biomedical field.
Smart Images

Figure QLYQS_-APPB-I200003 
Figure QLYQS_-APPB-I200004 
Figure QLYQS_-APPB-I200005
Abstract
Description
A spatial transcriptome chip, its preparation method and application Technical Field
[0001] This application belongs to the field of chip fabrication, and relates to a spatial transcriptome chip, its fabrication method and application. Background Technology
[0002] Spatial transcriptomics technology enables in-depth research into cellular expression states and intercellular interactions, finding wide application in life sciences, oncology, and neurodevelopment. Currently, the main methods for implementing spatial transcriptomics technology include: ① Laser microdissection: Under the assistance of an optical microscope, cells of interest are dissected using a laser for subsequent single-cell transcriptome analysis. This method is direct and reliable, providing a wealth of cellular information, but suffers from low throughput and difficulty in comprehensive analysis of large tissue areas; ② Fluorescence imaging-based methods, including in situ hybridization and in situ sequencing. These methods can obtain single-cell and even subcellular resolution information, but can only detect and analyze known sequences, and the process is cumbersome; ③ In situ capture methods: This is currently the mainstream international spatial transcriptome chip method, used by leading international companies such as 10x Genomics. This method enables comprehensive, high-throughput analysis of tissue and cell information, and is simple and low-cost. This method includes array-based spatial barcode in situ capture based on microarray chip technology and random decoding in situ capture based on high-throughput sequencing chips. The first approach suffers from low spatial resolution but high detection sensitivity per site. The second approach suffers from low detection sensitivity per site but high spatial sensitivity. The fundamental reason is that for spatial transcriptome detection, smaller sites can improve spatial resolution (clarity), but they also contain fewer probes, failing to meet the need to detect more transcripts at that site. Larger sites, on the other hand, have more probes, allowing for the detection of more transcripts—the number of molecular tags contained within a single spatial barcode—resulting in higher sensitivity and reducing the likelihood of missing low-abundance transcripts. Therefore, the desire for higher sensitivity to detect more transcripts and the need for clearer spatial resolution to visualize cell boundaries and subcellular structures present a contradiction. There is an urgent need for in-situ capture methods and spatial transcriptome chip solutions that can simultaneously achieve high spatial resolution and high detection sensitivity.
[0003] Hydrogels have advantages such as simple fabrication, low cost, and good biocompatibility, and are widely used in the life sciences. Dilatation microscopy utilizes hydrogels to immobilize biomolecules in tissues, followed by hydrogel expansion to increase the distance between biomolecules, thereby improving the spatial resolution of tissue analysis without changing the spatial resolution of the capture chip. However, this method damages the tissue structure, causing the loss of biomolecules and thus some biomolecular information. Invention Overview
[0004] This application is the first to utilize gel layer or shrink film reduction technology to improve the spatial resolution and detection sensitivity of spatial transcriptomics analysis. By using gel layers or shrink films, the spacing and diameter of the sites are reduced, thus improving spatial resolution. Furthermore, under the same synthesis process, the probe density at each site is increased, meaning the probes within the same area are more densely packed, meeting the requirements for high detection sensitivity. This technique, based on in-situ synthesis of microarray chips followed by gel or shrink film reduction, resolves the current contradiction between high spatial resolution and high detection sensitivity in spatial transcriptomics chips, enabling complete recognition of spatial expression patterns and analysis of cell-cell interactions, thereby promoting the application of spatial omics technology in the biomedical field. Technical issues
[0005] Currently, the contradiction between site size and spatial resolution / detection sensitivity has not been resolved. The idea of shrinking the spatial capture sequence array has not been applied to the field of spatial transcriptome chips. There is no precedent for improving the spatial resolution and detection sensitivity of the capture sequence array by shrinking the probes on the microarray chip through gel or shrink film during the fabrication of spatial transcriptome chips. Technical solutions
[0006] To address the aforementioned technical problems, the purpose of this invention is to provide a spatial transcriptome chip, its preparation method, and its application.
[0007] This application provides a method for preparing a spatial transcriptome chip, which includes the following steps: (1) cleaning the substrate with a plasma machine in an oxygen atmosphere to obtain a pretreated substrate;
[0008] (2) The pretreated substrate is immersed in a hydrophobic silane solution, and then the matrix is etched with a strong corrosive reagent or laser. Then, Spacer reagent and Unylinker molecules are added in sequence to obtain a surface-treated functional patterned chip.
[0009] (3) DNA sequences for spatial transcriptome analysis are synthesized on the surface-treated functional patterned chip by 3D inkjet printing or photochemical in-situ synthesis equipment to obtain a DNA array chip;
[0010] (4) The DNA sequence of the DNA array chip is captured by a gel or shrink film to obtain a gel layer or shrink film containing the captured sequence array;
[0011] (5) The volume or area of the gel layer or shrink film containing the capture sequence array is reduced proportionally to obtain a reduced gel layer or shrink film;
[0012] (6) Fix the shrunken gel layer or shrink film onto the substrate to obtain a spatial transcriptome chip with high spatial resolution and high detection sensitivity.
[0013] This application utilizes 3D inkjet printing in-situ DNA synthesis technology or photochemical in-situ DNA synthesis technology. By proportionally reducing the size of the capture sequence spatial array through gel layer implosion technology or shrinking film, a high spatial resolution and high detection sensitivity spatial transcriptome chip is fabricated. Subsequently, a spatial in-situ capture strategy is used to perform high-throughput in-situ transcriptome analysis, in-situ epigenome analysis, in-situ non-coding RNA analysis, and in-situ proteome analysis on tissue sections, achieving single-cell resolution and even subcellular resolution while improving detection sensitivity, for the construction of precise spatiotemporal maps of biological tissues.
[0014] In the above method, in step (2), the hydrophobic silane is selected from at least one of tridecafluorotetrahydrooctyl-triethoxysilane, fluorooctyltrichlorosilane, (tridecafluoro-1,1,2,2-tetrahydrooctyl)trichlorosilane and (tridecafluoro-1,1,2,2-tetrahydrooctyl)trimethoxysilane;
[0015] The highly corrosive reagents include hydrofluoric acid, ammonium fluoride solution, or sulfuric acid;
[0016] The Spacer reagent is selected from at least one of pentaethylene glycol, hexaethylene glycol, and PEG 800;
[0017] The Unylinker molecule is selected from at least one of the following: the linker shown in formula (1)-(19), the photolytic linker shown in formula (20)-(22), and the linker that can be grafted with multiple functional groups shown in formula (23)-(32):
[0018] ;
[0019] ;
[0020] [Revised according to Rule 26, dated September 29, 2024]
[0021] In the above method, the process of using gel to capture the DNA sequence of the DNA array chip in step (4) is as follows: 1) Modify the ends of the DNA sequence of the DNA array chip with acrylamide groups;
[0022] 2) Add the gel polymerization mixture to the surface of the DNA array chip treated in step 1) to gel, and a gel layer is formed on the surface of the DNA array chip;
[0023] 3) The DNA array chip with a gel layer on its surface obtained in step 2) is treated with an alkaline solution to break the DNA sequence from the substrate and remove the base protecting groups, and the gel layer containing the capture sequence array is collected.
[0024] The process of capturing the DNA sequence of the DNA array chip using a shrink film in step (4) is as follows: the DNA sequence of the DNA array chip is transferred to the shrink film by electrophoresis to obtain the shrink film containing the capture sequence array.
[0025] In this application, the shrink film is a shrinkable film, specifically including polyvinyl chloride and polyethylene uniaxial stretch films.
[0026] In the above method, in step (4)-2), the gel polymerization mixed solution comprises components with the following concentrations:
[0027] Sodium acrylate concentration 3~20%, g / ml;
[0028] Acrylamide / N,N′-methylenebisacrylamide with a mass ratio of 8~30:1 and a mass concentration of 1~10%, g / ml;
[0029] Ammonium persulfate concentration: 0.01%~0.5%, g / ml;
[0030] N,N,N',N'-Tetramethylethylenediamine volume percentage concentration: 0.01%~0.5%, ml / ml;
[0031] The solvent is 1X PBS solution.
[0032] In this application, the mass ratio of acrylamide to N,N′-methylenebisacrylamide can specifically be 19:2.
[0033] In the above method, in steps (4)-3), the alkaline solution is selected from at least one of ethylenediamine, ethanolamine and ammonia.
[0034] In the above method, the proportional reduction in volume or area is 1 / 2 to 1 / 20 of the original.
[0035] In the above method, in step (5), the process of proportionally reducing the gel layer containing the capture sequence array is as follows: the gel layer containing the capture sequence array is subjected to implosion treatment to proportionally reduce the volume of the gel layer and obtain the reduced gel layer.
[0036] In step (5), the shrink film containing the capture sequence dot matrix is subjected to shrinkage treatment to reduce the area of the shrink film proportionally, thereby obtaining the shrunken shrink film.
[0037] In the above method, the implosion treatment conditions are as follows: the gel layer containing the capture sequence array is immersed in an HCl solution with a concentration of 1 mM to 200 mM at room temperature for 5 to 7 hours (specifically 6 hours), and then dried at room temperature.
[0038] In this application, the room temperature is common knowledge in the field, and may specifically be 10~30℃.
[0039] This application also provides a spatial transcriptome chip prepared by the above method.
[0040] The application of the spatial transcriptome chip described in this application in spatial omics analysis of cell tissue sections.
[0041] In the above applications, the spatial omics analysis includes at least one of in situ transcriptome analysis, in situ epigenome analysis, in situ non-coding RNA analysis, and in situ proteome analysis. Beneficial effects
[0042] The spatial transcriptome chip fabrication and experimental method provided in this application, which combines high spatial resolution and high detection sensitivity, can meet the needs of more accurate and comprehensive spatial mapping for single cells and even subcellular structures. Compared with traditional spatial transcriptome schemes, it improves spatial resolution and detection sensitivity. Attached Figure Description
[0043] Figure 1 shows the fabrication process of a spatial transcriptome chip that combines high spatial resolution and high detection sensitivity using gel layer capture.
[0044] Figure 2 shows the etching pattern of the DNA array chip.
[0045] Figure 3 is a schematic diagram of gelation and substrate disconnection.
[0046] Figure 4 shows the implosion of the gel layer.
[0047] Figure 5 shows the fluorescence hybridization diagram of the captured sequence array before and after the gel layer implosion.
[0048] Figure 6 is a schematic diagram of oligonucleotide sequences on a spatial transcriptome chip.
[0049] Figure 7 shows the cDNA library fragment analysis.
[0050] Figure 8 shows the spatial location map of the transcript sequencing information obtained after spatial transcriptome sequencing analysis of tissue sections.
[0051] Figure 9 shows the fabrication process of a spatial transcriptome chip that combines high spatial resolution and high detection sensitivity using a shrink-film capture method. Embodiments of the present invention
[0052] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0053] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0054] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.
[0055] As shown in Figure 1, this application provides a method for preparing a spatial transcriptome chip, including the following steps: (1) cleaning the substrate with a plasma machine in an oxygen atmosphere to obtain a pretreated substrate;
[0056] (2) The pretreated substrate is immersed in a hydrophobic silane solution, and then the matrix is etched with a strong corrosive reagent or laser. Then, Spacer reagent and Unylinker molecules are added in sequence to obtain a surface-treated functional patterned chip.
[0057] (3) DNA sequences for spatial transcriptome analysis are synthesized on the surface-treated functional patterned chip by 3D inkjet printing or photochemical in-situ synthesis equipment to obtain a DNA array chip;
[0058] (4) Modify the DNA sequence of the DNA array chip with acrylamide groups;
[0059] (5) Add the gel polymerization mixture to the surface of the DNA array chip treated in step (4) to gel, and a gel layer is formed on the surface of the DNA array chip.
[0060] (6) The DNA array chip with a gel layer on the surface obtained in step (5) is treated with an alkaline solution to break the DNA sequence from the substrate, while removing the base protection groups and collecting the gel layer containing the capture sequence array.
[0061] (7) The gel layer containing the capture sequence array is subjected to implosion treatment to reduce the volume of the gel layer proportionally, and the imploded gel layer is obtained.
[0062] (8) Fix the gel layer after implosion onto the substrate to obtain a spatial transcriptome chip with high spatial resolution and high detection sensitivity.
[0063] As shown in Figure 9, this application provides another method for preparing a spatial transcriptome chip, including the following steps: (1) cleaning the substrate with a plasma machine in an oxygen atmosphere to obtain a pretreated substrate;
[0064] (2) The pretreated substrate is immersed in a hydrophobic silane solution, and then the matrix is etched with a strong corrosive reagent or laser. Then, Spacer reagent and Unylinker molecules are added in sequence to obtain a surface-treated functional patterned chip.
[0065] (3) DNA sequences for spatial transcriptome analysis are synthesized on the surface-treated functional patterned chip by 3D inkjet printing or photochemical in-situ synthesis equipment to obtain a DNA array chip;
[0066] (4) The DNA sequence of the DNA array chip is transferred onto a shrink film by electrophoresis;
[0067] (5) The shrink film containing the capture sequence dot matrix is shrunk by proportionally reducing the shrink film to obtain the shrunk shrink film;
[0068] (6) Fix the shrunken film onto the substrate to obtain a spatial transcriptome chip with high spatial resolution and high detection sensitivity.
[0069] Example
[0070] The entire implementation process is shown in Figure 1, and the specific steps are as follows:
[0071] (1) Clean the quartz glass with acetone, anhydrous ethanol and ultrapure water in sequence using ultrasonic cleaning, and dry it for later use.
[0072] (2) Place the quartz glass in a vapor deposition apparatus and vapor deposit fluorooctyltrichlorosilane overnight at 200 °C. Clean it with dichloromethane and acetonitrile in sequence, and dry it for later use.
[0073] (3) Use 3D printing equipment to print hydrofluoric acid onto quartz glass and etch hydrophilic patterns, as shown in Figure 2. The pattern is a circular dot array with a dot size of 40 μm and a distance of 50 μm between dots. A total of 120 columns and 400 rows are printed. The glass is cleaned with acetonitrile and dried for later use.
[0074] (4) Place the quartz glass in a 10% (GOPS / anhydrous ethanol) solution and react for 12 hours. Then wash it with anhydrous ethanol and dry it at 120°C for half an hour.
[0075] (5) Immerse the quartz glass in Unylinker solution for 12 hours, wash with anhydrous ethanol and dry.
[0076] (6) Using 3D printing equipment, oligonucleotide sequence arrays were synthesized on hydrophilic patterns by solid-phase synthesis. The oligonucleotide sequences contained the Illumina sequencing platform P5 end adapter sequence, spatial location code (barcode), RNA capture sequence (poly T) and unique molecular identifier (UMI), as shown in Figure 7. Specifically: P5 adapter: CTACACGACGCTCTTCCGATCT, the barcode is the designed 16-base sequence, the UMI is 12 random bases, and the poly T is 15-50 T bases.
[0077] (7) Add an acrylamide group to the end of the oligonucleotide sequence.
[0078] (8) Prepare a gel polymerization mixed solution with the following components: 8% sodium acrylate, 2% acrylamide / N,N′-methylenebisacrylamide (mass ratio of 19:2), 0.07% ammonium persulfate, and 0.07% N,N,N′,N′-tetramethylethylenediamine; the solvent is 1X PBS solution, and the unit of mass concentration is g / ml.
[0079] (9) Add 500 μl of gel polymerization mixture to the surface of quartz glass and react in an anaerobic environment for 2 hours to form a gel layer.
[0080] (10) Soak the quartz glass and the gel layer in ammonia water for 12 hours.
[0081] (11) Peel the gel layer off the quartz glass, clean it, soak it in 2 mM HCl solution for 6 hours, and then dry it. This step is a gel shrinkage step. The acid treatment eliminates the repulsive force between positive charges inside the gel layer, and the water molecules inside the gel layer are dried. As shown in Figure 4, the volume of the gel layer will shrink to 1 / 3 of its original size. Figure 5 shows the fluorescence hybridization diagram of the captured sequence array before and after the gel layer implosion. The shrinkage of the gel layer volume leads to a synchronous shrinkage of the captured sequence array, which improves the spatial resolution.
[0082] (12) Fix the gel layer to a clean quartz glass surface with glue.
[0083] (13) Take fresh mouse brain tissue, embed it with OTC embedding agent, and freeze it in an environment of -80℃; use a cryostat to cut the embedded tissue into slices with a thickness of 10 μm, and attach the slices to the above-fixed gel layer.
[0084] (14) Place the frozen sections in a 37 ℃ oven for 1 min, fix them in methanol solution at -20 ℃ for 20 min, rinse slowly with PBS solution, and then dehydrate with methanol solution. After that, place the quartz slides in an incubation box, add 70 μL of pepsin solution, and permeabilize at 37 ℃ for 15 min; after permeabilization, wash three times with 100 μL of 0.1X SSC solution.
[0085] (15) Add reverse transcription reagent (commercially purchased from Thermo, catalog number EP0753), react at 42 °C for 2 h, and wash with 0.1% SSC solution.
[0086] (16) Add 100 mM KOH solution and react for 5 min to denature the RNA strand. Then add 0.1×SSC solution to wash.
[0087] (17) Add cDNA second strand synthesis reaction reagent (commercially purchased from NEB Company, product catalog number M0212), react at 37 ℃ for 2 h, and wash with EB solution.
[0088] (18) Add 100 mM KOH solution and react for 10 min, then recover the cDNA second strand solution.
[0089] (19) The second strand of cDNA was amplified by PCR, and the distribution of the library fragments is shown in Figure 7.
[0090] (20) The cDNA was used to construct a sequencing library and then subjected to second-generation sequencing. As shown in Figure 8, after the tissue slices were analyzed by spatial transcriptome sequencing, the spatial location map of the transcript sequencing information could be obtained. Industrial applicability
[0091] The high-resolution, high-density spatial transcriptome chip technology of this application has broad application value in fields such as cancer research, microbiology and infection research, developmental biology research, plant and agricultural research, brain and neurodegenerative disease research, and the preparation of diagnostic products.
Claims
1. A method for preparing a spatial transcriptome microarray, characterized in that, The steps include: (1) cleaning the substrate with a plasma machine in an oxygen atmosphere to obtain a pretreated substrate; (2) The pretreated substrate is immersed in a hydrophobic silane solution, and then the matrix is etched with a strong corrosive reagent or laser. Then, Spacer reagent and Unylinker molecules are added in sequence to obtain a surface-treated functional patterned chip. (3) DNA sequences for spatial transcriptome analysis are synthesized on the surface-treated functional patterned chip by 3D inkjet printing or photochemical in-situ synthesis equipment to obtain a DNA array chip; (4) The DNA sequence of the DNA array chip is captured by a gel or shrink film to obtain a gel layer or shrink film containing the captured sequence array; (5) The volume or area of the gel layer or shrink film containing the capture sequence array is reduced proportionally to obtain a reduced gel layer or shrink film; (6) Fix the shrunken gel layer or shrink film onto the substrate to obtain a spatial transcriptome chip with high spatial resolution and high detection sensitivity.
2. The method according to claim 1, characterized in that, In step (2), the hydrophobic silane is selected from at least one of tridecafluorotetrahydrooctyl-triethoxysilane, fluorooctyltrichlorosilane, (tridecafluoro-1,1,2,2-tetrahydrooctyl)trichlorosilane and (tridecafluoro-1,1,2,2-tetrahydrooctyl)trimethoxysilane; The highly corrosive reagents include hydrofluoric acid, ammonium fluoride solution, or sulfuric acid; The Spacer reagent is selected from at least one of pentaethylene glycol, hexaethylene glycol, and PEG 800; The Unylinker molecule is selected from at least one of the following: the linker shown in formula (1)-(19), the photolytic linker shown in formula (20)-(22), and the linker that can be grafted with multiple functional groups shown in formula (23)-(32): ; ; ; ; 。。 3. The method according to claim 1 or 2, characterized in that, The process of using gel capture of the DNA sequence of the DNA array chip in step (4) is as follows: 1) Modify the ends of the DNA sequence of the DNA array chip with acrylamide groups; 2) Add the gel polymerization mixture to the surface of the DNA array chip treated in step 1) to gel, and a gel layer is formed on the surface of the DNA array chip; 3) The DNA array chip with a gel layer on its surface obtained in step 2) is treated with an alkaline solution to break the DNA sequence from the substrate and remove the base protecting groups, and the gel layer containing the capture sequence array is collected.
4. The method according to claim 3, characterized in that, In step (4)-2), the gel polymerization mixed solution comprises components with the following concentrations: Sodium acrylate concentration 3~20%, g / ml; Acrylamide / N,N′-methylenebisacrylamide with a mass ratio of 8~30:1 and a mass concentration of 1~10%, g / ml; Ammonium persulfate concentration: 0.01%~0.5%, g / ml; N,N,N',N'-Tetramethylethylenediamine volume percentage concentration: 0.01%~0.5%, ml / ml; The solvent is 1X PBS solution; In steps (4)-3), the alkaline solution is selected from at least one of ethylenediamine, ethanolamine and ammonia.
5. The method according to claim 1 or 2, characterized in that, The process of capturing the DNA sequence of the DNA array chip using a shrink film in step (4) is as follows: the DNA sequence of the DNA array chip is transferred to the shrink film by electrophoresis to obtain the shrink film containing the capture sequence array.
6. The method according to claim 1 or 2, characterized in that, The proportional reduction in volume or area is 1 / 2 to 1 / 20 of the original.
7. The method according to claim 6, characterized in that, In step (5), the process of proportionally reducing the gel layer containing the capture sequence array is as follows: the gel layer containing the capture sequence array is subjected to implosion treatment to proportionally reduce the volume of the gel layer, thereby obtaining the reduced gel layer.
8. The method according to claim 7, characterized in that, The implosion treatment conditions are as follows: the gel layer containing the capture sequence array is immersed in an HCl solution with a concentration of 1 mM to 200 mM at room temperature for 5 to 7 hours, and then dried at room temperature.
9. The method according to claim 6, characterized in that, In step (5), the shrink film containing the capture sequence dot matrix is subjected to shrinkage treatment to reduce the area of the shrink film proportionally, thereby obtaining the shrunken shrink film.
10. A spatial transcriptome chip prepared by the method of any one of claims 1-9.
11. The application of the spatial transcriptome chip of claim 10 in spatial omics analysis of cell tissue sections.
12. The application according to claim 11, characterized in that, The spatial omics analysis includes at least one of in situ transcriptomics analysis, in situ epigenomic analysis, in situ non-coding RNA analysis, and in situ proteomics analysis.
Citation Information
Patent Citations
De novo synthesized gene libraries
CN105637097A
Multi-omics chip based on spatial interleaving coding and preparation method and application thereof
CN115386965A
Three-dimensional nanofabrication by patterning of hydrogels
US20170081489A1
Method and system for fabricating DNA sequencing arrays
US20210032776A1
Enhanced chemical and biological detections with size-shrinkable hydrogels
US20220326210A1