RNAi therapy for cerebral ischemia

Abstract

The present invention provides a new method for treating cerebral ischemia, which comprises administering a polymer nanocapsule or a composition thereof. The nanocapsule comprises a polymer shell and an RNAi (e.g., miRNA) molecule, wherein the polymer shell comprises a) at least one positively charged monomer, b) at least one degradable cross-linking agent, and c) at least one neutral monomer; and the RNAi molecule provides therapeutic benefits for a subject suffering from cerebral ischemia. The present invention also discloses a composition of the polymer nanocapsule.

Description

[0001] Related Applications

[0002] This application claims the benefit of priority to U.S. Provisional Application No. 62 / 440,882, filed December 30, 2016, the contents of which are incorporated herein by reference in their entirety.

[0003] background

[0004] Ischemia caused by arterial blood supply blockage can lead to a serious imbalance between metabolic supply and demand, resulting in hypoxia and dysfunction of downstream tissues. In particular, cerebral ischemia is the most difficult to treat, causing high mortality and disability rates (the second leading cause of death and the third leading cause of disability in the world). Current treatments for cerebral ischemia focus on improving or restoring blood flow, improving perfusion of affected brain areas, and inducing regeneration of affected brain tissue. In this case, thrombolytic drugs are usually given by intravenous or intra-arterial infusion to dissolve blood clots at the time of thrombolysis after the actual ischemic stroke. For regenerative purposes, neurotrophic drugs have been tested in small trials. However, their effectiveness remains inconclusive. Although positive results have been shown in intravenous transplantation of autologous bone marrow cells or intracerebral transplantation of neural stem cells, such transplantation strategies require expensive and complicated procedures.

[0005] Systemic delivery of microRNAs (a class of molecules that regulate the expression of cellular proteins associated with angiogenesis, cell growth, proliferation, and differentiation) holds great promise in the treatment of cerebral ischemia. However, their therapeutic effectiveness is limited by the poor delivery efficiency of microRNAs. MicroRNAs (miRNAs) are a family of small noncoding RNAs with a length of 21-25 nucleotides that regulate the expression of various cellular proteins associated with angiogenesis, cell growth, proliferation, and differentiation. Administration of miRNAs can enhance blood vessel growth and help restore the function of damaged tissues, which may provide an effective strategy for the treatment of ischemic diseases. In fact, it has been demonstrated that local administration of miRNAs to isolated anatomical sites can promote functional recovery in models of cerebral ischemia; however, this invasive approach requires multiple injections into target sites or anatomically distinct regions. On the other hand, systemic administration of miRNAs is highly acceptable in clinical practice, but remains ineffective for the treatment of cerebral ischemia. To date, viral and nonviral vectors (such as lipids, peptides, cyclodextrins, and polymers) have been extensively explored to deliver miRNAs systemically. However, systemic delivery of miRNAs for brain tissue regeneration has not yet been demonstrated.

[0006] Therefore, a more effective and feasible delivery method is highly desirable for the treatment of ischemia and other diseases.

[0007] Overview

[0008] The present invention provides compositions and therapies for treating diseases (including diseases characterized by gene disorders) based on nucleic acid nanocapsules. The disclosed compositions enable them to be effectively delivered to disease sites in the brain, such as infarct sites or other vascular injury sites. Taking microRNA-21 as an example, intravenous injection of nanocapsules into a rat model of cerebral ischemia can effectively improve infarct volume, neurological defects and histopathological severity. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 It contains two subgraphs, namely Figure 1 A and 1B, which depict the schematic diagram of the synthesis of miRNA nanocapsules and their systemic delivery for the treatment of cerebral ischemia. The synthesis of miRNA nanocapsules includes step I for enriching monomers and cross-linking molecules around miRNA molecules and step I for forming n(miRNA) while growing a thin polymer shell around the miRNA molecules ( Figure 1 A). Systemic delivery of n(miRNA) for ischemic treatment involves: (I) accumulation of n(miRNA) in the ischemic area of ​​brain tissue due to increased vascular permeability; (II) cellular uptake of n(miRNA) and release of miRNA in the cytosol; and (III) the delivered miRNA promotes neuronal regeneration ( Figure 1 B).

[0011] Figure 2 Contains 9 subgraphs, namely Figure 2 A-2I, which describes the structure, size, stability, protein adsorption and degradation kinetics of miR-21 nanocapsules. Agarose gel electrophoresis of n(miR-21) synthesized at different monomer / miRNA (M / R) molar ratios ( Figure 2 A). Figure 2 B shows the stability of Lipo / miR-21 complexes and n(miR-21) synthesized at different M / R molar ratios after incubation with 10 mg / mL heparin. Transmission electron microscopy (TEM) images of n(miR-21) synthesized with an M / R ratio of 6000:1 are shown here ( Figure 2 C) Fluid dynamics size ( Figure 2 D) and zeta potential ( Figure 2 E). The hydrodynamic size and zeta potential were measured by dynamic light scattering (DLS) at a scattering angle of 173°. The residual miR-21 levels of native miR-21, Lipo / miR-21, and n(miR-21) were compared after incubation with mouse whole serum or RNase for 2 h at 37°C. Figure 2 F). Residual miRNA was then extracted with chloroform / 0.1% SDS-0.5 M NaCl and measured by qRT-PCR. Data are shown as mean ± SD (n =3). ** P <0.01,*** P <0.001 and **** P <0.0001 (Turkey post hoc test followed by ordinary one-way ANOVA). Figure 2 Quantification of serum proteins adsorbed by n(miR-21) and Lipo / miR-21 after incubation with whole mouse serum is shown in G. Data are presented as mean ± SD (n=3). ** P <0.01 (Turkey post hoc test followed by ordinary one-way ANOVA). The relative scattered light intensity of n(miR-21) after incubation in 50 mM sodium acetate buffer (pH 5.5) and 50 mM HEPES buffer (pH 7.4) at 37°C for 2 h was compared ( I / I 0 × 100%) changes, where I 0 is the initial n(miR-21) scattered light intensity, and I is the scattered light intensity measured at different time points, with a detection angle of 173° ( Figure 2 H). Data were normalized to facilitate direct comparison and are expressed as mean ± SD ( n =5). After incubation in 50 mM sodium acetate buffer (pH 5.5) and 50 mM HEPES buffer (pH 7.4) at 37°C for 2 h, the agarose gel electrophoresis of n(miR-21) was as shown in Figure 2 I. The symbol "-" indicates "without 1 mg / mL heparin incubation" and "+" indicates "with 1 mg / mL heparin incubation", respectively.

[0012] Figure 3 It includes three subgraphs, namely Figure 3 A-3C, which shows the properties of nanocapsules synthesized with different monomer:RNA (M:R) molar ratios, including a range of synthesis parameters for n(miR-21) with monomer:RNA molar ratios ( Figure 3 A), size distribution ( Figure 3 B) and zeta potential trends ( Figure 3 C). Figure 3 B and Figure 3 The data in C are expressed as mean ± SEM ( n =3).

[0013] Figure 4 Four subgraphs, namely Figure 4A-4D, which shows the characteristics of nanocapsules synthesized with different mPEG / miRNA molar ratios at an M:R ratio of 6000:1, including the synthesis parameters of n(miR-21) ( Figure 4 A) Agarose gel electrophoresis ( Figure 4 B), size distribution and PDI ( Figure 4 C) and zeta potential trends ( Figure 4 D). Figure 4 C and Figure 4 The data in D are expressed as mean ± SEM ( n =3).

[0014] Figure 5 It consists of two subgraphs, namely Figure 5 A and 5B, which depict C6 cells treated with miR-21 and n(miR-21) ( Figure 5 A) and J774A.1 cells ( Figure 5 B) Fluorescence assisted cell sorting analysis of miR-21 and n(miR-21) synthesized with different mPEG / miRNA molar ratios at an M:R ratio of 6000:1. C6 and J774A.1 cells were treated with 50 nM miRNA samples at 37°C for 4 hr. MiR-21 was labeled with FITC. Trypan blue quenching analysis was performed before measurement.

[0015] Figure 6 It includes three subgraphs, namely Figure 6 A-6C, which describes the properties of synthetic n(miR-21), including the stability of n(miR-21) synthesized at a monomer / miRNA molar ratio of 6000 in PBS (pH 7.4) at 4°C ( Figure 6 A), Temperature-dependent size change of n(miR-21) in PBS buffer at different temperatures of 25, 37 and 60 °C ( Figure 6 B), and the hydrodynamic size of n(miR-21) in the presence or absence of PBS buffer containing 10% serum ( Figure 6 C). All data in the three panels are expressed as mean ± SEM ( n =3).

[0016] Figure 7 Describes the quantification of serum protein adsorbed by n(miR-21) synthesized at an M:R ratio of 6000:1 and n(miR-21) synthesized at an M:R ratio of 6000:1 but without mPEG (no-PEG n(miR-21)) after incubation with whole mouse serum. Data are shown as mean ± SD ( n =3). * P <0.05 and * P<0.01 (Turkey post hoc test followed by ordinary one-way ANOVA).

[0017] Figure 8 It includes 8 sub-graphs, namely Figure 8 A-8H, which describes the cytotoxicity, cellular internalization efficiency, nonspecific phagocytosis and intracellular activity of miRNA nanocapsules. Confocal micrographs of the intracellular distribution of miR-21, n(miR-21) and Lipo / miR-21 in C6 cells after incubation at 37°C for 4 h. Figure 8 As shown in A. Scale bar: 20 µm. miR-21 was labeled with FITC. Cells were counterstained with DAPI (for nuclei) and DiI (for cell membranes). Scale bar: 20 µm. Fluorescence assisted cell sorting (FACS) analysis of C6 cells after incubation with miR-21 and n(miR-21) at 37°C for 4 hours is shown in Figure 8 In B, miR-21 was labeled with FITC. Trypan blue quenching analysis was performed before measurement. Cell viability assay of n(miR-NC) in C6 cells after incubation at 37°C for 4 h is shown in Figure 8 C. Data are shown as mean ± SD (n=5). Fluorescence images of J774A.1 mouse macrophages incubated with n(miR-21) and Lipo / miR-21 at 37°C for 1 hour are shown in Figure 8 D. MiR-21 was labeled with FITC. Cells were stained with Hoechst 33342 for imaging of nuclei. Scale bar: 100 µm. Histograms comparing mean fluorescence intensity obtained by FACS analysis of macrophages after incubation with n(miR-21) and Lipo / miR-21 ( Figure 8 E). Data are shown as mean ± SD ( n =3).*** P <0.001 (Turkey post hoc test followed by ordinary one-way ANOVA). Real-time quantitative PCR analysis was performed to compare the miR-21 levels in C6 cells treated with different samples in serum-free medium or 50% human serum medium ( Figure 8 F). Data are shown as mean ± SD ( n =3). * P <0.05 and ** P <0.01 (Turkey post hoc test followed by ordinary two-way ANOVA). Western blot analysis of protein expression in C6 cells 48 hours after sample administration is shown in Figure 8 G. Protein expression levels were quantified using ImageJ software. Figure 8 The normalized gray value obtained in G ( Figure 8 H).

[0018] Fig. 9 It includes 3 sub-graphs, namely Fig. 9 A-9C, which depicts the characteristics of J774A.1 mouse macrophages after treatment with n(miR-21). Fig. 9 A Comparison of fluorescence images of J774A.1 mouse macrophages after 1 hour of incubation with n(miR-21) and n(miR-21 without PEG). Cells were stained with Hoechst 33342 for imaging of nuclei. MiR-21 was labeled with FITC. Scale bar: 100 µm. FACS analysis of J774A.1 macrophages after incubation with n(miR-21), n(miR-21 without PEG, and Lipo / miR-21 ( Fig. 9 B). Histograms were performed to compare the mean fluorescence intensity obtained from FACS analysis of macrophages after incubation with n(miR-21) and no-PEG n(miR-21) ( Fig. 9 C). Data are shown as mean ± SD ( n =3). * P <0.05 (Turkey post hoc test followed by ordinary one-way ANOVA).

[0019] Fig.10 It includes 3 sub-graphs, namely Fig.10 A-10C, which depicts quantitative real-time PCR analysis of miR-21 levels in C6 cells treated with various samples in serum-free medium or 50% human serum medium. Data are shown as mean ± SD ( n =3). ** P <0.01 (Turkey post hoc test followed by ordinary two-way ANOVA).

[0020] Fig.11 It includes two subgraphs, namely Fig.11 A and 11B, which depict Western blot analysis of protein expression in C6 cells 48 hours after sample administration ( Fig.11 A) and normalized protein expression levels obtained from quantitative analysis using ImageJ software ( Fig.11 B).

[0021] Fig.12 It includes 9 subgraphs, namely Fig.12 A-12I, which describes the biodistribution, pharmacokinetics, and administration route comparison of miRNA nanocapsules. Fig.12 A shows in vivo fluorescence images of rats with ischemia (transient focal cerebral ischemia) model or non-ischemic rats (top), and intravenous ( iv.) In vitro fluorescence images of brain tissue collected 24 hours after administration of 0.5 mg / kg miR-21 Cy5.5-labeled miR-21 nanocapsules (n(Cy5.5-miR-21)) (bottom), and an equal volume of PBS was administered as a control. ROI analysis of the fluorescence signal of the collected brain tissue was performed ( Fig.12 B) and mature miR-21 levels ( Fig.12 C). Data are shown as mean ± SD ( n =5). * P <0.05 and ** P <0.001 (Turkey post hoc test followed by ordinary two-way ANOVA). Fig.12 D) and ROI analysis of fluorescence signals ( Fig.12 E) shows the main organs collected 24 hours after injection of Lipo / Cy5.5-miR-21 and n(Cy5.5-miR-21) (dose of 0.5 mg miR-21 / kg rat), and an equal volume of PBS was given as a control. Data are shown as mean ± SD ( n =5). * P <0.05 (two-tailed unpaired Student's t-test). Fig.12 F Comparison of the blood circulation profiles of n(Cy5.5-miR-21) in rats after intravenous injection of Lipo / Cy5.5-miR-21 and n(Cy5.5-miR-21) (at a dose of 0.5 mg / kg miR-21). Inset: Enlarged blood circulation profiles for the first 2 hours, which are plotted on a logarithmic y-axis. Data are shown as mean ± SEM ( n =5). Fig.12 G compares the in vivo fluorescence images of rats with ischemia model (top) and in the carotid artery ( ic .)or iv . In vitro images of brains collected 24 hours after injection of different doses of n(Cy5.5-miR-21) (bottom). Fig.12 ROI analysis of fluorescence signals measured in brain tissue collected in G ( Fig.12 H) and mature miR-21 levels ( Fig.12 I). Data are shown as mean ± SEM ( n =5). The significance level is * P <0.01 and ** P <0.001 (Turkey post hoc test followed by ordinary one-way ANOVA).

[0022] Fig.13Depicted are representative H&E-stained images of brain tissues obtained from sacrificed MCAO / R or normal rats.

[0023] Fig.14 Included are six sub-figures, 14A-14F, which depict the efficacy of miRNA nanocapsules as therapeutic agents for transient focal cerebral ischemia. Fig.14 A compares the neurological function of rats with transient focal cerebral ischemia model after sample administration. Arrows indicate the time point of sample administration. Neurological deficit scores were tested every other day before each injection. Data are shown as mean ± SEM ( n =10). * P <0.05 and ** P <0.01 (Bonferroni multiple comparison test followed by two-way RMANOVA). TTC staining of brain tissues obtained from rats sacrificed on day 7 is shown in Fig.14 B. From Fig.14 B Quantification of cerebral infarction volume ( Fig.14 C). Data are shown as mean ± SEM ( n =5). * P <0.05 and ** P <0.01. (Turkey post hoc test followed by ordinary one-way ANOVA). Representative HE staining images of the infarcted area are shown in Fig.14 D. Scale bar: 400 µm. Representative fluorescence in situ hybridization assays for miR-21 in the infarcted area were performed ( Fig.14 E). Blue indicates DAPI and red indicates miR-21. Scale bar: 100 µm. Representative immunohistochemical images of infarcted areas are shown in Fig.14 F. Scale bar: 400 µm (upper) and scale bar: 150 µm (lower).

[0024] Fig.15 It includes two subgraphs, namely Fig.15 A and 15B, which depict representative fluorescence images of TUNEL analysis of infarcted areas of brain tissue ( Fig.15 A) (blue for DAPI and green for FITC) and the apoptosis index of the infarcted area of ​​brain tissue obtained from the quantitative analysis of TUNEL analysis (Figure 165). Data are shown as mean ± SEM ( n =3).*** P <0.001 (Turkey post hoc test followed by ordinary one-way ANOVA).

[0025] Fig.16 Representative H&E-stained images of major organs after a 7-day treatment period are depicted.

[0026] Detailed Description

[0027] definition

[0028] For convenience, the meanings of certain terms and phrases used in the specification, examples and appended claims are provided below.

[0029] As used herein, the term "target" refers to a DNA or RNA strand of double-stranded DNA or RNA that is complementary to a DNA or RNA strand (including all transcription regions) used as a transcription substrate. The target gene, usually the sense strand, is a gene whose expression is selectively inhibited or silenced by RNA interference and / or microRNA.

[0030] As used herein, the term "polymer nanocapsule" refers to a composition comprising a "polymer shell" and an "RNAi molecule" such as a "microRNA molecule".

[0031] As used herein, the term "polymer shell" refers to the polymer portion of the microRNA polymer nanocapsule, which comprises one or more positively charged polymer monomers, one or more cross-linking agents, and optionally one or more neutral polymer monomers. Examples of positively charged monomers, cross-linking agents, and neutral monomers are provided in Tables 1, 2, and 3 of U.S. Patent Application Publication No. US 2015 / 0071999, which are incorporated herein by reference in their entirety.

[0032] As used herein, the term "microRNA molecule" refers to any microRNA (abbreviated "miRNA"), which is a small non-coding RNA molecule (containing about 22 nucleotides), whether found naturally (e.g., in plants, animals and certain viruses) or artificially or synthetically produced, that plays a role in RNA silencing and post-transcriptional regulation of gene expression (see Ambros (2004) Nature . 431:350-355; Bartel (2004) Cell116:281-297). Although naturally occurring miRNAs are usually located inside cells, some miRNAs have also been found in the extracellular environment (including various biological fluids and cell culture media), which are usually called circulating miRNAs or extracellular miRNAs. miRNAs are complementary to a portion of one or more messenger RNAs (mRNAs). Animal miRNAs are usually complementary to sites in the 3' UTR, while plant miRNAs are usually complementary to the coding region of the mRNA. Perfect or near-perfect base pairing with the target RNA promotes RNA cleavage. This is a typical pattern for plant miRNAs. In animals, pairing is usually imperfect. miRNAs sometimes also cause DNA methylation and histone modifications at promoter sites, which affect the expression of target genes. Nine miRNA mechanisms of action were described and assembled in a unified mathematical model: Cap-40S initiation inhibition; 60S ribosomal unit attachment inhibition; elongation inhibition; ribosome shedding (premature termination); co-translational nascent protein degradation; sequestration in P-bodies; mRNA decay (destabilization); mRNA cleavage; and transcriptional repression by microRNA-mediated chromatin reorganization followed by gene silencing (Morozova et al., 2005). et al. (2012) RNA 18:1635-1655).

[0033] As used herein, the terms "degradable polymer" and "non-degradable polymer" refer to the ability of the polymers described herein to degrade into smaller fragments. In certain embodiments of the present invention, the degradable polymer will decompose at physiological pH. In certain embodiments, the degradable polymer can decompose at about pH 7.4. In certain embodiments, a mixture of degradable and non-degradable polymers can produce a degradable polymer mixture. In certain embodiments, a mixture of degradable and non-degradable polymers will decompose at physiological pH. In certain embodiments, a mixture of degradable and non-degradable polymers can decompose at about pH 7.4.

[0034] As used herein, the terms "mutant gene" and "target mutant gene" refer to a gene that contains at least one point mutation relative to a corresponding normal, non-mutated cellular gene (referred to herein as the "corresponding wild-type gene"). The terms mutant gene and target mutant gene specifically include any variant of a normal cellular gene or gene fragment (e.g., an oncogene) whose expression is associated with a disease or disorder.

[0035] As used herein, the term "conjugate" or "conjugate" or "surface conjugated targeting agent" or "polymer nanocapsule conjugate" refers to any part, such as a protein or an effective part thereof, which is conjugated to a polymer nanocapsule and provides specific targeting of the polymer nanocapsule to the surface of a specific cell type, thereby enabling RNAi molecules (e.g., microRNAs) to be directed to a specific cell type. For example, the conjugate can be bound to a cell-specific cell surface receptor, thereby allowing the polymer nanocapsule to directly approach the target cell. In certain embodiments, the conjugate used to achieve specific targeting of the polymer nanocapsule includes CD4, CD8, CD45, CD133, aHLA, and transferrin. In other embodiments, the conjugate can be a cell-specific antibody or a fragment thereof. Other examples of conjugates for targeting specific cell types are described in the detailed description below.

[0036] The term "complementary RNA strand" (also referred to herein as "antisense strand") refers to a dsRNA strand that is complementary to an mRNA transcript or its processed product formed during the expression of a target gene. As used herein, the term "complementary nucleotide sequence" refers to a region on a complementary RNA strand that is complementary to a region of an mRNA transcript of a target mutant gene (i.e., the "corresponding nucleotide sequence" of a target gene). "dsRNA" refers to a ribonucleic acid molecule having a duplex structure comprising two complementary and antiparallel nucleic acid strands. Not all dsRNA nucleotides must exhibit Watson-crick base pairs. The maximum number of base pairs is the number of nucleotides in the shortest strand of a dsRNA. RNA strands may have the same or different numbers of nucleotides. The length of the complementary nucleotide region of a complementary RNA strand is less than 25, preferably 19-24, more preferably 20-24, even more preferably 21-23, and most preferably 22 or 23 nucleotides. The length of a complementary RNA strand is less than 30, preferably less than 25, more preferably 21-24, and most preferably 23 nucleotides. dsRNA (referred to as "short interfering RNA" or "siRNA") containing complementary or antisense strands of this length is particularly effective in inhibiting the expression of target mutant genes. "Introduction" refers to uptake or absorption in a cell, as understood by those skilled in the art. The absorption or uptake of nucleic acids such as microRNAs can occur through cellular processes or through auxiliary agents or devices. For example, when delivered in vivo, the microRNA can be injected into a tissue site or administered systemically. In vitro delivery includes methods known in the art, such as electroporation and lipofection.

[0037] As used herein, "selective inhibition of expression" means that the dsRNA and / or miRNA has a greater inhibitory effect on the expression of the target mutant gene than on the corresponding wild-type gene. Preferably, the expression level of the target mutant gene is less than 98%, less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20% or less than 10% of the expression level of the corresponding wild-type gene.

[0038] As used herein and known in the art, the term "identity" is the relationship between two or more polynucleotide sequences, as determined by comparing sequences. Identity also means the degree of sequence relatedness between polynucleotide sequences, as determined by the matching between the character strings of these sequences. Identity can be easily calculated (see, for example, Computation Molecular Biology, Lesk, AM, eds., Oxford University Press, New York (1998), and Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York (1993), both of which are incorporated herein by reference). Although there are many methods to measure the identity between two polynucleotide sequences, the term is well known to those skilled in the art (see, for example, Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press (1987); and Sequence Analysis Primer, Gribskov., M. and Devereux, J., eds., M.Stockton Press, New York (1991)). Methods commonly used to determine the identity between sequences include, for example, those disclosed in Carillo, H. and Lipman, D., SIAM J. Applied Math. (1988) 48: 1073. As used herein, "substantially identical" means that there is a high degree of homology (preferably 100% sequence identity) between the sense strand of the dsRNA and / or miRNA and the corresponding portion of the target gene. However, dsRNA and / or miRNA having greater than 90% or 95% sequence identity can be used in the present invention, so sequence variations that can be expected due to gene mutations, strain polymorphisms or evolutionary divergence can be tolerated. Although 100% identity is preferred, the dsRNA and / or miRNA may contain single or multiple random mismatches of base pairs between the RNA and the target gene.

[0039] As used herein, the term "treatment" refers to the application or administration of a therapeutic agent to a patient, or to an isolated tissue or cell line from a patient, who has a disorder, such as a disease or condition, a symptom of a disease, or a susceptibility to a disease, for the purpose of curing, healing, alleviating, alleviating, altering, treating, ameliorating, improving, or affecting the disease, a symptom of a disease, or a susceptibility to a disease.

[0040] As used herein, a therapeutic agent that "prevents" a condition, disorder, or disease refers to a therapeutic agent, such as the polymeric nanocapsules described herein (or compositions comprising them), which, in a statistical sample, reduces the occurrence of the disorder or condition in treated samples relative to untreated control samples, or delays the onset of or reduces the severity of one or more symptoms of the disorder or condition relative to untreated control samples.

[0041] As used herein, a "pharmaceutical composition" includes a pharmacologically effective amount of a therapeutic agent, such as a miRNA, and a pharmaceutically acceptable carrier. As used herein, a "pharmacologically effective amount", "therapeutically effective amount" or simply "effective amount" refers to an amount of RNA that is effective to produce a predetermined pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or disorder is reduced by at least 25%, then the therapeutically effective amount of a drug for treating the disease or disorder is the amount necessary to reduce the parameter by at least 25%.

[0042] The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to saline, buffered saline, glucose, water, glycerol, ethanol and combinations thereof. The term particularly does not include cell culture media. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, colorants and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, while lubricants, if present, are generally magnesium stearate, stearic acid or talc. If necessary, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract.

[0043] The term "cerebral ischemia" refers to cerebral ischemia and / or cerebrovascular ischemia, a condition in which the blood flow to the brain is insufficient to meet metabolic demands. This results in poor oxygen supply or lack of oxygen to the brain, thus leading to brain tissue death or cerebral infarction / ischemic stroke. It is a subtype of stroke, along with subarachnoid hemorrhage and intracerebral hemorrhage. Ischemia leads to altered brain metabolism, reduced metabolic rate, and energy crisis. The broad term "stroke" can be divided into 3 categories: cerebral ischemia, subarachnoid hemorrhage, and intracerebral hemorrhage. Cerebral ischemia can be further subdivided into thrombotic, embolic, and hypoperfusion based on the cause. Thrombotic and embolic are generally focal or multifocal in nature, while hypoperfusion affects the entire brain. Focal cerebral ischemia occurs when a blood clot blocks a cerebral blood vessel. Focal cerebral ischemia reduces blood flow to a specific brain area, increasing the risk of cell death in that specific area. It can be caused by thrombosis or embolism. Global cerebral ischemia occurs when blood flow to the brain stops or is sharply reduced. This is usually caused by cardiac arrest. If adequate circulation is restored in a short time, the symptoms may be transient. However, if a large amount of time passes before recovery, brain damage may be permanent. Although reperfusion is necessary to protect as much brain tissue as possible, it may also cause reperfusion injury. Reperfusion injury is divided into damage that follows the restoration of blood supply to the ischemic tissue. In this application, the scope of cerebral ischemia is broad enough to cover any thrombotic, embolic and hypoperfusion ischemia, plus any other ischemia related to and / or affecting brain function. The main symptoms of cerebral ischemia include impairment of vision, body movement and speech. The causes of cerebral ischemia vary, from sickle cell anemia to congenital heart defects. Symptoms of cerebral ischemia may include unconsciousness, blindness, coordination problems and physical weakness. Other effects that cerebral ischemia may cause are stroke, cardiopulmonary arrest and irreversible brain damage. Interruption of cerebral blood flow for more than 10 seconds leads to unconsciousness, while interruption of blood flow for more than a few minutes usually leads to irreversible brain damage.

[0044] The present invention provides a novel strategy for encapsulating microRNA molecules in cross-linked polymer nanocapsules by self-assembly and in situ polymerization techniques. In certain embodiments, the diameter of the polymer nanocapsules is about 20-100 nm. The small diameter of the polymer nanocapsules maximizes the protection of RNA molecules from external RNase attack and serum neutralization.

[0045] In certain embodiments, RNA is selected from the RNA that regulates the gene that reduces apoptosis, increases angiogenesis, increases neurogenesis, or increases neural plasticity. In certain embodiments, miRNA is selected from the miRNA that regulates the gene that reduces apoptosis, increases angiogenesis, increases neurogenesis, or increases neural plasticity.

[0046] In certain embodiments, the polymeric nanocapsule is 10 nm-20 nm, 20-25 nm, 25 nm-30 nm, 30 nm-35 nm, 35 nm-40 nm, 40 nm-45 nm, 45 nm-50 nm, 50 nm-55 nm, 55 nm-60 nm, 60 nm-65 nm, 70-75 nm, 75 nm-80 nm, 80 nm-85 nm, 85 nm-90 nm, 90 nm-95 nm, 95 nm-100 nm, or 100 nm-110 nm. In some embodiments, the diameter of the polymer nanocapsule is about 10 nm, 11 nm, 12 nm, 13 nm, 14 nm, 15 nm, 16 nm, 17 nm, 18 nm, 19 nm, 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, 50 nm, 51 nm, 52 nm, 53 nm, 54 nm, 55 nm, 56 nm, 57 nm, 58 nm, 59 nm, 60 nm, 61 nm, 62 nm, 63 nm, 64 nm, 65 nm, 66 nm, 67 nm, 68 nm nm, 69 nm, 70 nm, 71 nm, 72 nm, 73 nm, 74 nm, 75 nm, 76 nm, 77 nm, 78nm, 79 nm, 80 nm, 81 nm, 82 nm, 83 nm, 84 nm, 85 nm, 86 nm, 87 nm, 88 nm, 89 nm, 90 nm, 91nm, 92 nm, 93 nm, 94 nm, 95 nm, 96 119 nm nm or 120 nm.In certain embodiments, the diameter of the polymeric nanocapsule is 120 nm-130 nm, 130 nm-140 nm, 140 nm-150 nm, 150 nm-160 nm, 160 nm-170 nm, 170 nm-180 nm, 180 nm-190 nm, 190 nm-200 nm, 200 nm-210 nm, 220 nm-230 nm, 230 nm-240 nm, 240 nm-250 nm, or greater than 250 nm.

[0047] In certain embodiments, the polymer nanocapsules disclosed herein include non-targeted and targeted capabilities, higher efficiency and / or lower adverse immune responses. For example, higher efficiency may be the result of increased uptake and more targeted delivery.

[0048] In addition, when the polymer shell of the nanostructure is degraded in endosomes and lysosomes, the highly stable microRNA molecules in the protective nanocapsules can be completely released. In certain embodiments, the microRNA molecules encapsulated by non-targeted polymers can be transduced into primary cells such as PBMC in vitro, with higher efficiency and lower cytotoxicity compared to the low efficiency and high toxicity of liposome transduction. In certain embodiments.

[0049] Importantly, by selecting and designing the appropriate polymer charge, the method of delivering microRNA molecules for specific purposes can be tuned (eg, targeting by conjugating moieties to the polymer nanocapsules described herein).

[0050] In certain embodiments, the ratio of the degradable cross-linker to the non-degradable cross-linker is 1:1, 1:2, 2:1, 1:3, 2:3, 3:1, 3:2, 4:1, 1:4, 4:3, 3:4, 5:1, 1:5, 2:5, 5:2, 5:3, 3:5, 4:5, 5:4, 6:1, 1:6, 1:7, 7:1, 2:7, 7:2, 3:7, 7:3, 4:7, 7:4, 5:7, 7:8, 7:9, 8:10, 8:11, 8:12, 8:13, 8:14, 8:15, 8:16, 8:17, 8:18, 8:19, 9:11, 9:10, 9:11, 9:12, 9:13, 9:14, 9:15 In some embodiments, the molar ratio of the degradable cross-linking agent to the positively charged monomer is at least about 2:1, 1:1, 1:2 or more, preferably at least about 1:1. In certain embodiments, the molar ratio of positively charged monomers to neutral monomers is at least about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:11, about 1:12, about 1:13, about 1:14, about 1:15, about 1:20, or more, preferably at least about 1:10 or about 1:11.

[0051] In certain embodiments, the miRNA is selected from miRNAs that increase the expression of at least one of VEGF, GFAP, CD31, CD34, BCL-2, NeuN, bromodeoxyuridine, nestin, PSA-NCAM, doublecortin, Pax6, GAP-43, AKT, or HIF1-α. In certain embodiments, the miRNA is selected from miRNAs that reduce the expression of caspase 3 or PTEN.

[0052] Some exemplary degradable and non-degradable cross-linking agents are listed in Table 2 of US 2015 / 0071999.

[0053] In certain embodiments, polymer nanocapsules are designed to degrade in 1 hour, or 2 hours, or 3 hours, or 4 hours, or 5 hours, or 6 hours, or 7 hours, or 8 hours, or 9 hours, or 10 hours, or 11 hours, or 12 hours, or 13 hours, or 14 hours, or 15 hours, or 16 hours, or 17 hours, or 18 hours, or 19 hours, or 20 hours, or 21 hours, or 22 hours, or 23 hours, or 1 day, or 2 days, or 3 days, or 4 days, or 5 days, or 6 days, or 1 week, or 2 weeks, or 3 weeks, or 1 month or any combination thereof. In certain embodiments, polymer nanocapsules are designed to degrade at any of the above rates at physiological pH. In certain embodiments, polymer nanocapsules are designed to degrade at any of the above rates after being administered to a subject in need.

[0054] In certain embodiments, microRNA molecules can be effectively delivered to specific sites in vivo. In certain embodiments, targeting agents (i.e., conjugates or conjugating agents) are conjugated with polymer nanocapsules. In certain embodiments, conjugation prevents the dissociation of targeting agents and polymer particles. In certain embodiments, cyclodextrin and / or adamantane can be used for targeting agent conjugation.

[0055] In certain embodiments, the present invention is practiced using non-targeted and targeted polymer nanocapsule microRNA molecule delivery with high efficiency and low toxicity for in vitro assays and in vivo targeting of specific tissues and organs by intravenous injection.

[0056] The increased stability of RNAi / miRNA molecules encapsulated by cross-linked polymers also ensures their long-term circulation in vivo before reaching the target site.In summary, the delivery of microRNA molecules as described herein can provide significant efficiency, enhanced stability and minimal toxicity.

[0057] Monomers and crosslinkers

[0058] Various monomers and cross-linkers can be used to encapsulate RNAi molecules (eg, microRNAs) by in situ polymerization, such as those taught in this specification and other methods well known in the art.

[0059] In certain embodiments, the molar ratio of total monomer to miRNA is at least about 1000:1, about 2000:1, about 3000:1, about 4000:1, about 5000:1, about 6000:1, about 7000:1, 8000:1, about 9000:1, about 10000:1 or more, preferably at least about 4000:1, or about 5000:1.

[0060] Polymer nanocapsule conjugates

[0061] In certain embodiments, the microRNA molecules are delivered to cells using surface-conjugated targeting agents on optimized nanocapsules. Of particular interest, polymer nanocapsule conjugates can be used to target immune cells, lung cells, lung cells, eye cells, liver cells, kidney cells, brain cells, central nervous system cells, peripheral nervous system cells, heart cells, cancer cells, proliferating cells, virally infected or retrovirally infected cells, stem cells, skin cells, intestinal cells and / or auditory cells. In certain embodiments, the targeting agent delivers polymer nanocapsules to cell types selected from endothelial cells, microglia, neurons and astrocytes.

[0062] In certain embodiments, the conjugate for realizing the specific targeting of polymer nanocapsules includes CD4, CD8, CD45, CD133, aHLA and transferrin. In certain embodiments, the conjugate for realizing the specific targeting of polymer nanocapsules includes any one or more differentiation clusters or specified clusters (CD) markers. For example, CD markers include CDX, wherein X can be any one of 1-340. As described herein, the term "CD1", for example, means all CD1 variants and subtypes. This applies to all CD markers described herein.

[0063] In certain embodiments, the conjugates used to achieve specific targeting of polymer nanocapsules include any one or more of AFP, β-catenin, BMI-1, BMP-4, c-kit, CXCL12, SDF-1, CXCR4, decorin, E-cadherin, Cadherin 1, EGFR, ErbB1, Endoglin, EpCAM, TROP-1, FcεRIA, FCER1A, L1CAM, LMO2, Nodal, Notch-1, PDGFRB, Podoplanin, PTEN, Sonic Hedgehog, STAT3, Syndecan-1, transferrin receptor, and vimentin.

[0064] In certain embodiments, the conjugates used to achieve specific targeting of polymer nanocapsules include any one or more of ALK, AFP, B2M, β-hCG, BCR-ABL, BRAF, CA15-3, CA19-9, CA-125, calcitonin, CEA (carcinoembryonic antigen), CD20, chromogranin A, cytokeratin or fragments thereof, EGFR, estrogen receptor, progesterone receptor, fibrin, fibrinogen, HE4, HER2 / neu, IgG variants, KIT, lactate dehydrogenase, nuclear matrix protein 22, PSA, thyroglobulin, uPA, PAI-1, and Oval.

[0065] In certain embodiments, the targeting agent is selected from TAT (transduction domain of human immunodeficiency virus type 1 (HIV-1)) peptide, diphtheria toxin, tetanus toxin, Tet1, G23, rabies virus glycoprotein (RVG) peptide, opioid peptides, glutathione, thiamine, leptin, angiopep, low-density lipoprotein, insulin, melanoteferrin, and transferrin.

[0066] Any marker described herein or acceptable to one of skill in the art can be used alone, or in combination with one or more additional markers to achieve the desired targeting of specific cells.

[0067] All other cell and / or tissue specific markers known to those of skill in the art are incorporated herein by reference.

[0068] Method for treating diseases caused by expression of target genes

[0069] In one embodiment, the present invention relates to a method for treating a subject suffering from a disease caused by the expression of a target mutant gene or facing the risk of developing the disease. In certain embodiments, the polymer nanocapsules described herein can be used to treat or prevent one or more cell proliferation and / or differentiation disorders. In certain embodiments, polymer nanocapsules can be used to treat or prevent one or more immune or immunodeficiency disorders. In certain embodiments, polymer nanocapsules can be used to treat or prevent viral replication or viral infection. In certain embodiments, polymer nanocapsules can be used to treat one or more neurological disorders or neurodegenerative disorders. In certain embodiments, polymer nanocapsules can be used to treat or prevent cancer.

[0070] In certain embodiments, polymer nanocapsules can be used to treat or prevent stroke or ischemic diseases or conditions, particularly cerebral ischemia.

[0071] In certain embodiments, the polymer nanocapsules can be used to treat or prevent advanced cancer, pachyonychia congenita, age-related macular degeneration, choroidal neovascularization, metastatic melanoma, metastatic melanoma without CNS metastasis, chronic myeloid leukemia, solid tumors, advanced solid tumors, optic atrophy, non-arteritic anterior ischemic optic neuropathy, pancreatic cancer, pancreatic duct adenocarcinoma, diabetic macular edema, hypercholesterolemia, colorectal cancer with liver metastasis, pancreatic cancer with liver metastasis, gastric cancer with liver metastasis, breast cancer with liver metastasis, ovarian cancer with liver metastasis, preeclampsia, neuroblastoma, ocular hypertension, open-angle glaucoma, glaucoma, eye pain, dry eye syndrome, renal injury, acute renal failure, delayed graft function, renal transplant complications, TBX3 overexpression, and diabetic retinopathy.

[0072] In certain embodiments, polymer nanocapsules can be used to treat or prevent viral infections. In certain embodiments, polymer nanocapsules can be used to treat or prevent retroviral infections. In certain embodiments, polymer nanocapsules can be used to treat or prevent HIV or AIDS infections. In specific embodiments, polymer nanocapsules can be used to inhibit retroviral infections. In certain embodiments, polymer nanocapsules can be used to prevent, prevent or downregulate retroviral or viral replication. In certain embodiments, administration of polymer nanocapsules induces a physiological process selected from anti-apoptosis, neurogenesis and angiogenesis.

[0073] In certain embodiments, the polymeric nanocapsules described herein can be administered by intravitreal injection, parenterally, intravenously, by injection into the callus at the sole of one foot, orally, subcutaneously, or by any other mode of drug administration.

[0074] In certain embodiments, the method comprises administering to a subject a pharmaceutical composition of the invention so that the expression of a target mutant gene is silenced or downregulated. In certain embodiments, the subject is a mammal, such as a human. Due to the high specificity of the polymer nanocapsules of the invention, they can specifically target mutant genes of diseased cells and tissues, as described herein.

[0075] In the prevention of disease, target gene may be a gene necessary for initiating or maintaining disease, or has been identified as a gene relevant to a higher risk of infectious disease. In the treatment of disease, polymer nanocapsules can contact cells or tissues showing disease. As a non-limiting example, polymer nanocapsules can deliver RNA or miRNA substantially identical to all or part of a cancer-related mutant gene, or RNA or miRNA expressed at a high level in tumor cells can contact or be introduced into cancer cells or tumor genes. As another non-limiting example, polymer nanocapsules can deliver RNA or miRNA substantially identical to all or part of a viral or retroviral disease-related mutant gene. In particular, the non-limiting example of retroviral diseases that can be treated with polymer nanocapsules described herein is HIV.

[0076] Non-limiting examples of cell proliferation and / or differentiation disorders include cancer, such as carcinoma, sarcoma, metastatic disorders or hematopoietic tumor disorders, such as leukemia. Metastatic tumors can be caused by a variety of primary tumor types, including but not limited to tumors of prostate, colon, lung, breast and liver origin. As used herein, the terms "cancer", "overproliferation" and "tumor" refer to cells with autonomous growth ability, i.e., abnormal disease states characterized by rapid proliferation of cell growth. These terms are intended to include all types of cancer growth or carcinogenic processes, metastatic tissues or malignantly transformed cells, tissues or organs, regardless of the aggressive histopathological type or stage. Proliferative disorders also include hematopoietic tumor disorders, including diseases related to hyperplasia / tumor cells of hematopoietic origin, such as diseases caused by myeloid, lymphoid or erythroid systems or their precursor cells.

[0077] Mutations in cellular genes that directly or indirectly control cell growth and differentiation are considered to be the main cause of cancer. There are approximately 30 gene families, called oncogenes, that have been implicated in the formation of human tumors. Members of one such family, the RAS gene family, are carried in a wide range of eukaryotic organisms and are often found to be mutated in human tumors. The polymer nanocapsules of the present invention can be used to target such oncogenes to knock down or prevent their expression.

[0078] In addition to oncogenes, the methods and compositions of the present invention can also be applied to other disease-related target genes with point mutations. Gene mutations have been reported in more than 1000 different human genes. Data on these mutations and their associated phenotypes have been collated and are available online through two major databases: Online Mendelian Inheritance in Man in Baltimore and Human Gene Mutation Database in Cardiff. For example, the frequency of CG to TG or CA mutations in the human genome is very high due to the deamination of 5' methyl-cytosine. Short deletions or insertions of less than 20 nucleotides are also very common mutations in humans. See, for example, Antonarakis, SE, Eur. Pediatr. (2000) 159(3):5173-8.

[0079] In addition, Sachidanandam et al. described a human genome sequence variation map containing 1.42 million single nucleotide polymorphisms, which is very helpful for identifying genes with biomedical significance for diagnosis and treatment (Sachidanandam, R., et al., Nature (2001) 409(6822):821-2 and Nature (2001) 409(6822):822-3). The map integrates all publicly available SNPs and other genomic features of the described genes. It is estimated that 60,000 SNPs fall into exons (coding and untranslated regions), and 85% of exons are within 5 kb of the nearest SNP. Clifford et al. provide an expression-based genetic / physical map of single nucleotide polymorphisms identified by the Cancer Genome Dissection Project (Clifford, R., et al., Genome Res (2000) 10(8):1259-65). In addition to the SNP maps, Sachidanandam et al. also provide maps containing SNPs for genes expressed in breast, colon, kidney, liver, lung or prostate tissue.

[0080] Therefore, the microRNA molecule polymer nanocapsules of the present invention can be used to target such mutant genes to knock down or prevent their expression.

[0081] In certain embodiments, the method of treatment comprises administering an additional therapy. In certain embodiments, the additional therapy is selected from anticoagulant therapy, antiplatelet therapy, or thrombolytic therapy.

[0082] Methods for inhibiting mutant gene expression

[0083] In yet another aspect, the present invention relates to a method for inhibiting mutant gene expression in a subject. The method comprises administering a composition of the present invention to a subject so that the expression of the mutant gene is silenced compared to the corresponding wild-type gene. In certain embodiments, the subject is a mammal. In certain embodiments, the mammal is a human.

[0084] Due to the high specificity of the miRNA nanocapsules of the present invention, they can specifically target the RNA (primary or processed) of the target mutant gene at surprisingly low doses. Compositions and methods for inhibiting target gene expression using polymer nanocapsules can be performed as described herein.

[0085] In certain embodiments, the present invention includes administering a composition comprising a polymer nanocapsule, wherein the polymer nanocapsule includes a nucleotide sequence, such as a miRNA targeting a mutant gene. When the subject being treated is a mammal, such as a human, the composition can be administered by any method known in the art, including but not limited to oral or parenteral routes, including intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, airway (aerosol), rectal, vaginal and topical (including buccal and sublingual) administration. In certain preferred embodiments, the composition is administered by intravenous or intraperitoneal (intraparenteral) infusion or injection.

[0086] The method of suppressing target gene expression can be applied to any mutant gene that wants to be silenced, thereby selectively suppressing its expression. Non-limiting examples of human genes that can be used for targeted silencing include oncogene cytokinin genes, idiotype protein genes, prion genes, genes expressing molecules that induce angiogenesis, genes encoding adhesion molecules, genes encoding cell surface receptors, genes participating in the protein of transfer and / or invasion process, proteases, and genes regulating apoptosis and cell cycle molecules, genes expressing EGF receptors, genes encoding multidrug resistance 1 genes (MDR1 genes), genes that allow viral uptake and replication, genes that cause neurodegenerative disorders, genes that cause protein aggregation and / or accumulation, genes that cause hormone upregulation or downregulation, genes that cause neurological disorders, genes that cause cardiac diseases, and genes that cause psychological disorders. Those skilled in the art will understand which genes are included in the broad categories of exemplary genes described above.

[0087] Preparation method

[0088] In certain embodiments, the polymer nanocapsules described herein are prepared to achieve a specific size, target a specific site for gene downregulation, and downregulate a specific gene. The size of the polymer nanocapsules described herein can be determined according to the polymer: crosslinker ratio as described herein. For example, a conjugate attached (i.e., conjugated) to the outside of the polymer nanocapsules described herein can be used to achieve targeted delivery. In addition, the specific binding of the RNAi molecules of the polymer nanocapsules described herein to specific genes (thereby reducing specific gene expression) can be achieved by designing RNAi molecules using methods known to those skilled in the art. See, for example, Birmingham et al., "A protocol for designing siRNAs with high functionality and specificity", Nature Protocols, 2007; 2 (9): 2068-78. In addition, by adjusting the degradable: non-degradable polymer ratio as described herein, the ability of the polymer nanocapsules to deliver RNAi molecules to the target site can be optimized and determined.

[0089] Giving Method

[0090] The pharmaceutical compositions encompassed by the present invention can be administered by any method known in the art, including but not limited to oral or parenteral routes, including intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, airway (aerosol), rectal, vaginal and topical (including buccal and sublingual) administration. In certain preferred embodiments, the pharmaceutical compositions are administered by intravenous or intraperitoneal (intraparenteral) infusion or injection.

[0091] The term "subject" contemplated for administration includes, but is not limited to, humans (i.e., males or females of any age group, such as pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, or elderly adults) and / or other primates (e.g., cynomolgus monkeys, rhesus monkeys); mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, goats, cats, and / or dogs; and / or birds, including commercially relevant birds such as chickens, ducks, geese, quail, and / or turkeys. Preferred subjects are humans.

[0092] In certain embodiments, the disclosed compositions are administered nasally in a range of once a day, to once a week, to once every two weeks, to once a month. In preferred embodiments, the microparticles and compositions are administered nasally. As used herein, the term "nasal" or "nasal administration" refers to delivering the microparticles to the nasal mucosa of a subject so that the contents of the microparticles are absorbed directly into the nasal tissue.

[0093] In certain embodiments, polymeric nanocapsules, microparticles, and compositions comprising the same are for systemic administration.

[0094] In certain embodiments, administration of polymer nanocapsules increases the expression of at least one of VEGF, GFAP, CD31, CD34, BCL-2, NeuN, doublecortin, nestin, PSA-NCAM, doublecortin, Pax6, GAP-43, AKT, or HIF1-α. In certain embodiments, administration of polymer nanocapsules reduces the expression of at least one of caspase 3 or PTEN. Example

[0095] Example 1: Materials and Methods for Example 2

[0096] 1. Materials

[0097] All chemicals were purchased from Sigma-Aldrich (St. Louis, MO) and used as received without further purification unless otherwise noted. N-(3-aminopropyl)methacrylamide hydrochloride (APM) was purchased from Polysciences Inc (Washington, PA). DiI, DAPI, Hoechst 33342, Lipofectamine 2000, and Trizol were purchased from Invitrogen. Polyvinylidene fluoride (PVDF) membranes were purchased from MilLipore, Inc. Blood chemistry analysis ELISA kits, ABC-peroxidase and diaminobenzidine (DAB), and miRNA in situ hybridization kits were purchased from Boster Biotechnology, Inc. RNA oligonucleotides with the sequences listed in Table 1, FITC-labeled miR-21, Cy5.5-labeled miR-21, and Hairpin-it miRNA qPCR Quantitation Kit were ordered from GenePharma, Inc.

[0098] 2. Equipment

[0099] UV-visible spectra were obtained with a DU730 spectrometer (Beckman Coulter, Inc.). Dynamic light scattering (DLS) studies of nanocapsules were performed on a Zetasizer Nano instrument (Malvern Instruments Ltd., United Kingdom) equipped with a 10 mW helium-neon laser (λ=632.8 nm) and a thermoelectric temperature controller. Transmission electron microscopy (TEM) images were obtained on an H-600 transmission electron microscope (Hitachi, Tokyo) with a 120 kV accelerating voltage. Fluorescence intensity was measured with a Synergy 2 Multi-Mode Microplate Reader (BioTek, USA). Cells were observed and photographed with a Carl Zeiss Axio Observer inverted fluorescence microscope. Flow cytometry analysis was performed using a BD LSR Fortessa cell analyzer. Near-optical fluorescence images in vivo were obtained using a CRI in vivo imaging system (Maestro, USA).

[0100] 3. Synthesis of miRNA Nanocapsules and Lipofactamine / miRNA Complexes

[0101] Acrylamide (AAM), N-(3-aminopropyl)methacrylamide (APM), and poly(ethylene glycol) methyl ether acrylate (mPEG) with an average Mn of 2000 Da were prepared as 10% (w / v) stock solutions in deoxygenated RNase-free water, and glycerol dimethacrylate (GDMA) was prepared as a 10% (w / v) stock solution in anhydrous DMSO. Specific amounts of the above monomers and crosslinkers were then added to the miRNA solution, and the molar ratio of AAM / APM / mPEG / GDMA was adjusted for screening synthesis parameters. Polymerization was initiated by adding ammonium persulfate (1 / 10 molar ratio of total monomers) and N,N,N',N'-tetramethylethylenediamine (2-fold weight ratio of APS) and maintained at 4°C for 2 hr. The final miRNA concentration was adjusted to 5 μM by dilution with deoxygenated RNase-free water. After polymerization, the solution was dialyzed against 10 mM PBS using a 10 kDa membrane to remove unreacted monomers and byproducts. The PEG-free n(miR-21) was synthesized by a similar protocol but without mPEG. The blocking effect of miRNA or nanocapsules was observed by agarose gel electrophoresis analysis using a UV gel imaging system (G:BOX F3, Syngene, UK). The particle size and zeta potential of the nanocapsules were determined using a Zetasizer (Nano ZS, Malvern, UK). The morphology of the nanocapsules was observed using transmission electron microscopy (Hitachi, Tokyo, Japan).

[0102] Lipofectamine / miRNA complexes (Lipo / miRNA) were prepared according to the manufacturer's protocol. Briefly, equal amounts of Lipofectamine (1 mg / mL) and miR-21 (0.16 μg / μL) were thoroughly mixed and incubated at 4°C for 15 min for later use.

[0103] 4. Characterization of miRNA Nanocapsules

[0104] 4.1. Agarose gel electrophoresis analysis

[0105] Gel retardation analysis was performed in 2% (w / v) agarose gel in 1 × TAE buffer at a constant voltage of 80 V for 20 min. Then, the agarose gel was stained with 0.5 mg / ml ethidium bromide solution for 30 min. Finally, the miRNA bands were visualized at 365 nm using a UV gel imaging system (SIM135A, SIMON).

[0106] 4.2. Transmission electron microscopy (TEM)

[0107] TEM samples were prepared by drop coating 5 μL of nanocapsules on carbon-coated copper grids. After 5 min, the excess sample was removed. The grids were then rinsed and stained with 1% sodium phosphotungstate at pH 7.0. The grids were observed using an H-600 transmission electron microscope (Hitachi, Tokyo).

[0108] 4.3. Dynamic light scattering (DLS)

[0109] DLS experiments were performed using a ZetasizerNano instrument (Malvern Instruments Ltd., United Kingdom) equipped with a 10-mW HeNe laser (λ = 632.8 nm) and a thermoelectric temperature controller. Measurements were performed at a 90° scattering angle at 25°C. The size and standard deviation of n(miR-21) were obtained by averaging at least three measurements.

[0110] Zeta potential measurements

[0111] The zeta potential of n(miR-21) was determined by photon correlation spectroscopy using a Zetasizer Nano instrument (Malvern Instruments, Malvern, Worcestershire, UK). Measurements were performed at 25°C with a detection angle of 90°, and the raw data were subsequently correlated to the average size of the Z-average using cumulative analysis using the Zetasizer software package.

[0112] 5. Effect of mPEG chain density on size distribution, zeta potential and delivery performance of nanocapsules

[0113] To understand the effect of mPEG density on the size distribution, zeta potential and delivery performance of nanocapsules, nanocapsules were synthesized with different mPEG / miRNA molar ratios ranging from 50 to 500 at an M:R ratio of 6000:1 ( Figure 4 A). DLS was used to measure the size and zeta potential of these nanocapsules, and fluorescence activated cell sorting (FACS) was used to evaluate their internalization efficiency in model glioma cells (C6 cells, rat glioma cells) and low non-specific phagocytosis by model macrophages (J774A.1, mouse macrophages).

[0114] 6. Stability study of n(miR-21)

[0115] 6.1. Stability of n(miR-21) at physiological ionic strength

[0116] To ensure the in vivo stability of n(miR-21), it is crucial to examine their size changes under physiological ionic strength. The size changes of n(miR-21) were monitored using real-time DLS measurements at different times after dialysis in PBS solution. The size of n(miR-21) was recorded for 168 hours.

[0117] 6.2. Stability of n(miR-21) at different temperatures

[0118] To understand the thermal stability of n(miR-21), real-time DLS measurements were used to monitor the size changes of n(miR-21) in PBS at 25, 37, and 60° C. In each case, the samples were equilibrated at a given temperature for 15 min before data acquisition.

[0119] 6.3. Stability of n(miR-21) in 10% serum

[0120] To understand the stability of n(miR-21) in the presence of serum, DLS measurements were performed to observe the size changes of n(miR-21) in a mixture of serum and PBS (1:9, V / V). In each case, the samples were kept at room temperature for 168 h (Supplementary Figure 3 c).

[0121] 6.4. Heparin stability

[0122] To understand the stability of n(miR-21) in the presence of heparin, n(miR-21) and Lipo / miR-21 were incubated with 10 mg / mL heparin at room temperature for 15 min. Agarose gel electrophoresis was then performed on a 2% agarose gel and imaged using a UV gel imaging system (G:BOX F3, Syngene, UK).

[0123] 6.5. Serum and RNase stability of encapsulated miR-21

[0124] To understand the stability of miR-21 in the presence of serum, real-time PCR was performed to measure the relative quantification of residual miR-21 before and after treatment of miR-21 preparations with serum (Shi et al . (2013) Angew Chem Int Ed Engl 52:3901-3905). Native miR-21, n(miR-21), and Lipo / miR-21 (containing 1 µg miR-21) were incubated in 50% fetal bovine serum for 1 hour at 37°C. Then, miRNA was extracted with chloroform / 0.1% SDS-0.5 M NaCl and reconstituted to 100 µL with RNase-free water (Yan et al., 2013). et al. (2012) J Am Chem Soc 134:13542-13545). cDNA was synthesized using the Hairpin-it miRNA qPCR Quantitation Kit (GenePharma). Residual miR-21 levels were quantified using amplification efficiencies derived from the cDNA standard curve. Data were analyzed using the DNA Engine Opticon2 Two-Color Real-time PCR Detection System (Bio-Rad) and normalized to the expression of untreated native miR-21 (fold change, 2 -δCT ). All RT-PCR reactions were performed in triplicate. For nuclease stability studies, native miR-21, n(miR-21), and Lipo / miR-21 (containing 1 µg of miR-21) were incubated in 10 mM Tris-HCl (pH 8.0), 10 mM EDTA at 37°C for 1 h in the presence of 1 mg / mL RNase A. Then, miRNA was extracted with chloroform / 0.1% SDS-0.5 M NaCl and reconstituted to 100 µL with RNase-free water (Yan et al., 2013). et al. (2012), Same as above ). Relative quantification of miR-21 levels was determined using the method described in the serum stability study.

[0125] 7. Protein adsorption analysis

[0126] Protein adsorption was quantified using BCA Protein Assay (Thermo Scientific) (Liang et al. (2016) Nano Research 9:1022-1031). Briefly, 10 µL of PBS (negative control), no-PEG n(miR-21), n(miR-21), and Lipo / miR-21 were mixed with 30 µL of mouse whole serum and incubated at 37°C for 30 min. After incubation, the samples were filtered by centrifugation (MWCO = 100 kDa) and washed three times with PBS to remove any unadsorbed serum proteins. After reconstitution with 50 µL of PBS, the total protein concentration of each sample was measured using the BCA Protein Assay according to the manufacturer's instructions. The samples were reacted with the working reagent at 37°C for 30 min, and then the absorbance was measured at 562 nm. Each value was compared with a bovine serum albumin standard curve. The amount of adsorbed protein was calculated using the total protein concentration and the concentration of unadsorbed serum protein.

[0127] 8. Degradation kinetics and miRNA release studies

[0128] The degradation of miRNA nanocapsules was studied in 50 mM sodium acetate buffer (pH 5.4) and 50 mM PBS buffer (pH 7.4). The degradation kinetics of the nanocapsules was measured by DLS technique using the ratio of scattered light intensity. I / I 0 quantitative, where I 0 represents the initial nanocapsule scattered light intensity and I represents the time-dependent scattered light intensity of nanocapsules (Liu et al .(2015) Adv Mater 27:292-297; Gu et al . (2009) Nano Lett 9:4533-4538). Then, the release of miR-21 from n(miR-21) was studied by agarose gel electrophoresis analysis after they were incubated with or without 1 mg / mL heparin, followed by imaging by a UV gel imaging system.

[0129] 9. In vitro studies

[0130] 9.1. Cell lines and cell culture

[0131] Authenticated J774A.1 cells and glioma C6 cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD), tested for mycoplasma contamination, and cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Invitrogen), 4 mM glutamine, 100 U / ml penicillin, and 100 μg / ml streptomycin in an incubator (Thermo Scientific) at 37°C in an atmosphere of 5% CO2 and 90% relative humidity. All cells used in this study were in the logarithmic growth phase.

[0132] 9.2. Cell viability analysis

[0133] The toxicity of nanocapsules was evaluated by MTT analysis, using natural miR-NC as a control. One day before exposure to nanocapsules, C6 cells (2000 cells / well) were inoculated on 96-well plates. miR-NC nanocapsules, Lipo / miR-NC complexes and miR-NC (with various miRNA concentrations) were incubated with cells for 4 hours, removed from the mixture, and incubated with fresh culture medium for another 48 hours. MTT solution (20 μL) was added to each well and incubated for 4 hr. The culture medium was then removed and 150 μL DMSO was added to each well. The plate was placed on a shaker, 150 rpm 5 min to fully mix the solution, and then the absorbance reading was measured at 560 nm using Synergy 2 Multi-Mode Microplate Reader (BioTek, USA). Untreated cells were used as 100% cell viability controls.

[0134] 9.3. Intracellular transport and phagocytosis studies

[0135] C6 (2 × 10 5 Cells were seeded in 6-well plates with coverslips in the wells and cultured for adherence. FITC-labeled native miR-21 and n(miR-21) were added to each well at a final concentration of 50 nM miRNA for incubation at 37°C for 4 h. Then, cells were stained with 5 μg DiI according to the manufacturer's protocol. Cells were fixed with 4% formaldehyde in PBS for 20 min at room temperature and then washed three times with PBS. Finally, coverslips were placed on slides with 20 μL of aqueous mounting medium. Slides were then observed using a FluoView confocal laser scanning microscope-FV1000 (Olympus, Tokyo, Japan).

[0136] Fluorescence activated cell sorting (FACS) was used to determine the cellular uptake efficiency of n(miR-21). C6 cells were cultured at 2 × 10 5 Cells were seeded at a density of 10 cells / well on 6-well plates and cultured adherently. Then, 50 nM FITC-labeled native miR-21, Lipofectamine-complexed miR-21 (expressed as Lipo / miR-21), and n(miR-21) were transduced at 37°C for 4 hr. After trypsinization and centrifugation, the cells in the wells were washed twice with PBS buffer containing 1% (w / v) heparin, and then resuspended in 0.3 ml PBS buffer containing 40 μg / ml trypan blue for flow cytometric analysis (EPICS XL, Beckman Coulter).

[0137] To assess phagocytic activity, 1 × 10 5 J774A.1 cells were seeded onto 6-well plates and allowed to adhere and grow. After 48 hours, cells were incubated with n(miR-21), no-PEG n(miR-21) and Lipo / miR-21 (dosage 50 nM miRNA) and then incubated for another 2 hours for phagocytosis. Cells were washed twice for 10 minutes with PBS labeled with Hoechst 33342 and analyzed using a Carl Zeiss Axio Observer inverted fluorescence microscope. Further quantification of fluorescence intensity was analyzed by FACS using a similar protocol to that of C6 cells.

[0138] 9.4. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

[0139] Quantitative real-time polymerase chain reaction (qRT-PCR) was used to quantitatively compare the miRNA regulation ability of nanocapsules and Lipofectamine. C6 cells were cultured at 2 × 10 5Cells were seeded on 6-well plates at a density of 10 cells / well for 24 h. Then, cells were treated with miRNA nanocapsules or miRNALipofectamine complexes at a final concentration of 50 nM in serum-free medium or 50% human serum medium at 37°C for 4 h. The medium was later changed to DMEM containing 10% fetal bovine serum. After 24 h, total RNA was isolated from the cultured cells using Trizol according to the manufacturer's instructions. For the detection of miR-21, stem-loop reverse transcription polymerase chain reaction (RT-PCR) was performed using the Hairpin-it miRNA qPCR quantification kit (GenePharma) according to the manufacturer's instructions. Real-time PCR was performed by SYBR green detection using a forward primer to the mature miRNA sequence and a universal adapter reverse primer (miR-21-R: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACtcaaca (SEQ ID NO: 1); and miR-21-F: GCCGCTAGCTTATCAGACTGATGT (SEQ ID NO: 2)) (Liu et al., 2014). et al . (2015), Same as above The relative expression of miR-21 was evaluated by the comparative CT (threshold cycle) method and normalized to the expression of U6 microRNA. Primers for miR-21 and U6 were obtained from GenePharma (Shanghai, China). All RT-PCR reactions were performed in triplicate.

[0140] 9.5. Western blot analysis

[0141] In western blot analysis, C6 cells were transduced with n(miRNA) for 48 hours. Total protein production was quantified using NanoDrop2000 (Thermo Scientific). Protein lysates were separated by SDS-PAGE and then transferred to polyvinylidene fluoride (PVDF) membranes (MilLipore, Billerica, MA, USA). The membranes were incubated with primary antibodies against PTEN (1:1000, Santa Cruz Biotechnology, #sc-7974), AKT (1:1000, Santa Cruz Biotechnology, #sc-81434), HIF 1-α (1:1000, Cell Signaling Technology, #14179) and VEGF (1:1000, Santa Cruz Biotechnology, #sc-507), followed by incubation with HRP-conjugated secondary antibodies (1:5000, Promega Corporation). GAPDH (1:1000, Santa Cruz Biotechnology, #sc-47724) was set as a loading control.

[0142] 10. In vivo studies

[0143] 10.1. In vivo imaging studies

[0144] After induction of ischemia, Cy5.5-labeled Lipo / miR-21 or n(miR-21) was injected into the tail vein of animals (n=3) at a dose of 0.5 mg miRNA / kg rat. Control rats were given an equal amount of PBS. Then, 20 μL of blood was collected from the tail vein at 0.08333, 0.25, 0.5, 1, 2, 4, 12, and 24 hours after injection and subsequently diluted with 30 μL of PBS in a 96-well microtiter plate before fluorescence measurement. Cy5.5 fluorescence intensity measurements were performed on a VARIAN Cary Eclipse fluorescence spectrofluorometer using an excitation wavelength of 678 nm, recording emission in the wavelength range of 690-750 nm, and a scan rate of 125 nmmin -1 After blood collection, the rats were anesthetized and imaged using the CRI in vivo imaging system (Maestro, USA). Then, the animals were sacrificed and the organs (including liver, spleen, heart, lung, kidney and brain) were removed for near-light fluorescence imaging to examine the accumulation of fluorescent nanoparticles. Using LIVING IMAGE optical imaging software (Maestro), the total photons / second and maximum photons / second / cm 2 / steradian, the imaging signal intensity from the region of interest (ROI) was selected, measured and analyzed. After in vivo imaging analysis, the excised brain was frozen in liquid nitrogen and then finely ground. Total RNA was isolated with Trizol according to the manufacturer's instructions, and then the expression level of miR-21 in brain tissue was quantitatively measured using qRT-PCR method.

[0145] 10.2. Comparison of delivery efficiency between intracarotid and intravenous administration routes

[0146] To better estimate the efficiency of n(miR-21) delivery to the ischemic brain after systemic delivery, Cy5.5-labeled n(miR-21) was delivered into the ischemic brain via the carotid artery ( ic .) injection (dose 0.1 mg miRNA / kg rat), intravenous ( iv .) injection (dose 0.5mg miRNA / kg rat, or 0.1mg miRNA / kg rat) was given to the animals ( n =3). 24 hours after injection, rats were anesthetized and imaged with a CRI in vivo imaging system (Maestro, USA). Then, the animals were sacrificed and brain tissue was excised for near-light fluorescence imaging to examine the accumulation of fluorescent nanoparticles. After in vivo imaging, qRT-PCR analysis was also performed to examine miR-21 levels in the excised brain.

[0147] 10.3. Blood chemistry analysis

[0148] Liver function was evaluated by measuring serum enzyme parameters. Briefly, 24 h after sample injection, 2.0 mL of blood samples were collected from the canthal vein using a capillary tube. The blood samples were centrifuged at 300 r / min at room temperature, and then the upper serum was collected for serum biochemical analysis using an ELISA kit. This test included the detection of various enzymes such as aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), total protein, and albumin (TP) levels.

[0149] 10.4. Detection of miR-21 by fluorescence in situ hybridization

[0150] Quantitative miR-21 expression in brain tissues was detected by fluorescent in situ hybridization using an in situ hybridization kit (Boster, Wuhan, China) according to the manufacturer's protocol. Cy3-avidin was used to label miR-21 at a concentration of 0.5 mg / mL. Cell nuclei were counterstained with DAPI and observed using a Carl Zeiss Axio Observer inverted fluorescence microscope.

[0151] 10.5. Histology and Immunohistochemistry

[0152] Paraffin-embedded tissue sections were used for HE staining and detection of VEGF (1:100, Santa Cruz Biotechnology, #sc-507), CD31 (1:100, Santa Cruz Biotechnology, #sc-1506), HIF1-α (1:100, Cell Signaling Technology, #14179), and GFAP (1:100, Cell Signaling Technology, #3670). Sections were incubated with primary antibodies overnight at 4°C, followed by incubation with biotinylated secondary antibodies (1:100, Zhongshan Bio Corp) at 37°C for 1 h, followed by incubation with ABC-peroxidase and diaminobenzidine (DAB) (1:100, Zhongshan Bio Corp, #SP-9000-D), counterstained with hematoxylin, and finally observed by light microscopy.

[0153] 10.6. Apoptosis analysis

[0154] Paraffin-embedded tissue sections were used to examine apoptosis in IBD. TUNEL analysis was performed using an in situ cell death detection kit (Roche) according to the manufacturer's protocol. The sections were then imaged using a Carl Zeiss Axio Observer inverted fluorescence microscope. Quantitative analysis was performed using ImageJ software (NIH).

[0155] 10.7. Histopathological analysis of major organs

[0156] Histopathological analysis was performed as described above. Paraffin-embedded sections were stained with hematoxylin and eosin for histopathological evaluation. Lesions were examined microscopically for evidence of cellular damage and inflammation.

[0157] 11. Statistical Analysis

[0158] Unless otherwise stated, all quantitative results are from at least 3 separate experiments (performed in triplicate). Graphpad Prism 6 software was used to evaluate significance using two-tailed unpaired Student t-test (comparison of two groups) and analysis of variance (comparison of more than two groups) with correction for multiple comparisons. All data met the assumptions of the statistical tests and the variance was calculated to be similar between the compared groups. P The results were considered significant if p<0.05 or less.

[0159] 12. Synthesis and Characterization of miRNA Nanocapsules

[0160] Stock solutions of acrylamide (AAM), N-(3-aminopropyl)methacrylamide (APM), and poly(ethylene glycol) methyl ether acrylate (mPEG) (average Mn 2000) were prepared in deoxygenated RNase-free water (10% w / v). Glycerol dimethacrylate (GDMA) was prepared as a 10% (w / v) stock solution in anhydrous DMSO. Then, specific amounts of the above monomers and crosslinkers were added to the miRNA solution, and the molar ratio of AAM / APM / mPEG / GDMA could be adjusted for screening purposes. Polymerization was initiated by adding ammonium persulfate (1 / 10 molar ratio of total monomers) and N,N,N',N'-tetramethylethylenediamine (2-fold weight ratio of APS) and maintained at 4°C for 2 hr. The final miRNA concentration was adjusted to 5 μM by dilution with deoxygenated RNase-free water. After polymerization, the solution was dialyzed against 10 mM PBS using a 10 kDa membrane to remove unreacted monomers and byproducts. No-PEG n(miR-21) was synthesized by a similar protocol but without mPEG. The retardation of miRNA or nanocapsules was observed using agarose gel electrophoresis analysis with a UV gel imaging system (G:BOX F3, Syngene, UK). The particle size and zeta potential of the nanocapsules were determined by Zetasizer (NanoZS, Malvern, UK). Transmission electron microscopy (Hitachi, Tokyo, Japan) was used to observe the morphology of the nanocapsules. The sequences of the miRNAs used by the inventors are listed in Table 1.

[0161] Table 1 miRNA sequences used in this study

[0162]

[0163] 13. Transient Focal Cerebral Ischemia Rat Model

[0164] Male Sprague-Dawley (SD) rats (weighing 260–280 g) were randomly assigned to experimental groups and weight matching was ensured before starting the experimental protocol. Unless otherwise stated, researchers were not blinded to treatment groups during the study. et al . (2013) Biomaterials34, 817-830), a rat model of transient focal cerebral ischemia was induced by middle cerebral artery occlusion / reperfusion (MCAO / R). Briefly, SD rats were anesthetized with 10% chloral hydrate (350 mg / kg, intraperitoneal (ip)). Body temperature was monitored and maintained at 37°C. A midline incision was made on the ventral side of the neck, the muscles were gently pulled aside, and then the right common carotid artery and the junction of the internal and external carotid arteries were carefully dissected. The external carotid artery was ligated and cauterized. A surgical nylon monofilament (0.234 mm in diameter) with a rounded tip heated near a flame was inserted into the internal carotid artery through the notch of the external carotid stump to block the origin of the middle cerebral artery. After 1 hour of ischemia, the filament was pulled out for reperfusion.

[0165] Neurological scores were evaluated 24 hours after MCAO / R to confirm the successful establishment of the transient focal cerebral ischemia model (Liu et al . (2013), Same as above ). The behavioral assessment was performed by an examiner blinded to the experimental group. Neurological deficits were scored according to the following description: 0, no deficit; 1, difficulty in full extension of the contralateral forelimb; 2, inability to extend the contralateral forelimb; 3, mild coiling to the contralateral side; 4, severe coiling; and 5, falling to the contralateral side. Rats with neurological deficit scores ranging from 1 to 3 were selected as models. After evaluating the neurological scores, the rats were anesthetized and sacrificed, and brain sections were taken for HE staining to confirm the successful establishment of the transient focal cerebral ischemia model.

[0166] 14. In vivo treatment effects

[0167] Thirty rats with transient focal cerebral ischemia were randomly divided into three groups. n(miR-NC) and n(miR-21) were injected into the tail vein of model rats at a dose of 0.5 mg miRNA / kg rat every two days for a total of three times; an equal amount of PBS was given to control rats. Neurological scores were assessed as described above before each injection. On day 7 (two days after the last injection), the animals were sacrificed after the last evaluation of neurological deficit scores. The brain was quickly removed, coronally sliced ​​at 1 mm intervals, and stained by immersion in the vital dye (2%) 2,3,5-triphenyltetrazolium hydrochloride (TTC). The infarct volume was calculated by summing the infarct area of ​​all sections and multiplying it by the total section thickness. To avoid the potential influence of edema on the infarct volume value, the infarct volume was divided by the total volume of the ipsilateral hemisphere to calculate the infarct volume expressed as a percentage of infarction (Pignataro et al .(2009) FEBS J 276:46-57). Infarct size was assessed from scanned digital images using ImageJ software (NIH, Bethesda, MD) and expressed as a percentage. Coronal sections of the brain were fixed with 4% paraformaldehyde, dehydrated, and then embedded in paraffin for histochemical analysis.

[0168] Example 2. Systemic delivery of microRNA for the treatment of cerebral ischemia

[0169] This paper describes a platform technology based on microRNA nanocapsules, which enables their effective delivery to disease sites in the brain. Taking microRNA-21 as an example, intravenous injection of nanocapsules in a rat model of cerebral ischemia can effectively improve cerebral infarction volume, neurological deficits and histopathological severity. Exemplary nanoencapsulation technology, in which miRNA molecules are encapsulated in a thin network-polymer shell by in situ polymerization, Figure 1 Shown in A. Briefly, miRNA is first incubated with mixed monomers and a degradable cross-linker, glycerol dimethacrylate (GDMA). The mixed monomers include acrylamide (AAM), poly(ethylene glycol) methyl ether acrylate (mPEG), and the positively charged monomer N-(3-aminopropyl) methacrylamide (APM). Driven by non-covalent interactions (e.g., electrostatic interactions between negatively charged miRNA and APM), monomers and cross-linkers are enriched around miRNA molecules (step I). Subsequently, free radical polymerization is initiated to form a thin polymer layer around the miRNA core to obtain miRNA nanocapsules (denoted as n(miRNA)). GDMA molecules cross-link polymer chains to form a network structure surrounding the core miRNA (step II). GDMA is stable at neutral pH but degradable in acidic environments (Yan et al., 2011). et al. (2010) Nat Nanotechnol 5:48-53). The nanocapsule (polymer shell) is stable under physiological conditions (pH 7.4); upon entering the endosome with an acidic environment (pH 5.5), the GDMA crosslinker is cleaved and the shell is degraded, allowing the miRNA cargo to be released. Figure 1 B shows that after intravenous injection, vascular permeability increased in ischemic tissue (Kim et al .(2011) Nano Lett 11:694-700; England et al . (2016) Biomaterials 100:101-109) allows the extravasation and accumulation of nanocapsules in ischemic tissues, which enables the delivery of n(miRNA) to the target site (I). When the nanocapsules are internalized by cells, miRNA is released into the cytoplasm (II), inducing angiogenesis and regeneration of ischemic tissues (III).

[0170] result

[0171] Synthesis of miRNA nanocapsules

[0172] MiR-21, a miRNA that exhibits angiogenic and anti-apoptotic activities in various diseases (Buller et al. (2010) FEBS J 277:4299-4307; Chan et al. (2005) Cancer Res 65:6029-6033), was used as a demonstration of effective delivery of miRNA for brain tissue regeneration. Figure 2 A shows gel electrophoresis of miR-21 nanocapsules (n(miR-21)) synthesized using various monomer:miR-21 molar ratios (M / R) of 500:1, 1000:1, 2000:1, 4000:1, 6000:1, 8000:1, and 10000:1 and a fixed AAM:APM:mPEG:GDMA molar ratio of 54:5:1:6 ( Figure 3 A). Samples prepared with M / R ratios below 4000:1 exhibited a native miR-21 band, indicating incomplete encapsulation of miR-21. When the M / R ratio was higher than 4000:1, the samples showed no native miR-21 band and migrated toward the anode, indicating that miR-21 was completely encapsulated within the cationic polymer shell. This observation is consistent with the results of dynamic light scattering measurements (DLS, Figure 3 C) The zeta potentials obtained are consistent.

[0173] To further confirm that the miR-21 molecule was encapsulated within the polymer shell, Lipofectamine / miR-21 complexes (Lipo / miR-21) and n(miR-21) prepared at M / R ratios of 4000 to 10000 were incubated with 10 mg / mL heparin. Lipo / miR-21 is formed by assembling negatively charged miR-21 with positively charged Lipofectamine through non-covalent interactions, which is unstable in the presence of charged biomolecules such as heparin. As expected, gel electrophoresis showed that miR-21 was extracted from Lipo / miR-21 when the complex was dissociated in the presence of heparin. In contrast, for n(mir-21), miR-21 was encapsulated in the polymer shell network, and no extraction of miR-21 was observed from n(miR-21) after heparin incubation, indicating a highly stable encapsulation structure ( Figure 2 B).

[0174] Nanocapsules synthesized at M / R ratios ranging from 4000:1 to 10000:1 showed a slight decrease in hydrodynamic diameter from ~28 nm to ~18 nm ( Figure 3 B), and the zeta potential increased from ~6.9 mV to ~13.8 mV ( Figure 3C). At a fixed M / R ratio of 6000:1, different mPEG / miRNA ratios (50:1, 100:1, 250:1 and 500:1, Figure 4 A and Figure 4 B) n(miR-21) was also synthesized and showed a similar hydrodynamic diameter of ~30 nm ( Figure 4 C). However, as the percentage of mPEG increased, the zeta potential decreased from ~11.2 mV to ~4.6 mV ( Figure 4 D). Based on the relatively high internalization efficiency in model glioma cells (C6 cells, rat glioma cells) and the low nonspecific phagocytosis in model macrophages (J774A.1, mouse macrophages) Figure 5 ), nanocapsules synthesized using an M / R ratio of 6000:1 and an mPEG / miRNA ratio of 100:1 were used for further studies. Such nanocapsules have a spherical morphology with a diameter of ~25 nm and a surface charge of ~10 mV, which can be observed by transmission electron microscopy (TEM) ( Figure 2 C) and DLS ( Figure 2 D and Figure 2 E) confirmed.

[0175] Storage stability, RNase stability, non-specific protein adsorption and release kinetics of miRNA nanocapsules

[0176] To examine the storage stability of n(miR-21), the hydrodynamic diameter of n(miR-21) was monitored by DLS measurement under different conditions: (i) different storage times at 4°C in the presence of physiological salt concentration; (ii) different storage temperatures (25°C, 37°C, and 60°C); and (iii) storage in the presence and absence of 10% serum. The results showed that the nanocapsules were stable in PBS solution at 4°C for one week ( Figure 6 A), while the presence of 10% serum induced the aggregation of nanocapsules during one week of storage ( Figure 6 C). In addition, the change in storage temperature did not result in a change in the size of n(miR-21) ( Figure 6 B).

[0177] The nanocapsules showed enhanced stability against ribonucleases (RNases) and minimized nonspecific adsorption of proteins. After incubation with RNase A and mouse serum for 2 hr, miRNA was extracted from both Lipo / miR-21 and n(miR-21) and then quantified by real-time PCR. Figure 2As shown in F, comparing native miR-21 and Lipo / miR-21, n(miR-21) showed that encapsulated miR-21 had a more effective protection against RNase and serum. In addition, the mPEG chains on the nanocapsules minimized the non-specific adsorption of proteins. Figure 2 As shown in G, after incubation with mouse serum at 37°C for 30 min, n(miR-21) exhibited minimal protein adsorption, while Lipo / miR-21 showed significant protein adsorption. To verify that the mPEG chains on the nanocapsule shell were responsible for the reduced protein adsorption, comparative nanocapsules without mPEG (containing only AAM and APM monomers) (referred to as no-PEG n(miR-21)) were synthesized and showed significant serum protein adsorption ( Figure 7 ). Reducing non-specific adsorption of proteins is crucial to extending the circulation life of proteins (Gref et al. (1995) Adv Drug Deliv Rev 16:215-233).

[0178] The degradation kinetics of n(miR-21) in an acidic environment (e.g., pH 5.5, similar to the endosomal environment) was dynamically monitored by measuring the scattered light intensity using DLS (Gu et al . (2009), Same as above ; Liu et al . (2015), Same as above ). Figure 2 As shown in H, in an endosomal-mimicking environment (pH 5.5), the relative scattered light intensity decreased from 100% to ~40% within 2 h of incubation at 37°C, demonstrating the degradation of n(miR-21), while no significant change in the relative scattered light intensity was observed at pH 7.4. Agarose gel electrophoresis was used to further confirm the release of miRNA from the nanocapsules upon their degradation. Figure 2 As shown in FIG. 1 , at pH 5.5, significant extraction of miR-21 was observed in the presence of 1 mg / mL heparin, whereas no extraction of miR-21 from n(miR-21) was observed at pH 7.4.

[0179] Cellular internalization efficiency, non-specific phagocytosis, cytotoxicity and bioactivity of miRNA nanocapsules

[0180] To estimate the delivery efficiency, miR-21 was first labeled with fluorescein isothiocyanate (FITC) and encapsulated in nanocapsules. The cellular internalization of n(miR-21) was evaluated using C6 cells. Fluorescence images of C6 cells after 4-hr incubation with miR-21, n(miR-21), and Lipo / miR-21 are shown in Figure 8A. Both n(miR-21) and Lipo / miR-21 showed efficient internalization of miR-21 in C6 cells. Based on the intensity of FITC quantified by flow cytometry, the internalization efficiency of N(miR-21) reached ~60% in C6 cells ( Figure 8 B).

[0181] The non-specific phagocytosis of n(miR-21) and Lipo / miR-21 was evaluated in J744A.1 mouse macrophages. Compared with Lipo / miR-21, n(miR-21) showed 1 / 10 of the non-specific phagocytosis ( Figure 8 D. Figure 8 E and Fig. 9 ). In addition, scrambled miRNA (miR-NC) was used to synthesize n(miR-NC) and Lipo / miR-NC to study cytotoxicity. Lipo / miR-NC showed increasing toxicity with increasing doses, while n(miR-NC) showed comparable cell viability to miR-NC itself, indicating minimal toxicity from the polymer shell of n(miR-NC) ( Figure 8 C).

[0182] The expression of miR-21 in C6 cells by the two delivery systems was quantitatively compared by qRT-PCR to detect their biological activities. miR-NC was first delivered by both systems to monitor its disruption of miR-21 expression. Neither system showed a significant effect on miR-21 expression ( Fig.10 ). We further compared the transfection efficiency of miR-21 between n(miR-21) and Lipo / miR-21. Figure 8 As shown in F, in the absence of serum, Lipo / miR-21 and n(miR-21) upregulated the expression of miR-21 to 19-fold and 12-fold, respectively. However, in the presence of serum, n(miR-21) still upregulated the expression to more than 8-fold, while Lipo / miR-21 only upregulated the expression of miR-21 to about 5-fold, losing 75% of its capacity. Antisense miR-21 (AS-miR-21) was also used to compare the miRNA transfection capacity of the two methods. In serum-free conditions, n(AS-miR-21) and Lipo / miR-21 effectively downregulated the expression of miR-21 to 26% and 18%, respectively. In addition, in the presence of serum, n(AS-miR-21) still significantly knocked down the expression of miR-21 to 32%, while Lipo / miR-21 only maintained a silencing effect of 56% ( Fig.10 ). These results demonstrate that the nanocapsule-delivery system is safe and effective for regulating intracellular miRNA levels.

[0183] To further evaluate the activity of mir-21 released from nanocapsules, the regulation of its downstream proteins related to angiogenesis, hypoxia and apoptosis was analyzed by Western blot assay. The results showed that the delivery of n(miR-21) effectively increased the expression of AKT, HIF1-α and VEGF, while reducing the expression of PTEN ( Figure 8 G and Fig.11 A). Meanwhile, n(AS-miR-21) regulated these proteins in the opposite way. In addition, neither n(miR-NC) nor n(AS-miR-NC) interfered with the expression of any of the above proteins ( Fig.11 B), further demonstrating the safety and efficacy of this type of nanocapsules.

[0184] Biodistribution, pharmacokinetics, hepatotoxicity, and delivery efficiency of intravenously administered miRNA nanocapsules

[0185] The in vivo application of miRNA nanocapsules for the treatment of cerebral ischemia was demonstrated in a rat model of transient focal cerebral ischemia induced by middle cerebral artery occlusion / reperfusion (MCAO / R). Fig.13 ). MiR-21 labeled with Cy5.5 (Cy5.5-miR-21) was used to synthesize Lipo / miR-21 and n(miR-21). Then, one day after ischemic injury, these two samples were intravenously injected at a dose of 0.5 mg / kg miR-21. 24 hours after administration, the accumulation of samples in ischemic and non-ischemic brains was analyzed using both fluorescence imaging and qRT-PCR.

[0186] Both ischemic and non-ischemic rats treated with n(miR-21) showed stronger fluorescence intensities in the head and isolated brain tissues than those treated with Lipo / miR-21 ( Fig.12 A). The radiative efficiency of miR-21 delivered by n(miR-21) or Lipo / miR-21 was quantitatively compared in ischemic and non-ischemic rats. Fig.12 As shown in B, in ischemic rats, the radiation efficiency of n(miR-21) was 2-fold and 3.5-fold that of Lipo / miR-21 and PBS controls, respectively, indicating that n(miR-21) was more effectively delivered to ischemic brain tissue. After delivery, the expression of miR-21 in ischemic and non-ischemic brain tissues was further compared by qRT-PCR ( Fig.12C). The levels of miR-21 in ischemic rat brains treated with n(miR-21) were shown to be 2.7-fold higher than those treated with Lipo / miR-21. No significant changes in miR-21 levels were observed in non-ischemic brains treated with Lipo / miR-21 or n(miR-21), indicating that n(miR-21) enhances regulation in ischemic brain tissues compared to Lipo / miR-21.

[0187] Major organs including liver, spleen, kidney, heart, and lung were collected for biodistribution studies by ex vivo imaging. Minimal signals from n(miR-21) were detectable in organs associated with the reticuloendothelial system (RES), such as the liver and spleen, whereas significant accumulation of Lipo / miR-21 was observed in RES organs ( Fig.12 D). Further quantification of organ radiation efficiency showed that the accumulation of Lipo / miR-21 in the liver, spleen, and kidney was 5-fold, 3-fold, and 3.5-fold higher than that of n(miR-21), respectively ( Fig.12 E). The pharmacokinetic characteristics of Lipo / miR-21 and n(miR-21) were also evaluated by quantitatively measuring the intensity of Cy5.5 in plasma. As expected, n(miR-21) showed enhanced blood persistence compared with Lipo / miR-21 ( Fig.12 F). The concentration-time curve was fitted with a two-compartment model, and the obtained PK parameters are listed in Table 2. The area under the concentration-time curve of n(miR-21), elimination half-life (t 1 / 2 ) and mean residence time were significantly higher than those of Lipo / miR-21, indicating that administration of n(miR-21) resulted in higher miR-21 concentrations in systemic circulation over an extended lifespan.

[0188] Table 2 Pharmacokinetic parameters of lipo / miR-21 and n(miR-21)

[0189]

[0190] a Elimination half-life

[0191] b Area under the plasma miRNA concentration versus time curve

[0192] c Average stay time

[0193] Compared with Lipofectamine-mediated delivery, the results provided show that nanocapsules lead to improved efficiency of delivery to ischemic brain, reduced accumulation in RES organs, and prolonged half-life in blood. In addition, since acute hepatotoxicity is a major concern for systemic delivery of nanomedicines, blood chemistry parameters reflecting liver function 24 hours after intravenous administration of nanocapsules were also evaluated (Table 3). In contrast to rats injected with PBS, significant liver dysfunction was observed in rats injected with Lipo / miR-21, while for n(miR-21), no significant hepatotoxicity was observed even with a dose of up to 0.5 mg / kg. Due to severe hepatotoxicity, Lipo / miR-21 was not studied in further in vivo studies.

[0194] Table 3. Blood chemistry analysis of treated rats measured by ELISA 24-h after systemic administration of lipo / miR-21 and n(miR-21). Data are shown as mean ± SEM ( n =5).

[0195]

[0196] Intracarotid artery ( ic .) Injection has been considered an effective strategy to avoid the accumulation of colloid drugs within the RES and maximize the bioavailability of the administered drug. However, it also requires surgical experience and is limited in dose and frequency of administration (Chen et al . (2015) Adv Drug Deliv Rev 81:128-141; Kim et al . (2011), Same as above In this regard, intravenous ( iv .) Injections are actually more acceptable. Fig.12 G pair ic .or iv Fluorescence images of intact and excised brains after injection of n(miR-21) were compared. iv .Injected rats showed ic . The injected rats had lower fluorescence intensity in the brain tissue. At a higher injection dose (0.5 mg / kg), the fluorescence intensity was similar ( Fig.12 H); further qRT-PCR results confirmed iv .Injection and ic . The similar efficacy of injection of both ( Fig.12 I), Tips iv .Injection of nanocapsules may be an effective drug delivery strategy for the treatment of cerebral ischemia.

[0197] The therapeutic effect of miRNA-21 nanocapsules in rats with transient focal cerebral ischemia

[0198] The therapeutic effect of n(miR-21) was examined in a rat model of transient focal cerebral ischemia induced by MCAO / R. 24 hours after the establishment of ischemia, n(miR-NC) and n(miR-21) were injected into the tail vein for 3 times every other day at a dose of 0.5 mg / kg miRNA, with an equal amount of PBS used as a negative control. The therapeutic benefits of n(miR-21) were mainly determined based on their neurological function and ischemic infarct volume. Before each injection, neurological outcomes were evaluated and scored on a five-point scale according to a double-blind test.

[0199] As in Fig.14 As shown in A, the mean neurological deficit scores of rats treated with PBS or n(miR-NC) improved only slightly over time, whereas rats treated with n(miR-21) showed significantly improved performance. Brain tissues were collected on day 7 to assess infarct volume by 2,3,5-triphenyltetrazolium hydrochloride (TTC) staining. Fig.14 B and Fig.14 As shown in C, TTC-stained brains of n(miR-21)-treated rats exhibited significantly reduced infarct volume (~45%) compared with rats treated with PBS or n(miR-NC). Further histopathological analysis of ischemic brains by hematoxylin-eosin (H&E) staining showed that transient focal cerebral ischemia induced by MCAO / R resulted in significant neuronal necrosis in the ischemic core and penumbra, which appeared as eosinophilic neurons on H&E-stained sections ( Fig.14 D). In contrast to the PBS and n(miR-NC) groups, administration of n(miR-21) significantly protected neurons from necrosis and improved pathological symptoms.

[0200] To finally confirm the therapeutic effect of miR-21, in situ hybridization and immunohistochemistry were also used to analyze the expression levels of miR-21 and downstream proteins in the ischemic border zone (IBZ). Fig.14 miR-21 expression in the IBZ was labeled by Cy3 and directly visualized in representative micrographs, shown in E. The red fluorescence intensity of miR-21 from brains treated with n(miR-21) was stronger than those treated with PBS or n(miR-NC), suggesting that n(miR-21) effectively regulates miR-21 levels in the IBZ.

[0201] The delivered miR-21 also regulated proteins related to angiogenesis or neuroprotection. As confirmed by immunohistochemistry results, HIF-1α, a transcription factor that controls the expression of vascular endothelial growth factor (VEGF), was expressed in the nucleus (Oladipupo et al., 2011). et al .(2011) Proc Natl Acad Sci USA 108:13264-13269; Semenza (2000) J Clin Invest 106:809-812) expression was significantly increased in brain tissues collected from n(miR-21)-treated rats (compared to those treated with n(miR-NC)) ( Fig.14 F). VEGF is an important regulator of vascular survival and angiogenesis, with clear potential for neuroprotection and regeneration (Oladipupo et al . (2011), Same as above ). CD31 (an important marker for angiogenesis) (Deshpande et al . (2011) Radiology 258: 804-811), as well as the level of glial acidic protein (GFAP), a marker of neural injury, were increased in the brain tissues of n(miR-21)-treated rats, suggesting the pro-angiogenic effect of VEGF and the good biological activity of n(miR-21) in vivo.

[0202] In addition, in cerebral ischemia / reperfusion injury, delayed neuronal death is associated with apoptosis, especially in the ischemic penumbra (Lee et al . (2000) J Clin Invest 106:723-731). In this study, TUNEL analysis was used to detect neuronal apoptosis. Significantly less green fluorescence was observed in brain sections of n(miR-21)-treated rats, indicating less neuronal apoptosis in the IBZ ( Fig.15 ). Consistent with previous reports, upregulation of miR-21 reduced neuronal death (Buller et al . (2010) FEBS J 277:4299-4307). In addition, H&E staining of major organs showed neither detectable pathological effects nor myocardial damage in n(miR-21)-treated rats after 7-day treatment ( Fig.16 ), indicating that n(miR-21) has good therapeutic effect and satisfactory safety.

[0203] In summary, a platform technology has been developed for the efficient systemic delivery of miRNAs that could provide new therapeutics for cerebral ischemia, a leading cause of death and disability, as well as other diseases.

[0204] References

[0205] 1. Isner JM. J Clin Invest 106, 615 - 619 (2000).

[0206] 2. Semenza GL. J Clin Invest 106, 613 - 614 (2000).

[0207] 3. Eltzschig HK, Eckle T. Nat Med 17, 1391 - 1401 (2011).

[0208] 4. Upadhyay RK. Biomed Res Int 2014, 869269 (2014).

[0209] 5. Rosenberg GA. J Cereb Blood Flow Metab 32, 1139 - 1151 (2012).

[0210] 6. Gállego J, Muñoz R, Martínez - Vila E. Cerebrovasc Dis 27(suppl 1),88 - 96 (2009).

[0211] 7. Luengo - Fernandez R, Gray AM, Rothwell PM. Stroke 40, e18 - 23 (2009).

[0212] 8. Novakovic R, Toth G, Purdy PD. J Neurointerv Surg 1, 13 - 26 (2009).

[0213] 9. Hankey GJ. Stroke. Lancet , Preprint at http: / / dx.doi.org / 10.1016 / S0140 - 6736(16)30962 - X (2016).

[0214] 10. Lee JM, Grabb MC, Zipfel GJ, Choi DW. J Clin Invest 106, 723 - 731(2000).

[0215] 11. Hacke W , et al.N Engl J Med 359, 1317 - 1329 (2008).

[0216] 12. Goyal M , et al.Stroke 47, 548 (2016).

[0217] 13. Del Zoppo GJ, Saver JL, Jauch EC, Adams HP, Jr., Stroke 40, 2945-2948 (2009).

[0218] 14. Emberson J , et al.Lancet 384, 1929-1935 (2014).

[0219] 15. Mead GE , et al.Cochrane Database Syst Rev 11, CD009286 (2012).

[0220] 16. Mortensen JK, Andersen G. Expert Opin Drug Saf 14, 911-919 (2015).

[0221] 17. Prasad K , et al.Stroke 45, 3618-3624 (2014).

[0222] 18. Kalladka D , et al.Lancet 388, 787-796 (2016).

[0223] 19. Beavers KR, Nelson CE, Duvall CL. Adv Drug Deliv Rev 88, 123-137(2015).

[0224] 20. Inui M, Martello G, Piccolo S. Nat Rev Mol Cell Biol 11, 252-263(2010).

[0225] 21. Caputo et al. Adv Drug Deliv Rev 88, 78-91 (2015).

[0226] 22. Liang TY, Lou JY. Med Sci Monit 22, 2950-2955 (2016).

[0227] 23. Zhao H , et al.Stroke 44, 1706-1713 (2013).

[0228] 24. Buller B , et al.FEBS J 277, 4299-4307 (2010).

[0229] 25. Chen Y, Gao DY, Huang L. Adv Drug Deliv Rev 81, 128-141 (2015).

[0230] 26. Kim et al. Nano Lett 11, 694-700 (2011).

[0231] 27. Pecot et al. Nat Rev Cancer 11, 59-67 (2011).

[0232] 28. Vickers KC, Remaley AT Curr Opin Lipidol 23, 91-97 (2012).

[0233] 29. Crooke ST , et al.J Pharmacol Exp Ther 277, 923-937 (1996).

[0234] 30. Cheng CJ , et al . Nature 518, 107-110 (2015).

[0235] 31. Davis ME , et al.Nature 464, 1067-1070 (2010).

[0236] 32. Gibbings et al. Nat Cell Biol 11, 1143-1149 (2009).

[0237] 33. The YP , et al.Biomaterials 33, 1462-1476 (2012).

[0238] 34. Chiou GY , et al.J Control Release 159, 240-250 (2012).

[0239] 35. Kanasty et al. Nat Mater 12, 967-977 (2013).

[0240] 36. Zhang Y, Wang Z, Gemeinhart RA. J Control Release 172, 962-974(2013).

[0241] 37. Hwang DW , et al.Biomaterials 32, 4968-4975 (2011).

[0242] 38. Yan M , et al.Nat Nanotechnol 5, 48-53 (2010).

[0243] 39. England CG , et al.Biomaterials 100, 101-109 (2016).

[0244] 40. Chan et al. Cancer Res 65, 6029-6033 (2005).

[0245] 41. Shi et al. Angew Chem Int Ed Engl 52, 3901-3905 (2013).

[0246] 42. Graf R , et al.Adv Drug Deliv Rev 16, 215-233 (1995).

[0247] 43. Gu Z , et al . Nano Lett 9, 4533-4538 (2009).

[0248] 44. Liu C , et al.Adv Mater 27, 292-297 (2015).

[0249] 45. Oladipupo S , et al.Proc Natl Acad Sci U S A 108, 13264-13269(2011).

[0250] 46. ​​Seed GL. J Clin Invest 106, 809-812 (2000).

[0251] 47. Deshpande et al. Radiology 258, 804-811 (2011).

[0252] 48. Yang Z, Wang KK. Trends Neurosci 38, 364-374 (2015).

[0253] 49. Liu et al. Biomaterials 34, 817-830 (2013).

[0254] 50. Pignataro et al. FEBS J276, 46-57 (2009).

[0255] Incorporate by Reference

[0256] All publications and patents mentioned herein are incorporated by reference in their entirety to the same extent as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. In the event of a conflict, the present application, including any definitions herein, will control.

[0257] Equivalent

[0258] Although specific embodiments of the present invention have been discussed, the above description is illustrative rather than restrictive. Many variations of the present invention will become apparent to those skilled in the art after reviewing this specification and the following claims. The full scope of the present invention should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

Claims

1. Use of a polymer nanocapsule in preparing a drug for treating cerebral ischemia or cerebral ischemia-reperfusion injury, wherein the polymer nanocapsule comprises a polymer shell and an RNA interference (RNAi) molecule, wherein the polymer shell comprises at least a) N-(3-aminopropyl)methacrylamide (APM) as a positively charged monomer, b) glycerol dimethacrylate (GDMA) as a degradable crosslinker, and c) acrylamide (AAM) and poly(ethylene glycol) methyl ether acrylate (mPEG) as neutral monomers, The treatment comprises systemically administering the polymer nanocapsules, wherein the RNAi molecule comprises at least one RNAi selected from microRNA (miRNA), antisense microRNA (AS-miRNA), small interfering RNA (siRNA) and small hairpin RNA (shRNA), wherein the RNAi knocks down or reduces the expression of an overexpressed gene and / or increases the expression of a gene whose expression is reduced or inhibited, thereby treating cerebral ischemia or cerebral ischemia-reperfusion injury; wherein the molar ratio of the degradable cross-linking agent to the positively charged monomer is 1:2 to 2:1; and The molar ratio of the positively charged monomer to the neutral monomer is 1:5 to 1:

20.

2. The use of claim 1, wherein the polymer shell further comprises at least one non-degradable crosslinking agent.

3. The use of claim 1 or 2, wherein the polymer shell further comprises a degradable crosslinker selected from the group consisting of 1,3-glycerol dimethacrylate, glycerol 1,3-diglycerol glycolic acid diacrylate, N,N'-bis(acryloyl)cystamine, bis[2-(methacryloyloxy)ethyl]phosphate and a crosslinker of a bisacryloyl polypeptide.

4. The method of claim 1 or 2, wherein the positively charged monomer is further selected from the group consisting of N-(3-aminopropyl)methacrylamide hydrochloride, propylene-spermine, dimethylaminoethyl methacrylate, (3-acrylamidopropyl)trimethylammonium hydrochloride, N-(3-((4-((3-aminopropyl)amino)butyl)amino)propyl)methacrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, N-(3-((4-aminobutyl)amino)propyl)acrylamide, The invention also includes the following: N-(2-((2-aminoethyl)(methyl)amino)ethyl)acrylamide, N-(2-((2-aminoethyl)(methyl)amino)ethyl)methacrylamide, N-(piperazin-1-ylmethyl)acrylamide, N-(piperazin-1-ylmethyl)methacrylamide, N-(2-(bis(2-aminoethyl)amino)ethyl)acrylamide and N-(2-(bis(2-aminoethyl)amino)ethyl)methacrylamide.

5. The use according to claim 1 or 2, wherein the molar ratio of the degradable cross-linking agent to the total monomers is 1:5 to 1:

10.

6. The use according to claim 1 or 2, wherein the molar ratio of the degradable cross-linking agent to the positively charged monomer is 2:1 to 1:1 or 1:1 to 1:

2.

7. The use according to claim 1 or 2, wherein the molar ratio of the positively charged monomer to the neutral monomer is from 1:10 to 1:

15.

8. The use of claim 6, wherein the molar ratio of APM:mPEG is 5:1 to 5:

5.

9. The use of claim 1 or 2, wherein the molar ratio of total monomers to RNAi is 1000:1 to 10000:

1.

10. The use of claim 1 or 2, wherein the RNAi is selected from RNAi that modulates a gene that induces reduced apoptosis, increased angiogenesis, increased neurogenesis, or increased neural plasticity.

11. The use of claim 1 or 2, wherein the RNAi is selected from RNAi that increases the expression of at least one of VEGF, GFAP, CD31, CD34, BCL-2, NeuN, bromodeoxyuridine, nestin, PSA-NCAM, doublecortin, Pax6, GAP-43, AKT, or HIF1-α.

12. The use according to claim 1 or 2, wherein the RNAi is selected from RNAi that reduces the expression of caspase 3 or PTEN.

13. The use according to claim 1 or 2, wherein the polymer nanocapsule has a diameter of 18 nm to 250 nm, or a diameter of 18 nm to 28 nm.

14. The use of claim 1 or 2, which has reduced non-specific protein adsorption compared to control nanocapsules without neutral monomers.

15. The use of claim 1 or 2, wherein the polymer nanocapsule is stable at neutral pH and degradable at acidic pH.

16. The use of claim 1 or 2, wherein the polymer nanocapsule is degradable in the late endosome.

17. The use according to claim 1 or 2, which is further conjugated with a labeling agent or a targeting agent.

18. The use according to claim 17, wherein the labeling agent is selected from fluorescent agents and / or radioisotopes.

19. The method of claim 17, wherein the targeting agent is selected from the group consisting of TAT (transduction domain of human immunodeficiency virus type 1 (HIV-1)) peptide, diphtheria toxin, tetanus toxin, Tet1, capsid protein G23, rabies virus glycoprotein (RVG) peptide, opioid peptides, glutathione, thiamine, leptin, angiopep, low-density lipoprotein, insulin, melanocyte transferrin and transferrin.

20. The use of claim 17, wherein the targeting agent delivers the polymer nanocapsule to a cell type selected from the group consisting of endothelial cells, microglia, neurons, and astrocytes.

21. The use according to claim 1 or 2, wherein the medicament further comprises a pharmaceutically acceptable carrier.

22. The use of claim 1 or 2, having an internalization efficiency of at least 40%, at least 50%, at least 60% or at least 70%.

23. The use of claim 1 or 2, wherein administration of the polymer nanocapsules induces a physiological process selected from reduced apoptosis, increased neurogenesis, increased neural plasticity, or increased angiogenesis.

24. The use of claim 1 or 2, wherein administration of the polymer nanocapsules increases the expression of at least one of VEGF, GFAP, CD31, CD34, BCL-2, NeuN, bromodeoxyuridine, nestin, PSA-NCAM, doublecortin, Pax6, GAP-43, AKT, or HIF1-α.

25. The use of claim 1 or 2, wherein administration of the polymer nanocapsules reduces the expression of at least one of caspase 3 or PTEN.

26. The method of claim 1, wherein the drug is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1.0 mg / kg, 1.5 mg / kg or 2.0 mg / kg.

27. The use of claim 1, wherein the medicament is administered at a dose exceeding 2.0 mg / kg.

28. The use of claim 26, wherein the medicament is administered at a dose of 0.5 mg / kg.

29. The use according to claim 26, 27 or 28, wherein the medicament is suitable for intravenous and / or intracarotid administration.

30. The use of claim 1 or 2, wherein the polymer nanocapsules are prepared by the steps comprising: a) dissolving RNAi molecules in RNase-free water; b) dissolving positively charged monomers, neutral monomers, and degradable cross-linking agents in deoxygenated and deionized water to create a monomer mixture; c) combining the dissolved RNAi molecules of step a) with the monomer mixture of step b); d) adding ammonium persulfate and N,N,N',N'-tetramethylethylenediamine to the product of step c), and e) incubating the product of step d) in a serum-free medium.

Images