Primer pair for mecA gene amplification, mecA gene detection kit and mecA gene detection method

Abstract

The present invention provides a primer pair comprising a combination of sequence numbers 3 and 7, a combination of sequence numbers 2 and 9, a combination of sequence numbers 1 and 8, a combination of sequence numbers 1 and 9, a combination of sequence numbers 4 and 11, a combination of sequence numbers 5 and 12, a combination of sequence numbers 6 and 10, or a combination of sequence numbers 6 and 12 as a primer for detecting a methicillin resistance gene for realizing highly sensitive methicillin resistance gene detection.

Description

Technical Field

[0001] The present invention relates to a primer pair, a kit and a detection method for simply, rapidly and with high sensitivity detecting the mecA gene as a specific genetic element of methicillin resistance. Background Art

[0002] Methicillin resistant Staphylococcus aureus (hereinafter referred to as "MRSA") is the main pathogen of nosocomial infection in the world, and is valued as the most important clinical drug-resistant bacteria in many countries. mecA, a gene related to methicillin resistance of MRSA, encodes PBP (Penicillin Binding Protein)-2' (also known as PBP-2a). Generally, Staphylococcus aureus mainly produces four kinds of PBP. PBP is a protein involved in the synthesis of peptidoglycan of cell wall and has transpeptidase activity. β-lactam antibiotics exert their effects by binding to the active site of PBP, thereby inhibiting transpeptidase activity and inhibiting peptidoglycan synthesis. However, PBP-2' avoids the effect of inhibiting peptidoglycan synthesis by reducing affinity with β-lactam antibiotics (Non-patent Document 1).

[0003] For Staphylococcus aureus and coagulase-negative Staphylococci, the presence or absence of methicillin resistance is very important information in the diagnosis of infected patients and the determination of treatment guidelines. Although Staphylococcus aureus is more pathogenic than other coagulase-negative Staphylococci because of its strong pathogenicity, it is more important than other coagulase-negative Staphylococci. However, for Staphylococcus aureus and coagulase-negative Staphylococci that have acquired methicillin resistance, infection of susceptible hosts is still a big problem. Therefore, as a countermeasure against nosocomial infection caused by methicillin-resistant Staphylococci, rapid detection of methicillin resistance has been desired to achieve rapid diagnosis and treatment.

[0004] As a method for testing methicillin resistance, methods such as drug sensitivity test, immunoassay, and detection using PCR (polymerase chain reaction) can be performed (Non-Patent Document 2).

[0005] In the drug sensitivity test, blood collected from the patient needs to be cultured for more than one day to increase the number of staphylococci. In addition, immunoassay also requires a process of culturing staphylococci, so it takes more than one day to obtain the results of the methicillin resistance test.

[0006] Compared with the above, nucleic acid amplification tests such as PCR have a much higher sensitivity, so there is no need for a culture process and the test can be performed directly using the patient's blood. Therefore, the test results can be submitted within a few hours after the patient's blood sample arrives (Patent Document 1).

[0007] Prior art literature

[0008] Patent Literature

[0009] Patent Document 1: International Publication No. 2007 / 097323

[0010] Non-patent document 1: Journal of Bacteriology, May 1980, p.275

[0011] Non-patent document 2: Journal of Clinical Microbiology, July 1992, p.1685 Summary of the invention

[0012] Problems to be solved by the invention

[0013] Although several methods for detecting methicillin resistance genes using nucleic acid amplification such as PCR have been reported, most reports do not clearly describe specific detection sensitivity. There is only one report that clearly describes the detection sensitivity, but does not achieve a detection sensitivity sufficient for use in clinical settings (Non-Patent Document 2).

[0014] On the other hand, the detection of methicillin resistance genes has a great impact on the diagnosis and treatment of patients, so the development of a method for rapid, accurate and reliable detection is a clinical priority. Therefore, the present invention aims to rapidly, accurately and reliably detect methicillin resistance genes. In particular, the present invention aims to provide a primer pair for achieving highly sensitive methicillin resistance gene detection.

[0015] Means for solving problems

[0016] The present invention is a method for directly and rapidly identifying a methicillin resistance gene from a patient specimen by using a nucleic acid amplification method, and reliably detecting the gene with higher detection sensitivity than conventional methods. The inventors of the present application aimed to establish a highly sensitive and rapid method for detecting a methicillin resistance gene, and focused on the PCR method. In particular, the inventors studied primers used in the PCR method in order to detect the methicillin resistance gene with high sensitivity.

[0017] Primers were designed using the following conditions.

[0018] The size of the amplified DNA fragment is increased within the range that does not reduce the amplification efficiency. Specifically, the size of the DNA fragment is set to be more than 150 bp and less than 700 bp. By increasing the size of the amplified DNA fragment, the fluorescence intensity of the amplification curve during the PCR reaction is improved, and the height of the peak obtained in the melting analysis (Melting analysis) is also increased.

[0019] The sequence of mecA homologues was verified, and the base sequence of the primer pair was designed only for the highly conserved portion. Specifically, the base sequence was corrected to a highly conserved sequence, excluding the case where the sequence contained a low conservation within 5 bases from the 3' end of the primer.

[0020] Based on the above concept, 32 specific Fwd and Rev primers were prepared and combined to prepare 313 primer pairs that were considered feasible. The most suitable combination was studied among them, thereby screening out primer pairs that can achieve higher detection sensitivity than Patent Document 1, which was previously applied for.

[0021] That is, the primer pair involved in the present invention is a primer pair for detecting the mecA gene (methicillin resistance gene), characterized in that:

[0022] The primer pair is a primer pair selected from the group consisting of the following (a) to (c),

[0023] (a) a primer pair comprising a combination of SEQ ID NO: 3 and SEQ ID NO: 7, a combination of SEQ ID NO: 2 and SEQ ID NO: 9, a combination of SEQ ID NO: 1 and SEQ ID NO: 8, a combination of SEQ ID NO: 1 and SEQ ID NO: 9, a combination of SEQ ID NO: 4 and SEQ ID NO: 11, a combination of SEQ ID NO: 5 and SEQ ID NO: 12, a combination of SEQ ID NO: 6 and SEQ ID NO: 10, or a combination of SEQ ID NO: 6 and SEQ ID NO: 12;

[0024] (b) a primer pair in (a) above, wherein one or both primers have 1 to 2 bases added, deleted or substituted to a portion of their base sequences within a range that does not impair their functions as primers;

[0025] (c) A primer pair comprising a complementary sequence corresponding to the base sequence of (a) or (b) above.

[0026] The mecA gene detection kit according to the present invention is characterized by comprising at least one primer pair selected from the group consisting of (a) to (c) above.

[0027] The method for detecting mecA in a sample according to the present invention is characterized by comprising the following steps:

[0028] a PCR step of performing PCR using the DNA prepared from the sample and a primer pair for amplifying the DNA; and

[0029] a step of detecting the mecA gene in the sample by detecting the mecA gene in the amplification product obtained by the PCR step or analyzing the amplification product;

[0030] The primer pair used in the PCR step is at least one primer pair selected from the group consisting of (a) to (c) above.

[0031] Effects of the Invention

[0032] According to the present invention, a PCR primer pair and a mecA gene detection kit for highly sensitive mecA gene detection, as well as a mecA gene detection method can be provided. Therefore, according to the present invention, it is possible to detect trace amounts of mecA genes in specimens in the medical field, the food field, etc. with high sensitivity and high accuracy compared to conventional test kits. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] [ Figure 1 ] is a graph showing comparison of measurement results in methicillin-resistant strains and methicillin-sensitive strains. Figure 1 (a) shows the amplification curve and Tm value measurement results when using a sample derived from a methicillin-resistant strain, Figure 1 (b) shows the amplification curve and Tm value measurement results when a sample derived from a methicillin-sensitive strain was used. DETAILED DESCRIPTION

[0034] <Primer>

[0035] In the present invention, a primer refers to a DNA that serves as a starting point for DNA replication in the PCR method. In the present specification, a primer refers to a DNA primer unless otherwise specified.

[0036] The inventive point of the present invention lies in a specific primer pair that can enjoy the effect of improving detection sensitivity.

[0037] The pair of a primer consisting of the base sequence of sequence number 45 and a primer consisting of the base sequence of sequence number 46 described in patent document 1 has a DNA sequence that hybridizes with a sequence in the structural gene of the methicillin resistance gene (mecA). It should be noted that the base sequence of sequence number 45 and the base sequence of sequence number 46 described in patent document 1 are respectively recorded as sequence numbers 13 and 14 in this specification.

[0038] However, even the above primer pair does not have sufficient detection sensitivity in the detection method using PCR and cannot detect low concentrations of mecA (Example 5 and Table 2 described below). When analyzing a specimen containing low concentrations of MRSA, there is a possibility that a false negative will be shown due to insufficient detection sensitivity.

[0039] The structural gene of the mecA gene consists of about 2100 bp, and the inventors of the present application have found that the mecA gene can be detected with higher sensitivity by performing PCR using each primer pair included in the following group a designed by the inventors to hybridize with the structural gene.

[0040] Group (a):

[0041] (a1) A primer pair comprising a combination of a primer comprising SEQ ID NO: 3 and a primer comprising SEQ ID NO: 7.

[0042] (a2) A primer pair comprising a combination of a primer comprising SEQ ID NO: 2 and a primer comprising SEQ ID NO: 9.

[0043] (a3) A primer pair comprising a combination of a primer comprising SEQ ID NO: 1 and a primer comprising SEQ ID NO: 8.

[0044] (a4) A primer pair comprising a combination of a primer comprising SEQ ID NO: 1 and a primer comprising SEQ ID NO: 9.

[0045] (a5) A primer pair comprising a combination of a primer comprising SEQ ID NO: 4 and a primer comprising SEQ ID NO: 11.

[0046] (a6) A primer pair comprising a combination of a primer comprising SEQ ID NO: 5 and a primer comprising SEQ ID NO: 12.

[0047] (a7) A primer pair comprising a combination of a primer comprising SEQ ID NO: 6 and a primer comprising SEQ ID NO: 10.

[0048] (a8) A primer pair comprising a combination of a primer comprising sequence number 6 and a primer comprising sequence number 12.

[0049] As long as it is within the scope of being able to enjoy the effects of the present invention, a modified primer comprising a modified base sequence may also be applied, wherein the modified base sequence is obtained by changing a portion of the bases in the base sequence possessed by the DNA fragment (oligonucleotide) constituting each of the above-mentioned primers. In principle, as long as the modified primer can hybridize with the complementary DNA strand of each of the above-mentioned primers, it is considered to be equivalent to each primer. Furthermore, the modified primer considered to be equivalent is preferably a primer having the function of a primer hybridizing with the complementary DNA strand of the original primer and having a modified base sequence in which one or two bases are added, deleted or substituted in the base sequence of the original primer.

[0050] Therefore, the primer pairs included in the following group (b) can also be used as primer pairs for mecA gene detection.

[0051] Group (b):

[0052] (b1-1) A primer pair comprising a modified primer comprising the modified base sequence of SEQ ID NO: 3 and a primer comprising SEQ ID NO: 7.

[0053] (b1-2) A primer pair comprising a combination of a primer comprising sequence number 3 and a modified primer comprising the modified base sequence of sequence number 7.

[0054] (b1-3) A primer pair comprising a combination of a modified primer comprising the modified base sequence of SEQ ID NO: 3 and a modified primer comprising the modified base sequence of SEQ ID NO: 7.

[0055] (b2-1) A primer pair comprising a modified primer comprising the modified base sequence of SEQ ID NO: 2 and a primer comprising SEQ ID NO: 9.

[0056] (b2-2) A primer pair comprising a combination of a primer comprising SEQ ID NO: 2 and a modified primer comprising a modified base sequence of SEQ ID NO: 9.

[0057] (b2-3) A primer pair comprising a combination of a modified primer comprising the modified base sequence of SEQ ID NO: 2 and a modified primer comprising the modified base sequence of SEQ ID NO: 9.

[0058] (b3-1) A primer pair comprising a combination of a modified primer comprising the modified base sequence of SEQ ID NO: 1 and a primer comprising the base sequence of SEQ ID NO: 8.

[0059] (b3-2) A primer pair comprising a combination of a primer comprising SEQ ID NO: 1 and a modified primer comprising a modified base sequence of SEQ ID NO: 8.

[0060] (b3-3) A primer pair comprising a combination of a modified primer comprising the modified base sequence of SEQ ID NO: 1 and a modified primer comprising the modified base sequence of SEQ ID NO: 8.

[0061] (b4-1) A primer pair comprising a modified primer comprising the modified base sequence of SEQ ID NO: 1 and a primer comprising SEQ ID NO: 9.

[0062] (b4-2) A primer pair comprising a combination of a primer comprising SEQ ID NO: 1 and a modified primer comprising a modified base sequence of SEQ ID NO: 9.

[0063] (b4-3) A primer pair comprising a combination of a modified primer comprising the modified base sequence of SEQ ID NO:1 and a modified primer comprising the modified base sequence of SEQ ID NO:9.

[0064] (b5-1) A primer pair comprising a modified primer comprising the modified base sequence of SEQ ID NO: 4 and a primer comprising SEQ ID NO: 11.

[0065] (b5-2) A primer pair comprising a combination of a primer comprising SEQ ID NO: 4 and a modified primer comprising a modified base sequence of SEQ ID NO: 11.

[0066] (b5-3) A primer pair comprising a combination of a modified primer comprising the modified base sequence of SEQ ID NO: 4 and a modified primer comprising the modified base sequence of SEQ ID NO: 11.

[0067] (b6-1) A primer pair comprising a modified primer comprising the modified base sequence of SEQ ID NO: 5 and a primer comprising SEQ ID NO: 12.

[0068] (b6-2) A primer pair comprising a combination of a primer comprising sequence number 5 and a modified primer comprising a modified base sequence of sequence number 12.

[0069] (b6-3) A primer pair comprising a combination of a modified primer comprising the modified base sequence of SEQ ID NO: 5 and a modified primer comprising the modified base sequence of SEQ ID NO: 12.

[0070] (b7-1) A primer pair comprising a modified primer comprising the modified base sequence of SEQ ID NO: 6 and a primer comprising SEQ ID NO: 10.

[0071] (b7-2) A primer pair comprising a combination of a primer comprising sequence number 6 and a modified primer comprising a modified base sequence of sequence number 10.

[0072] (b7-3) A primer pair comprising a combination of a modified primer comprising the modified base sequence of SEQ ID NO: 6 and a modified primer comprising the modified base sequence of SEQ ID NO: 10.

[0073] (b8-1) A primer pair comprising a modified primer comprising the modified base sequence of SEQ ID NO: 6 and a primer comprising SEQ ID NO: 12.

[0074] (b8-2) A primer pair comprising a combination of a primer comprising sequence number 6 and a modified primer comprising a modified base sequence of sequence number 12.

[0075] (b8-3) A primer pair comprising a combination of a modified primer comprising the modified base sequence of sequence number 6 and a modified primer comprising the modified base sequence of sequence number 12.

[0076] In addition, a pair of complementary primers including complementary sequences of the primers constituting each of the above primer pairs can also be used as a primer pair for mecA gene detection. That is, the primer pair included in the following group (c) can also be used as a primer pair for mecA gene detection.

[0077] Group (c):

[0078] (c1-1) A primer pair comprising a combination of a primer comprising a complementary sequence to SEQ ID NO:3 and a primer comprising a complementary sequence to SEQ ID NO:7.

[0079] (c1-2) A primer pair comprising a combination of a modified primer containing a complementary sequence to the modified base sequence of SEQ ID NO: 3 and a primer containing a complementary sequence to SEQ ID NO: 7.

[0080] (c1-3) A primer pair comprising a combination of a primer comprising a complementary sequence of SEQ ID NO: 3 and a modified primer comprising a complementary sequence of the modified base sequence of SEQ ID NO: 7.

[0081] (c1-4) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 3 and a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 7.

[0082] (c2-1) A primer pair comprising a combination of a primer comprising a sequence complementary to SEQ ID NO: 2 and a primer comprising a sequence complementary to SEQ ID NO: 9.

[0083] (c2-2) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 2 and a primer comprising a complementary sequence to SEQ ID NO: 9.

[0084] (c2-3) A primer pair comprising a combination of a primer comprising a complementary sequence of SEQ ID NO: 2 and a modified primer comprising a complementary sequence of the modified base sequence of SEQ ID NO: 9.

[0085] (c2-4) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 2 and a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 9.

[0086] (c3-1) A primer pair comprising a combination of a primer comprising a sequence complementary to SEQ ID NO: 1 and a primer comprising a sequence complementary to SEQ ID NO: 8.

[0087] (c3-2) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 1 and a primer comprising a complementary sequence to the base sequence of SEQ ID NO: 8.

[0088] (c3-3) A primer pair comprising a combination of a primer comprising a complementary sequence of SEQ ID NO: 1 and a modified primer comprising a complementary sequence of the modified base sequence of SEQ ID NO: 8.

[0089] (c3-4) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 1 and a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 8.

[0090] (c4-1) A primer pair comprising a combination of a primer comprising a sequence complementary to SEQ ID NO: 1 and a primer comprising a sequence complementary to SEQ ID NO: 9.

[0091] (c4-2) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 1 and a primer comprising a complementary sequence to SEQ ID NO: 9.

[0092] (c4-3) A primer pair comprising a combination of a primer comprising a complementary sequence of SEQ ID NO: 1 and a modified primer comprising a complementary sequence of the modified base sequence of SEQ ID NO: 9.

[0093] (c4-4) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 1 and a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 9.

[0094] (c5-1) A primer pair comprising a combination of a primer comprising a sequence complementary to SEQ ID NO: 4 and a primer comprising a sequence complementary to SEQ ID NO: 11.

[0095] (c5-2) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 4 and a primer comprising a complementary sequence to SEQ ID NO: 11.

[0096] (c5-3) A primer pair comprising a combination of a primer comprising a complementary sequence of SEQ ID NO: 4 and a modified primer comprising a complementary sequence of the modified base sequence of SEQ ID NO: 11.

[0097] (c5-4) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 4 and a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 11.

[0098] (c6-1) A primer pair comprising a combination of a primer comprising a complementary sequence to SEQ ID NO: 5 and a primer comprising a complementary sequence to SEQ ID NO: 12.

[0099] (c6-2) A primer pair comprising a combination of a modified primer containing a complementary sequence to the modified base sequence of SEQ ID NO: 5 and a primer containing a complementary sequence to SEQ ID NO: 12.

[0100] (c6-3) A primer pair comprising a combination of a primer comprising a complementary sequence of SEQ ID NO: 5 and a modified primer comprising a complementary sequence of the modified base sequence of SEQ ID NO: 12.

[0101] (c6-4) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 5 and a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 12.

[0102] (c7-1) A primer pair comprising a combination of a primer comprising a complementary sequence to SEQ ID NO: 6 and a primer comprising a complementary sequence to SEQ ID NO: 10.

[0103] (c7-2) A primer pair comprising a combination of a modified primer containing a complementary sequence to the modified base sequence of SEQ ID NO: 6 and a primer containing a complementary sequence to SEQ ID NO: 10.

[0104] (c7-3) A primer pair comprising a combination of a primer comprising a complementary sequence of SEQ ID NO: 6 and a modified primer comprising a complementary sequence of the modified base sequence of SEQ ID NO: 10.

[0105] (c7-4) A primer pair comprising a combination of a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 6 and a modified primer comprising a complementary sequence to the modified base sequence of SEQ ID NO: 10.

[0106] (c8-1) A primer pair comprising a combination of a primer comprising a complementary sequence to SEQ ID NO: 6 and a primer comprising a complementary sequence to SEQ ID NO: 12.

[0107] (c8-2) A primer pair comprising a combination of a modified primer containing a complementary sequence to the modified base sequence of SEQ ID NO: 6 and a primer containing a complementary sequence to SEQ ID NO: 12.

[0108] (c8-3) A primer pair comprising a combination of a primer comprising a complementary sequence of SEQ ID NO: 6 and a modified primer comprising a complementary sequence of the modified base sequence of SEQ ID NO: 12.

[0109] (c8-4) A primer pair comprising a combination of a modified primer containing a complementary sequence to the modified base sequence of SEQ ID NO: 6 and a modified primer containing a complementary sequence to the modified base sequence of SEQ ID NO: 12.

[0110] Among these primer pairs, primer pair (a7), primer pairs (b7-1) to (b7-3), and primer pairs (c7-1) to (c7-4) are preferred.

[0111] It should be noted that the primer pairs included in the above-mentioned groups (a) to (c) have a common function in that they specifically hybridize with the structural gene of the mecA gene to amplify a specific DNA fragment of the mecA gene.

[0112] It should be noted that the primer pair of the present invention was first discovered based on the combination of a considerable number of various primers to confirm whether there is an effect, and it is not achieved at the level of merely confirming the effect. In addition, it should be noted that the results of the sequence search confirmed that it is a new combination for the primer pair for mecA gene detection.

[0113] The present invention does not prevent the use of a plurality of known primers for bacteria, fungi, or viruses in addition to the primer pair of the present invention.

[0114] The primer concentration in PCR is not particularly limited, and can generally be appropriately set within the range of 0.05 μM to 1.0 μM depending on the study.

[0115] <Enzymes used for PCR>

[0116] The enzyme for PCR used in the present invention is preferably a heat-resistant DNA polymerase derived from a heat-resistant organism, more preferably a heat-resistant DNA polymerase derived from a prokaryotic organism such as methanogens, thermoacidophiles, thermophiles, and hyperthermophiles.

[0117] Specific examples of the heat-resistant DNA polymerase used in the present invention include heat-resistant DNA polymerases derived from Thermus aquaticus, Thermus thermophilus, Bacillus stearothermophilus, Thermococcus gorgonarius, Thermococcus kodakaraensis KOD1, Pyrococcus woesei, Pyrococcus furiosus, Aeropyrum pernix, Aquifex aeolicus, Sulfolobus tokodaii, Pyrolobus fumarii, or Methanopyrus kandleri.

[0118] Alternatively, the thermostable DNA polymerase may be a thermostable DNA polymerase artificially synthesized in genetic engineering.

[0119] <Other Reagents>

[0120] In addition to the primer pair, the reagents used for PCR analysis in the present invention can use a known combination of known reagents. The reagents required for the assay include enzymes for PCR, pH buffer, dNTP, Mg 2+ Source, sterile water, etc. In addition, in real-time PCR analysis, in addition to the above reagents, labeling substances such as fluorescent dyes are also required.

[0121] The pH buffer is used to adjust the sample for PCR analysis to pH = 7.0 to 10.0 (more preferably pH 8.0 to 9.0). Specifically, Tris hydrochloric acid buffer etc. are mentioned. For example, in the case of Tris hydrochloric acid buffer, 5 mM to 100 mM is used.

[0122] dNTP is a nucleoside source for DNA amplification by PCR, and four types of dNTP are required: dATP, dCTP, dGTP, and dTTP. In addition, dNTPs that have been chemically modified for use in the hot start method can be used, such as CleanAmp manufactured by TriLink BioTechnologies, Inc. TM dNTP: dATP, dCTP, dGTP, and dTTP are used at a concentration of about 0.1 to 0.2 mM each.

[0123] In DNA amplification via PCR, Mg 2+ is required. As Mg 2+ The source includes MgCl2, MgSO4, etc. MgCl2 is preferred, and the amount used is appropriately used in the range of 0.5 mM to 5.0 mM depending on the study.

[0124] Fluorescent dyes are used for the purpose of detecting DNA amplification products via real-time PCR and measuring the Tm value of the amplified DNA fragments. For example, a method using an intercalator with a labeling function can be cited. As intercalators, ethidium bromide, SYBR GreenI and Resolight (made by Roche), EvaGreen (made by Biotium), BOXTO (made by Tata Biocenter) and the like can be cited. Preferred intercalators are EvaGreen and Resolight. The amount used is based on the recommendation of the manufacturer and seller of the fluorescent dye used.

[0125] In addition, the kit may contain bacterial genomic DNA for use as a positive control for PCR, or sterile water for use as a negative control.

[0126] As the PCR analysis and measurement container (e.g., analysis and measurement tube) used in the present invention, a container having a shape and structure corresponding to the measurement device can be selected and used. As long as the container is recommended by the supplier of the measurement device, there is no particular problem and it can be used for the measurement.

[0127] As other instruments required for implementing the present invention, there are pipettes, pipette tips, 1.5 ml microtubes and other instruments widely used in molecular biology experiments. As devices, there are PCR, clean benches, centrifuges for tubes and other equipment widely used in molecular biology experiments.

[0128] <Kit Format>

[0129] The mecA gene detection kit of the present invention is a kit for detecting the mecA gene by analyzing the DNA fragments amplified by the primer pair of the present invention. The analysis of the DNA fragments as the amplified product can be implemented by known methods. For example, the analysis of the DNA fragments as the amplified product can be implemented by molecular weight analysis of the DNA fragments, Tm value determination (melting curve analysis), etc. Two or more analytical methods can also be combined. Preferably, the determination of the Tm value is used, and real-time PCR is appropriately used for this purpose. The analysis of the molecular weight can be implemented using electrophoresis, a mass spectrometer, etc.

[0130] The mecA gene detection kit of the present invention comprises one or more primer pairs of the above-mentioned groups (a) to (c). In addition to the above-mentioned primers, it may also comprise an enzyme selected from PCR, a pH buffer, MgCl2, dNTP (or CleanAmp TM At least one reagent and / or component among reagents such as reagents such as dNTPs) and sterile water, containers for PCR analysis and measurement (such as analysis and measurement tubes) and other required appliances and other components. In addition, in the analysis using real-time PCR, fluorescent pigments can be added as components. In addition, according to various forms of PCR methods, components required for the PCR method used in addition to the above components can also be added to the kit. The above-mentioned reagents or components can be packaged in any form, such as individually packaged, or packaged in parts, or all packaged in one piece. Specifically, there are forms such as the following.

[0131] 1) Separate each reagent used.

[0132] 2) Divide into the following three categories, that is, package them separately: pH buffer, MgCl2, dNTP (or CleanAmp TM dNTPs), a premixed mixture of fluorescent dyes for real-time PCR analysis; a primer pair; and an enzyme for PCR.

[0133] 3) Divide into the following two categories, that is, package them separately: pH buffer, MgCl2, dNTP (or CleanAmp TM dNTP), a fluorescent dye in real-time PCR analysis, a premixed mixture of a primer pair; and an enzyme for PCR.

[0134] 4) Add pH buffer, MgCl2, dNTP (or CleanAmp TM dNTP), a fluorescent dye for real-time PCR analysis, a primer pair, and an enzyme for PCR are all pre-mixed and packaged.

[0135] It should be noted that when the kit has multiple primer pairs, the multiple primer pairs are separately packaged. In the case where the kit consists of multiple mixtures containing different primer pairs, each mixture is separately packaged.

[0136] <Field of Use · Specimen>

[0137] The mecA gene detection kit of the present invention can be used to detect the mecA gene in various fields such as the medical field, food field, environmental analysis, etc. In addition, it can be used in combination with the method for rapid identification of infectious disease pathogens in Patent Document 1 for simultaneous and rapid implementation of pathogen identification and mecA gene detection.

[0138] The specimen for examination is not particularly limited, and a wide range of specimens can be applied. Specifically, in the medical field, examples include blood, cerebrospinal fluid, tears, aqueous humor, amniotic fluid, synovial fluid, saliva, nasal swabs, urine, other body fluids, and attachments to medical devices such as catheters. In the food field, examples include the food itself, liquids during production, or solid feeds, and attachments to equipment within the manufacturing process.

[0139] <DNA Extraction Treatment>

[0140] When detecting the mecA gene in a specimen using the mecA gene detection kit of the present invention, it is necessary to pre-extract DNA from the bacteria presumably present in the specimen. As DNA extraction methods, currently, alkaline lysis method, boiling method, phenol extraction method, bead beating method, etc. are known. In addition, various DNA extraction kits are also sold by each manufacturer.

[0141] The DNA extraction method in the present invention is not particularly limited. Since the most suitable method varies depending on the specimen, it is desirable to select a method suitable for the target specimen.

[0142] <PCR Analysis>

[0143] The primer pairs of the present invention can be used in the PCR method. As the PCR method, any PCR method for amplifying the target gene for the purpose of detecting the mecA gene can be used, and various PCR methods can be utilized. As a preferred analysis method, there is real-time PCR, and more preferably a combination of real-time PCR and melting curve analysis for Tm value determination. In this case, the real-time PCR device used is not particularly limited. It should be noted that Rotor GeneQ produced by QIAGEN GmbH used in the examples of the present application is an example of a suitably used real-time PCR device.

[0144] In PCR and real-time PCR, generally known devices and methods can be used.

[0145] The conditions (temperature, time, heating and cooling speed, number of cycles) of the temperature cycle in PCR are not particularly limited and can be appropriately set according to the properties of the primers used, the enzymes used for PCR, the template, etc., and the sensitivity of the DNA detection method after PCR. There are many documents known about the setting of such conditions.

[0146] In PCR, generally speaking, the heat denaturation step of the template double-stranded DNA, the annealing step of the primers, and the DNA extension step using the enzyme used for PCR are repeated. The heat denaturation step is the temperature and time for the template double-stranded DNA to dissociate into single strands, for example, it is set at 90°C to 98°C for several seconds to several minutes. In addition, most of the time, at the beginning of PCR, a heat denaturation process of several minutes to 10 minutes is added only in the first cycle. The annealing step of the primers is set according to the base sequence and the number of bases of the primers, and is mostly set at 40°C to 72°C for several seconds to tens of seconds. In the DNA extension step, the temperature is generally 58°C to 76°C, for example, according to the properties such as the optimal temperature of the enzyme used for PCR. As for the time of the DNA extension step, it is set by estimating the required time based on the chain length of the DNA to be amplified and the DNA synthesis rate of the enzyme used for PCR. The target DNA is amplified by repeating the steps of heat denaturation, annealing, and extension. The number of repetitions can be appropriately changed according to the amount of template DNA, the amount of enzyme used for PCR, and the sensitivity of the DNA detection method after PCR. As a general example, 10 to 50 times can be given. In addition, when the annealing temperature and the temperature of DNA extension are approximately the same, these two steps can also be performed simultaneously.

[0147] In real-time PCR, the conditions for heat denaturation, annealing, and DNA extension required for DNA amplification, as well as the number of repetitions of these steps, are the same as those described above for PCR. In real-time PCR, the fluorescence intensity derived from the intercalator is measured before and after the DNA extension step, and the amount of amplified DNA can be quantified or estimated. As for the temperature for measuring the fluorescence intensity, when, for example, an intercalator is used for implementation, it can be maintained at the temperature during DNA extension. In addition, when the chain length of the amplified target DNA is long and its Tm value is high, the Tm value of the non-target DNA (also referred to as non-specific amplified DNA) with a short chain length such as primer dimers is low. By using this point, it can also be set to a temperature between the Tm value of the target DNA and the Tm value of the non-specific amplified DNA, with the intermediate value as the representative. In this way, especially in the implementation using an intercalator, only non-specific amplified DNA such as primer dimers dissociates from a double strand to a single strand, and the amount of DNA quantified or estimated by the fluorescence intensity can be made the amount for the target DNA.

[0148] In addition, in real-time PCR, after the DNA amplification process is completed, the Tm value of the amplified DNA can be determined by melting curve analysis. In the melting curve analysis, the dissociation of DNA from double-stranded to single-stranded corresponding to the temperature change is observed, and the temperature and detection conditions are not particularly limited. Generally speaking, after the stages of thermal denaturation (Denaturation) (90°C to 98°C), double-stranded formation (Annealing) (40°C to 80°C), and melting (Melting) (slowly increasing the temperature from the double-stranded formation temperature to about 98°C), the change in fluorescence intensity in the melting step is monitored to obtain a melting curve, and the Tm value can be obtained from it. Such a measurement can be implemented in various models of real-time PCR devices and can be implemented according to the method of use of the equipment.

[0149] <Detection method>

[0150] As a method for detecting the mecA gene in a sample according to the present invention, a method having the following steps can be used.

[0151] (1) A step of performing PCR using the bacterial genomic DNA prepared from the above-mentioned sample, a primer pair for obtaining an amplification product containing the mecA gene, and a PCR reagent represented by a thermostable DNA polymerase.

[0152] (2) A step of detecting the mecA gene in the amplification product of the PCR, or detecting the mecA gene in the sample by analyzing the amplification product.

[0153] It should be noted that when using a plurality of primer pairs, the PCR step (1) is performed separately for each of the plurality of primer pairs. That is, one primer pair is added to one reaction solution for PCR, and the PCR step (1) is performed using a plurality of reaction solutions to which different primer pairs are added separately.

[0154] By using at least one primer pair according to the present invention as a primer pair for obtaining an amplification product containing the mecA gene, highly sensitive detection of the methicillin resistance gene (mecA) can be performed.

[0155] In this detection method, it is preferred to implement the amplification process while suppressing the amplification of genes (non-target genes) other than the mecA gene as the target gene. Hot start PCR can be used to suppress the amplification of the non-target gene. As an example, a hot start method using anti-DNA polymerase antibodies can be cited. At this time, it is preferred to use an excess of anti-DNA polymerase antibodies for the heat-resistant DNA polymerase 1U. In addition, a hot start method in which a reversible chemical modification is applied to the DNA polymerase as disclosed in Patent Document 1 and International Publication No. 2010 / 082640 can also be appropriately used. In addition, a hot start method using chemically modified dNTPs or primers that have been chemically modified as described in U.S. Patent Application Publication No. 20070281308 (US2007 / 0281308A1) can also be appropriately used. In addition, using heated and melted wax, etc., it is also appropriate to use a method that physically isolates the DNA polymerase from the components necessary for DNA amplification using the DNA polymerase (for example, primers, dNTPs, Mg 2+ Salt) hot start method.

[0156] In the detection step of the amplification product, the target gene in the amplification product can be detected by measuring the Tm value using a real-time PCR intercalator having a fluorescent label for detection. Preferred intercalators are Gyber Green I, EvaGreen, Resolight, BOXTO, and more preferably EvaGreen and Resolight.

[0157] In the detection step of measuring the Tm value using real-time PCR, the amplification product of the target gene can be detected, and the amplification products of other non-target genes are not detected. As a method for this purpose, it is preferred to use

[0158] (1) selecting primers that make the melting temperature (TmA) of the target gene amplification product higher than the melting temperature (TmB) of the non-target gene amplification product;

[0159] (2) Detection of amplification products at a temperature between TmA and TmB,

[0160] A method for detecting only the amplification product of the target gene by setting conditions that allow detection of the amplification product of the target gene and do not detect amplification products of other non-target genes.

[0161] Furthermore, a method of performing the amplification process and the detection process by real-time PCR using a display device that displays the amount of the amplification product in which the amplification product other than the target gene is not displayed may be used.

[0162] The analysis of the amplification product in the detection process can be carried out by developing the amplification product on a gel or the like by electrophoresis and analyzing the visualized amplification product. In addition, the analysis of the amplification product can also be carried out by analyzing the amplification product by reading the base sequence of the amplification product. In addition, the analysis of the amplification product can also be carried out by an analytical method for measuring the molecular weight of the amplification product using a mass spectrometer.

[0163] Example

[0164] (Example 1) Primary Screening

[0165] The genomic DNA extracted from the culture medium of MRSA (strain transferred by RIKEN CORPORATION, JCM31453) was used as a template using the High pure PCR template preparation kit (Roche), and PCR was performed using the primers of sequence number 15 and sequence number 16, using the reaction solution composition shown in Table 1, to amplify the full length of mecA ORF. Then, a serial dilution of the amplified product of mecA was prepared, and a comparative primer pair consisting of a forward primer consisting of sequence number 13 and a reverse primer consisting of sequence number 14 was used to perform PCR using the reaction solution composition shown in Table 1. The concentration of the amplified product of mecA with an ascending cycle number of about 20 cycles was determined and used as a template. It should be noted that methicillin-resistant Staphylococcus aureus JCM31453 can be obtained through the Microbial Material Development Laboratory ( 3-1-1 Konodai, Tsukuba-shi, Ibaraki Prefecture, Microbial Materials Development Laboratory, RIKEN BRC-JCM)

[0166] Then, in order to evaluate the prepared primers, PCR was performed for 313 primer pairs using the reaction solution composition shown in Table 1. The real-time PCR apparatus used was Rotor-Gene Q MDx 5plex HRM (QIAGEN). The reaction conditions of PCR were: after heating at 95°C for 5 minutes, 94°C for 10 seconds, 65°C for 10 seconds, and 72°C for 30 seconds were repeated 40 times. For evaluation, 88 pairs of primer pairs that were confirmed to be improved compared with the results of the comparative primer pairs were screened for the number of rising cycles, the shape of the peak in high-resolution melting analysis (HRM), the intensity of the bands in the electrophoresis, and the presence or absence of nonspecific products in the electrophoresis.

[0167] (Example 2) Secondary Screening

[0168] A 50 μg / ml human genomic DNA solution (invirogen) was used as a template. The concentration of genomic DNA extracted from the culture medium of MRSA (strain transferred from RIKEN CORPORATION, JCM31453) was adjusted to a solution with a rising cycle number of about 20 cycles using a High pure PCR template preparation kit (Roche).

[0169] PCR was performed for 88 primer pairs using the reaction solution composition shown in Table 1 for evaluation. The real-time PCR apparatus used was Rotor-Gene Q MDx 5plex HRM (QIAGEN). The reaction conditions for PCR were: heating at 95°C for 5 minutes, and then repeating 94°C for 10 seconds, 65°C for 10 seconds, and 72°C for 30 seconds 40 times. For evaluation, 57 primer pairs that were confirmed to be improved compared to the results of the comparative primer pairs were screened based on the number of rising cycles, the shape of the peak in HRM, the intensity of the bands in electrophoresis, and the presence or absence of nonspecific products in electrophoresis.

[0170] (Example 3) Three-time screening

[0171] Using a 50μg / ml human genomic DNA solution (invirogen), the concentration of genomic DNA extracted from the culture solution of MRSA (transferred strain of RIKEN CORPORATION, JCM31453) was adjusted to a solution of 10.4 molecules / reaction solution using the High pure PCR template preparation kit (Roche) as a template. PCR was performed and evaluated for 57 primer pairs by triple determination using the reaction solution composition shown in Table 1. The real-time PCR device used was Rotor-Gene QMDx 5plex HRM (QIAGEN). The reaction conditions of PCR were: after heating at 95°C for 5 minutes, 94°C for 10 seconds, 65°C for 10 seconds, and 72°C for 30 seconds were repeated 40 times. For the evaluation, 9 pairs of primer pairs were screened for which amplification was observed in the triple determination, and the height of dF / dT in HRM (channel A), the presence or absence of primer dimers, and the presence or absence of non-specific product peaks were confirmed to be improved compared with the results of the comparative primer pairs.

[0172] (Example 4) Final Screening

[0173] Using 50μ g / ml human genomic DNA solution (invirogen), the genomic DNA extracted from the culture solution of MRSA (transferred strain of RIKEN CORPORATION, JCM31453) was adjusted to solutions of various concentrations (copy number / reaction solution: shown as copies / reaction in Table 2) using the High pure PCR template preparation kit (Roche) as a template. For 9 primer pairs, the reaction solution composition shown in Table 1 was used to implement PCR in triple determination, thereby evaluating. The real-time PCR device used Rotor-Gene Q MDx 5plex HRM (QIAGEN). The reaction conditions of PCR were: after heating at 95°C for 5 minutes, 94°C for 10 seconds, 65°C for 10 seconds, and 72°C for 30 seconds were repeated 40 times. The lowest concentration at which amplification can be observed in the triple determination is used as the detection limit. It should be noted that the determination of the Tm value confirms whether the target amplification product has been obtained.

[0174] As a result, 8 pairs were screened for which the detection limit was improved compared to the case where the comparative primer pair shown in the prior application Patent Document 1 was used for detection. The results are shown in Table 2. In addition, the sequence numbers 13 and 14 of the comparative primer pair and the base sequences of the 8 pairs screened are shown in Table 3.

[0175] (Example 5) Comparison between methicillin-resistant strains and methicillin-sensitive strains

[0176] The genomic DNA solution extracted from the culture medium of Staphylococcus aureus (methicillin-sensitive strain transferred from RIKEN CORPORATION, JCM2151) and MRSA (methicillin-resistant strain transferred from RIKEN CORPORATION, JCM16555) using the High pure PCR template preparation kit (Roche) was used as a template. PCR was performed in the reaction solution composition shown in Table 1 for the primer pairs of sequence numbers 6 and 10, and thus evaluated. The real-time PCR apparatus used was Rotor-Gene Q MDx 5plex HRM (QIAGEN). The reaction conditions of PCR were: after heating at 95°C for 5 minutes, 94°C for 10 seconds, 65°C for 10 seconds, and 72°C for 30 seconds were repeated 40 times. It should be noted that the determination of the Tm value and the presence or absence of a peak near 81°C confirmed whether the target amplification product was obtained. The results of the methicillin-resistant strain are shown in Figure 1 (a), the results of methicillin-susceptible strains are shown in Figure 1 (b).

[0177] [Table 1]

[0178] Table 1 Reaction solution composition

[0179]

[0180] (DW: deionized water)

[0181] [Table 2]

[0182] Table 2:

[0183]

[0184] [Table 3]

[0185] Table 3

[0186] Sequence (5′→3′) Sequence Number 1 CTGCTATCCACCCTCAAACAG Sequence number 2 ACTGCTATCCACCCTCMAC Sequence number 3 GAAGATGGCTATCGTGTCAC Sequence Number 4 ATCTTGGGGTGGTTACAACG Sequence number 5 TAGCACTCGAATTAGGCAGTAAG Sequence No. 6 AGCTGATTCAGGTTACGGAC Sequence Number 7 AATCTGGAACTTGTTGAGCAG Sequence Number 8 AACGTTGTAACCACCCCAAG Sequence Number 9 TGTAACGTTGTAACCACCCC Sequence number 10 GATTTTGGCATTGTAGCTAGCC Sequence Number 11 ACCACCCAATTTGTCTGCC Sequence Number 12 GTACCGGATTTGCCAATTAAG Sequence Number 13 CAAACTACGGTAACATTGATCGC Sequence Number 14 ATGTATGCTTTGGTCTTTCTGC Sequence number 15 ATGAAAAAGATAAAAATTGTTC Sequence Number 16 TTATTCATCTATATCGTAT

[0187] Industrial Applicability

[0188] From the test results described in Table 2, it can be seen that the detection method of the present invention using the primer pair of the present invention can detect extremely small amounts of mecA genes of less than 10 copies in one reaction. The detection method of the present invention can detect extremely rare mecA genes in extremely small amounts of specimens with high sensitivity, high accuracy, and rapidity, and therefore has sufficient practicality and wide applicability. The primer pair, detection method, and detection kit of the present invention can be used for the detection of trace amounts of mecA genes in various specimens generated in the medical field, the food field, and environmental analysis.

Claims

1. A primer pair for detecting the mecA gene, characterized in that: The primer pair is a primer pair consisting only of a combination of sequence number 1 and sequence number 8.

2. A mecA gene detection kit comprising a primer pair, characterized in that: The primer pair is a primer pair consisting only of a combination of sequence number 1 and sequence number 8. 3 . The kit according to claim 2 , comprising at least one of a reagent for PCR and an instrument for PCR.

4. The kit according to claim 3, wherein The reagent for PCR contains an enzyme for PCR.

5. Use of a primer pair consisting only of a combination of SEQ ID NO: 1 and SEQ ID NO: 8 in the manufacture of a kit for detecting a mecA gene in a specimen, the detection comprising: A PCR step is to perform PCR using DNA prepared from a sample and a primer pair for amplifying the DNA; and A step of detecting the mecA gene in the sample by detecting the mecA gene in the amplification product obtained by the PCR step or by analyzing the amplification product.

Images