Gene-guided method and kit for personalized medication of epirubicin

Abstract

The present invention provides a guidance method and a kit for epirubicin personalized medication genes. Specifically, the present invention takes into account the differences in the efficacy of medication for different cancer patients, screens out a combination of SNP sites of genes related to epirubicin personalized medication, and uses a nucleic acid mass spectrometer to perform extensive (high-throughput detection sites, high-throughput detection samples) screening and testing of epirubicin-related genetic markers. The method of the present invention has a high detection success rate, good technical reproducibility, and high cost-effectiveness, and can achieve the detection of multiple genes in a single small sample, meeting the maximum use of small samples; the method of the present invention has the technical advantages of high accuracy and high sensitivity, and the detection results are stable, which improves the detection positive rate.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular, relates to a gene guidance method and a kit for individualized medication of epirubicin. Background Art

[0002] Epirubicin (Famaxin) has been approved by CFDA for 14 indications, including the treatment of malignant lymphoma, breast cancer, lung cancer, soft tissue sarcoma, esophageal cancer, gastric cancer, liver cancer, pancreatic cancer, melanoma, colorectal cancer, ovarian cancer, multiple myeloma, leukemia and superficial bladder cancer (local bladder instillation). Large-scale clinical studies have been conducted in the above approved indications and provided data on effectiveness and safety. Due to the common side effects of anthracyclines, cardiac toxicity often limits their clinical application, but it can be managed. Before treatment, the benefits and potential risks of treatment should be fully evaluated, the patient's organ function and tumor conditions should be fully understood, and cardiac function should be closely monitored (LVFE reduction and dynamic monitoring of troponin), so that the effectiveness of epirubicin can be fully exerted. Therefore, it is of great significance to study the guidance method of epirubicin in clinical medication and confirm its safety.

[0003] Single nucleotide polymorphism (SNPs) is a genetic marker, which refers to the polymorphism of DNA sequence caused by the variation of single nucleotide at the genome level. The frequency of occurrence in the population is greater than 1%, including single base conversion, inversion, and single base insertion or deletion. It is a new genetic marker that can provide a reliable and effective scientific basis for the prediction, diagnosis, treatment of diseases and the development of new drugs.

[0004] SNP occurs in the coding region and can affect protein function, thereby affecting human health or drug metabolism, mainly manifested in individual differences in disease susceptibility, individual differences in the efficacy of the same drug, and individual differences in adverse reactions to the same drug. Pharmacogenetics or pharmacogenomic methods are very important for solving individual differences in drug efficacy, especially in the era of precision medicine.

[0005] Breast cancer is the most common female malignancy, and its incidence is increasing year by year, reaching an annual incidence of (30-40) / 100,000, among which the incidence of people aged >60 years is 70 / 100,000. Since the 1970s, the application of breast cancer chemotherapy has greatly improved the treatment effect of breast cancer, but chemotherapy is a double-edged sword, and the adverse reactions caused by chemotherapy are an important factor limiting the application of chemotherapy. Anthracyclines are the first-line drug of choice in breast cancer chemotherapy, and numerous clinical trials have confirmed their cornerstone status in breast cancer chemotherapy. However, the adverse reactions of anthracyclines, especially the cumulative cardiac toxicity with dose, limit the total amount of anthracyclines used. Because of its greater impact on the heart, doxorubicin has strict dose control. Later, epirubicin was launched on the market, and compared with the two, epirubicin greatly reduced the damage to the heart. Standard dose epirubicin increases the pathological complete remission rate of neoadjuvant chemotherapy for breast cancer.

[0006] Although drug therapy has significantly improved the overall survival of patients, tumor resistance is still a common cause of treatment failure. Existing studies have shown that the resistance mechanism of breast cancer cells is complex, mainly in the following aspects: overexpression of ABC transporters including P-gp, Mrp, BCRP and other transporters in tumor cells; a large number of metabolic enzymes in cells such as cytochrome P450 (CYP450) or glutathione-S-transferase (GST) family; changes in DNA transcription and translation in cells, i.e., gene expression.

[0007] Studies have shown that genetic variations in genes in the nucleotide excision repair (NER) pathway (XPG, XPC, WRN) may change genome integrity. Based on the efficacy of epirubicin chemotherapy in breast cancer and referring to the results of genetic testing, doctors can propose individualized medication plans suitable for each patient in terms of drug selection, dose control, and combination therapy when prescribing, ultimately improving drug efficacy and reducing drug toxicity, allowing patients to get out of the blind spot of medication, use accurate drugs, use good drugs, and grasp the best treatment period. At present, there is no very effective method for guiding the use of epirubicin in clinical practice, so it is urgent to establish a highly sensitive, economical, and simple molecular technology screening method to fill the domestic gap. Summary of the invention

[0008] The purpose of the present invention is to provide a gene guidance method and kit for individualized medication of epirubicin.

[0009] In a first aspect of the present invention, a guidance kit for the personalized medication gene of epirubicin is provided, the kit comprising a PCR amplification primer pair group, the PCR amplification primer pair group comprising a primer pair for specifically amplifying a SNP site selected from the following group: rs7668258, rs915927, rs2854501, rs1143684 and rs2279744.

[0010] In another preferred embodiment, the kit detects the SNP gene mutation site of the epirubicin personalized medication gene based on multiplex PCR time-of-flight mass spectrometry.

[0011] In another preferred embodiment, the kit further comprises a single base extension primer set.

[0012] In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs7668258 is shown as SEQ ID NO.1 to SEQ ID NO.2.

[0013] In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs915927 is shown as SEQ ID NO.3 to SEQ ID NO.4.

[0014] In another preferred example, in the PCR amplification primer pair set, the primer pairs for specifically amplifying rs2854501 are shown as SEQ ID NO.5 to SEQ ID NO.6.

[0015] In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs1143684 is shown as SEQ ID NO.7 to SEQ ID NO.8.

[0016] In another preferred example, in the PCR amplification primer pair group, the primer pair for specifically amplifying rs2279744 is shown as SEQ ID NO.9 to SEQ ID NO.10.

[0017] In another preferred example, in the single-base extension primer set, the extension primer for rs7668258 is shown as SEQ ID NO.11.

[0018] In another preferred example, in the single-base extension primer set, the extension primer for rs915927 is shown as SEQ ID NO.12.

[0019] In another preferred example, in the single-base extension primer set, the extension primer for rs2854501 is shown as SEQ ID NO.13.

[0020] In another preferred example, in the single-base extension primer set, the extension primer for rs1143684 is shown as SEQ ID NO.14.

[0021] In another preferred example, in the single-base extension primer set, the extension primer for rs2279744 is shown as SEQ ID NO.15.

[0022] In another preferred example, the kit includes a first container, and the first container contains the PCR amplification primer pair set.

[0023] In another preferred embodiment, the kit includes a second container, and the second container contains the single-base extension primer set.

[0024] In another preferred embodiment, the kit includes a third container, the third container contains a PCR premix solution, and the PCR premix solution mainly includes hot-start Taq enzyme, dNTPs, MgCl2, and PCR buffer.

[0025] In another preferred embodiment, the kit comprises a fourth container, wherein the fourth container contains shrimp alkaline phosphatase (SAP Enzyme).

[0026] In another preferred embodiment, the kit comprises a fifth container, wherein the fifth container contains a SAP buffer.

[0027] In another preferred embodiment, the kit comprises a sixth container, wherein the sixth container contains an elongation enzyme (iPLEX Enzyme).

[0028] In another preferred embodiment, the kit comprises a seventh container, and the seventh container contains ddNTPs.

[0029] In another preferred embodiment, the kit comprises an eighth container, wherein the eighth container contains an extension reaction buffer.

[0030] In another preferred embodiment, the kit further comprises pure water.

[0031] In a second aspect of the present invention, a method for detecting SNP gene mutation sites of epirubicin personalized medication genes based on multiplex PCR time-of-flight mass spectrometry is provided, comprising the following steps:

[0032] (1) using the peripheral blood genomic DNA of the sample to be tested as a template, performing PCR amplification to obtain an amplified product;

[0033] (2) treating the amplified product of step (1) with SAP using shrimp alkaline phosphatase;

[0034] (3) using an extension primer to perform a single base extension reaction on the product purified in step (2) to obtain an extension product;

[0035] (4) purifying the extension product with desalting resin;

[0036] (5) Mass spectrometry platform detection and analysis to determine whether there is a genetic mutation.

[0037] In another preferred embodiment, in the step (1), during the PCR amplification process, a SNP site selected from the following group is specifically amplified: rs7668258, rs915927, rs2854501, rs1143684, and rs2279744.

[0038] In another preferred embodiment, in the step (1), during the PCR amplification process, the amplification primer pair group is used to perform PCR amplification.

[0039] In another preferred embodiment, in the step (3), the single base extension primer set is used to perform a single base extension reaction.

[0040] The third aspect of the present invention provides the use of a PCR amplification primer pair group for preparing a detection kit for detecting the SNP gene mutation site of the epirubicin personalized medication gene;

[0041] The primer pair group includes primers with sequences shown as SEQ ID NO.1 to SEQ ID NO.10.

[0042] In a fourth aspect of the present invention, a use of a single base extension primer set is provided for preparing a detection kit for detecting a SNP gene mutation site of an epirubicin personalized medication gene;

[0043] The single-base extension primer set includes extension primers whose sequences are shown as SEQ ID NO.11 to SEQ ID NO.15.

[0044] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. DETAILED DESCRIPTION

[0045] The present invention provides a method and kit for guiding the gene of personalized medication of epirubicin. The present invention screens out 5 SNP sites of genes related to personalized medication of epirubicin by comparing the differences in the efficacy of medication of different cancer patients, and then can use a nucleic acid mass spectrometer to perform extensive (high-throughput detection sites, high-throughput detection samples) screening and testing of genetic markers related to epirubicin. Through multiple rounds of screening, a multiple PCR amplification primer pair that can perform efficient multiple amplification of the 5 SNP sites and is suitable for MassARRAY nucleic acid mass spectrometry detection is obtained, and a suitable extension primer is screened, thereby achieving high-accuracy and high-sensitivity detection of the 5 SNP sites, the test results are stable, and the detection positive rate is improved.

[0046] The determination method of the present application is based on multiplex PCR technology and MassARRAY nucleic acid mass spectrometry technology to detect the SNP gene mutation sites of the epirubicin personalized medication gene, and can detect 5 sites simultaneously.

[0047] Multiplex PCR, also known as multiple primer PCR or composite PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to amplify multiple nucleic acid fragments at the same time. Its reaction principle, reaction reagents and operation process are the same as general PCR.

[0048] There are many factors that affect multiplex PCR reactions, such as:

[0049] (1) The reaction system is unbalanced. The imbalance of the reaction system leads to the rapid amplification of certain advantageous primers and their templates in the first few rounds of reactions, resulting in a large amount of amplified products. These amplified products are also good inhibitors of DNA polymerase. Therefore, as a large number of amplified products appear, the polymerization ability of the polymerase is increasingly suppressed. Therefore, the primers and their templates that are at a disadvantage in the early stage are more difficult to react, which ultimately leads to a very small amount of amplified products that cannot be detected.

[0050] (2) Primer specificity: If the primer binds more strongly to other non-target gene fragments in the system, the target gene's ability to bind to the primer will be competed for, resulting in a decrease in amplification efficiency.

[0051] (3) The optimal annealing temperature is inconsistent. When multiple pairs of primers are placed in a system for amplification, since the annealing temperature of the PCR reaction is the same, the optimal annealing temperature of each pair of primers is required to be close.

[0052] (4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, as well as third-party DNA-mediated dimers. These dimers, like non-specific primers, will interfere with the competition between primers and target binding sites, affecting amplification efficiency.

[0053] Although several factors that affect amplification efficiency are mentioned above, more factors are still unclear. So far, there is no effective method to clearly predict amplification efficiency.

[0054] Although multiplex PCR-time-of-flight mass spectrometry detection technology can perform ultra-high throughput detection, it has high requirements for the quality of PCR amplification products. The inventors found in their research that the existing amplification primers and extension primers that can perform multiplex fluorescence PCR detection are directly applied to multiplex PCR-time-of-flight mass spectrometry detection, and there are many defects, such as the inability to perform single-base extension reactions, resulting in false negatives in mass spectrometry detection, low sensitivity and poor repeatability, which are difficult to meet clinical applications. Therefore, the inventors redesigned multiple pairs of amplification primers and extension primers for each detection site, and carried out multiple combination detection verification when single-site detection can meet the requirements. After a large number of experimental screenings, a multiplex PCR detection system and extension primers suitable for time-of-flight mass spectrometry detection with high sensitivity, good specificity, and stable detection results were finally obtained.

[0055] The present invention adopts multiplex PCR method to amplify the target sequence, artificially designs multiple pairs of primers, optimizes, selects and verifies them, and finally determines a nucleic acid detection kit for detecting a total of 5 sites of epirubicin personalized medication gene SNP mutation sites comprising the following amplification primers.

[0056] Table 1 Amplification primers

[0057]

[0058]

[0059] Among them, F is the upstream primer and R is the downstream primer.

[0060] The extension primers are shown in Table 2:

[0061] Table 2 Extension primers

[0062]

[0063] The primer sequences listed in Table 1 and Table 2 can all be synthesized using conventional polynucleotide synthesis methods.

[0064] In addition to the amplification primers and extension primers mentioned above, the present invention also provides a kit for detecting the SNP gene mutation site of the epirubicin personalized medication gene. The specific content of each component in the detection kit is as follows:

[0065] Table 3 Kit components

[0066]

[0067] The present invention also provides a method for detecting SNP gene mutation sites of epirubicin personalized medication genes based on multiplex PCR time-of-flight mass spectrometry, comprising the following steps:

[0068] (1) using the peripheral blood genomic DNA of the sample to be tested as a template, performing PCR amplification to obtain an amplified product;

[0069] (2) treating the amplified product of step (1) with SAP using shrimp alkaline phosphatase;

[0070] (3) using an extension primer to perform a single base extension reaction on the product purified in step (2) to obtain an extension product;

[0071] (4) purifying the extension product with desalting resin;

[0072] (5) Mass spectrometry platform detection and analysis to determine whether there is a genetic mutation.

[0073] Furthermore, in the step (1), during the PCR amplification process, SNP sites selected from the following group are specifically amplified: rs7668258, rs915927, rs2854501, rs1143684, and rs2279744.

[0074] Furthermore, in the step (1), during the PCR amplification process, the amplification primer pair group is used to perform PCR amplification.

[0075] Furthermore, in step (3), a single base extension reaction is performed using an extension primer set.

[0076] Furthermore, the amplification conditions of step (1) are: 95°C, 3 min; 95°C, 15 s, 60°C, 15 s, 72°C, 1 min, 45 cycles; 72°C for 5 min.

[0077] Furthermore, the SAP treatment conditions in step (2) are: 57° C. for 40 min, 65° C. for 5 min.

[0078] Furthermore, the conditions of the extension reaction in step (3) are: 95°C, 30s; 95°C, 5s, (49°C, 5s, 72°C, 5s, 5 cycles), 35 cycles; 72°C for 5min.

[0079] The main advantages of the present invention are:

[0080] The nucleic acid mass spectrometry-guided method for personalized medication genes for epirubicin provided by the present invention takes into account the differences in the efficacy of medication for different cancer patients, detects more advanced personalized medication genes, and incorporates multiple SNP sites related to personalized medication for epirubicin. These sites have a high detection success rate, good technical reproducibility, and high cost-effectiveness.

[0081] The detection technology provided by the present invention has obvious price advantages, changing the disadvantages of traditional single-base detection, such as high price, long time consumption, and cumbersome operation. It has higher sensitivity and higher throughput in the gene-guided detection of personalized medication for epirubicin, and can realize the detection of multiple genes in a single small sample, meeting the maximum use of small samples.

[0082] The nucleic acid mass spectrometry method for detecting a group of epirubicin personalized medication genes based on MassARRAY nucleic acid mass spectrometry technology provided by the present invention has the technical advantages of high accuracy and high sensitivity, stable detection results, obvious advantages over Sanger sequencing, and improved detection positivity rate.

[0083] The present invention will be further described in detail below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where detailed conditions are not specified are usually carried out according to conventional conditions such as the conditions described in "Molecular Cloning Laboratory Guide" by Sambrook.J et al. (Huang Peitang et al., Beijing: Science Press, 2002), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial channels unless otherwise specified.

[0084] Example 1

[0085] Feasibility analysis of SNP site screening for genes related to personalized medication of human epirubicin

[0086] By searching for sites related to the safety and efficacy of epirubicin that have been verified in large-scale clinical studies of pathological control groups by genome-wide association studies (GWAS) at home and abroad by NCBI, the inventors screened and evaluated them, and selected 5 single nucleotide polymorphism sites that are significantly related to the personalized medication of epirubicin, and are independent of each other and do not have linkage disequilibrium. Therefore, the site selection of the present invention is representative, independent, and has accumulative risk values, and can be used to guide the personalized medication of epirubicin.

[0087] The screened SNP sites are as follows:

[0088] rs7668258, rs915927, rs2854501, rs1143684, rs2279744.

[0089] Example 2 System Verification

[0090] System validation includes accuracy, specificity, sensitivity, precision and inter-personnel comparison.

[0091] Accuracy verification plan: 20 cases were tested at each site and compared with Sanger sequencing, with an expected target of 95%.

[0092] Specificity validation protocol: included in accuracy, expected target 95%.

[0093] Sensitivity verification plan: Using human genomic DNA positive samples as templates, the DNA content of the calibrated samples was 1ng / μL, 5ng / μL, 10ng / μL, 50ng / μL, and 100ng / μL for sensitivity testing.

[0094] The precision verification plan (including intra-batch, inter-batch and personnel comparison, not involving inter-instrument comparison) has an expected target of 95%.

[0095] Intra-batch precision: Each sample was repeated 3 times in the same batch to compare the intra-batch precision.

[0096] Inter-batch precision: The same operator tests the same sample in multiple batches and compares the inter-batch precision.

[0097] Inter-personnel comparison: Two operators test the same sample and compare the differences in results between them.

[0098] The specific test steps are as follows:

[0099] 1. DNA extraction: According to the operating steps provided in the instructions of the blood DNA extraction kit independently developed by Nanxin Medical (a commercially available kit for rapid and efficient extraction of genomic DNA), human peripheral blood genomic DNA was prepared and eluted with 50 μL ddH2O;

[0100] 2. PCR process

[0101] (1) The sample was diluted to 20 ng / μL;

[0102] (2) Prepare the PCR reaction system according to the table below (the following is a single sample amount, and the sample DNA requires a total of 40ng)

[0103] Table 4. PCR reaction system

[0104] Reagents W1(μL) W2(μL) <![CDATA[Water, ddH2O]]> 0.8 0.8 10PCR Buffer with 20mM 0.5 0.5 <![CDATA[25mM MgCl2]]> 0.4 0.4 25mM dNTP mix 0.1 0.1 25 μM amplification primer mix 1 1 5U / μL PCR Taq enzyme 0.2 0.2 20ng / μL DNA 2 2 Total volume 5.00 5.00

[0105] (3) Seal the membrane, vortex mix for 30 seconds, and centrifuge at 500 g for 1 minute;

[0106] (4) Place the plate on a PCR machine and perform the following thermal cycles:

[0107] 95℃ 3 minutes

[0108] 45 cycles:

[0109] (95℃15sec

[0110] 60℃15sec

[0111] 72℃ for 1 minute)

[0112] 72℃ for 5 minutes

[0113] 4℃ insulation

[0114] 2. SAP Process

[0115] (1) Take out the PCR plate and centrifuge at 500 g for 3 minutes;

[0116] (2) Prepare the SAP reaction system according to the table below (the following is the amount of a single sample);

[0117] Table 5 SAP reaction system

[0118] Reagents Sample per well (μL) ×2 <![CDATA[ddH2O]]> 1.53 3.06 SAP Buffer 0.17 0.34 SAP enzyme (1.7U / μL) 0.3 0.6 Total volume 2.00 4.00

[0119] (3) Add 2 μL of SAP mixture to each well;

[0120] (4) Seal the membrane, vortex mix for 30 seconds, and centrifuge at 500 g for 1 minute;

[0121] (5) Place the plate on a PCR machine and perform the following thermal cycles:

[0122] 57℃ 40min

[0123] 65℃5min

[0124] 4℃ insulation

[0125] 3. EXT (single base extension) process

[0126] (1) Take out the PCR plate and centrifuge at 500 g for 3 minutes;

[0127] (2) Prepare the EXT reaction system according to the table below (the following is the amount for a single sample);

[0128] Table 6 EXT reaction system

[0129] Reagents W1(μL) W2(μL) <![CDATA[ddH2O]]> 0.62 0.62 iPLEX Buffer 0.2 0.2 ddNTP Mixture 0.2 0.2 Extension Primer Mix 0.94 0.94 iPLEX Enzymes 0.04 0.04 Total volume 2.00 2.00

[0130] (3) Add 2 μL of iPLEX extension mixture;

[0131] (4) Seal the membrane, vortex mix for 30 seconds, and centrifuge at 500 g for 1 minute;

[0132] (5) Place the plate on a PCR machine and perform the following thermal cycles:

[0133] 95℃30s

[0134] 35 cycles:

[0135] (95℃, 5s

[0136] 5 cycles:

[0137] (49℃5s

[0138] 72℃5s))

[0139] 72℃5min

[0140] 4℃ insulation

[0141] 4. Resin desalination

[0142] Take out the PCR plate and centrifuge at 500g for 3 minutes; spread the clean resin on the wells of the dimple plate and air-dry for at least 10 minutes; add 10uL of water to each well of the sample plate with samples; seal the plate, vortex for 10 seconds, and centrifuge at 500g for 1 minute; gently invert the sample plate in mid-air and place it on the dimple plate with resin, then invert the dimple plate and the sample plate together (the two plates cannot move horizontally during the process) to allow the resin to fall into the wells; remove the dimple plate, seal the sample plate, and shake upside down on a rotator for 3 minutes; centrifuge at 2000g for 5 minutes.

[0143] 5. Dispensing

[0144] A MALDI-TOF (matrix-assisted laser desorption ionization-time of flight) mass spectrometer was used to obtain a cluster diagram of each data point (all clusters were clear).

[0145] Test results: Taking one of the samples as an example, the accuracy verification results are shown in Table 7.

[0146] Table 7 Accuracy verification (comparison of first-generation sequencing and MassARRAY results)

[0147] SNP_ID First-generation sequencing results MassARRAY Results rs7668258 TT TT rs915927 TT TT rs2854501 AG AG rs1143684 CC CC rs2279744 TT TT

[0148] Taking the rs915927 site of this sample as an example, the precision verification results are shown in Table 5.

[0149] Table 8 rs915927 site precision verification results

[0150] Repeat 1 Repeat 2 Repeat 3 Batch 1 TT TT TT Batch 2 TT TT TT Batch 3 TT TT TT Batch 4 TT TT TT Batch 5 TT TT TT

[0151] Overall, all sites in this application are clearly clustered, with basically no gray area, and the possibility of false detection is small. The accuracy (including sensitivity and specificity) and precision verification of each site detection in this application are shown in Table 9.

[0152] Table 9 Accuracy, sensitivity and specificity verification results

[0153] SNP_ID accuracy Sensitivity Specificity Intra-batch precision Batch-to-batch precision Personnel comparison rs7668258 100％ 1ng / μL 100％ 100％ 100％ 100％ rs915927 100％ 1ng / μL 100％ 100％ 100％ 100％ rs2854501 100％ 1ng / μL 100％ 100％ 100％ 100％ rs1143684 100％ 1ng / μL 100％ 100％ 100％ 100％ rs2279744 100％ 1ng / μL 100％ 100％ 100％ 100％

[0154] In the above table, accuracy of 100% indicates that all positive samples were correctly detected and consistent with the Sanger sequencing results; specificity of 100% indicates that no false positive results occurred in the samples tested; intra-batch precision of 100% indicates that the results of repeated tests of the same batch of samples are consistent; inter-batch precision of 100% indicates that the test results of multiple batches of the same sample tested by the same operator are consistent; and personnel comparison of 100% indicates that the test results of the same sample tested by two operators are consistent.

[0155] In summary, the nucleic acid mass spectrometry-guided method for personalized medication of epirubicin provided by the present invention takes into account the differences in the efficacy of medication for different cancer patients, detects more advanced personalized medication genes, and incorporates multiple SNP sites related to personalized medication of epirubicin. These sites have a high detection success rate, good technical reproducibility, and high cost-effectiveness.

[0156] Comparative Example 1 Screening of PCR amplification primer pairs and extension primers

[0157] For each site, the inventors designed several to more than ten pairs of amplification primers and extension primers, verified and optimized them, and finally established a multiplex PCR amplification primer and extension primer combination that can be used for MassARRAY nucleic acid mass spectrometry detection.

[0158] This comparative example takes the rs2854501 site as an example, and cites some amplification primers and extension primers with unsatisfactory effects.

[0159] Control primer pair 1:

[0160] F-1: ACGTTGGATGGCAAGGACCCTGACTG (SEQ ID NO.:16)

[0161] R-1: ACGTTGGATGGCCAAGGTGGGAGAAT (SEQ ID NO.:17)

[0162] Control primer pair 2:

[0163] F-2: ACGTTGGATGAAGGACCCTGACTGACC (SEQ ID NO.:18)

[0164] R-2: ACGTTGGATGTGAGCTATGATCGCACC (SEQ ID NO.:19)

[0165] Control primer pair 3:

[0166] F-3: ACGTTGGATGGGGCAAGGACCCTGACT (SEQ ID NO.:20)

[0167] R-3: ACGTTGGATGGCCAAGGTGGGAGAAT (SEQ ID NO.:17)

[0168] Control extension primer 1:

[0169] Y-1:CTCATGTTGGTAGTTTGTC(SEQ ID NO.:21)

[0170] Control extension primer 2:

[0171] Y-2: CACTCATGTTGGTAGTTTGTC (SEQ ID NO.:22)

[0172] Primer pair of the present invention: SEQ ID NO. 5 and 6

[0173] Extension primer of the present invention: SEQ ID NO.13

[0174] The specific method is the same as the above embodiment. In the single-plex screening experiment, different extension primers are used to perform single-base extension after single-plex PCR amplification, and then the extension product is detected by mass spectrometry. The single-plex detection results show that the control primer pairs 1 and 3 can work normally in the single-plex system, but cannot obtain positive results in the multiplex system.

[0175] In the multiplex system, the combination of control primer pair 2 and control extension primers 1 and 2 has a detection sensitivity of 50 ng / μL and 50 ng / μL, respectively; the combination of control primer pair 2 and the extension primer shown in SEQ ID NO.13 has a detection sensitivity of 10 ng / μL; the combination of primer pairs shown in SEQ ID NO.5 and 6 and control extension primers 1 and 2 has a detection sensitivity of 10 ng / μL and 10 ng / μL, respectively. The combination of primer pairs shown in SEQ ID NO.5 and 6 and the extension primer shown in SEQ ID NO.13 has a detection sensitivity of up to 1 ng / μL.

[0176] The results show that the control primer pairs 1 and 3 cannot effectively amplify the target nucleic acid sequence in the multiple detection system, and therefore cannot work normally in the multiple detection system; the control primer pair 2 can work normally in the multiple detection system, but the sensitivity is poor; although the control extension primers 1 and 2 can also work during the extension process, the sensitivity is also poor. The combination of the primer pair of the present invention (SEQ ID NO.5 and 6) and the extension primer of the present invention (SEQ ID NO.13) can work normally in the multiple detection system, and the sensitivity is high, reaching 1ng / μL.

[0177] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Guangdong Nanxin Medical Technology Co., Ltd. <120> Gene-guided method and kit for personalized medication of epirubicin <130> 200513 <160> twenty two <170> PatentIn version 3.5 <210> 1 <211> 30 <212> DNA <213> Artificial sequence <400> 1 acgttggatg ctcataaaca taaaagggaa 30 <210> 2 <211> 30 <212> DNA <213> Artificial sequence <400> 2 acgttggatg agaaccgatt aaatagaaac 30 <210> 3 <211> 29 <212> DNA <213> Artificial sequence <400> 3 acgttggatg cccaccaaag tctgatgat 29 <210> 4 <211> 31 <212> DNA <213> Artificial sequence <400> 4 acgttggatg agtgaggata gataccctgt g 31 <210> 5 <211> 25 <212> DNA <213> Artificial sequence <400> 5 acgttggatg cctgcggttg cttct 25 <210> 6 <211> 26 <212> DNA <213> Artificial sequence <400> 6 acgttggatg taagagggtg gaaccg 26 <210> 7 <211> 25 <212> DNA <213> Artificial sequence <400> 7 acgttggatg ccaggaaccc aagtc 25 <210> 8 <211> 28 <212> DNA <213> Artificial sequence <400> 8 acgttggatg atcgtgaccc taatagtg 28 <210> 9 <211> 31 <212> DNA <213> Artificial sequence <400> 9 acgttggatg agttcagggt aaaggtcacg g 31 <210> 10 <211> 29 <212> DNA <213> Artificial sequence <400> 10 acgttggatg cacccgtcca actgagtcg 29 <210> 11 <211> twenty one <212> DNA <213> Artificial sequence <400> 11 tcatttacct tcatttgtct c 21 <210> 12 <211> 17 <212> DNA <213> Artificial sequence <400> 12 gcatagctag gtcctgc 17 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <400> 13 actcatgttg gtagtttgtc 20 <210> 14 <211> 19 <212> DNA <213> Artificial sequence <400> 14 tgatttgtat gccatgaac 19 <210> 15 <211> 15 <212> DNA <213> Artificial sequence <400> 15 ggacctcccg cgccg 15 <210> 16 <211> 26 <212> DNA <213> Artificial sequence <400> 16 acgttggatg gcaaggaccc tgactg 26 <210> 17 <211> 26 <212> DNA <213> Artificial sequence <400> 17 acgttggatg gccaaggtgg gagaat 26 <210> 18 <211> 27 <212> DNA <213> Artificial sequence <400> 18 acgttggatg aaggaccctg actgacc 27 <210> 19 <211> 27 <212> DNA <213> Artificial sequence <400> 19 acgttggatg tgagctatga tcgcacc 27 <210> 20 <211> 27 <212> DNA <213> Artificial sequence <400> 20 acgttggatg gggcaaggac cctgact 27 <210> twenty one <211> 19 <212> DNA <213> Artificial sequence <400> twenty one ctcatgttgg tagtttgtc 19 <210> twenty two <211> twenty one <212> DNA <213> Artificial sequence <400> 22 cactcatgtt ggtagtttgt c 21

Claims

1. A gene guidance kit for personalized medication of epirubicin, characterized in that: The kit includes a PCR amplification primer pair group, and the PCR amplification primer pair group includes primer pairs for specifically amplifying the following SNP sites: rs7668258, rs915927, rs2854501, rs1143684 and rs2279744; In the PCR amplification primer pair group: The primer pairs for specific amplification of rs7668258 are shown in SEQ ID NO. 1 to SEQ ID NO. 2; The primer pairs for specific amplification of rs915927 are shown in SEQ ID NO.3 to SEQ ID NO.4; The primer pairs for specific amplification of rs2854501 are shown in SEQ ID NO. 5 to SEQ ID NO. 6; The primer pairs for specific amplification of rs1143684 are shown in SEQ ID NO. 7 to SEQ ID NO. 8; The primer pairs for specific amplification of rs2279744 are shown in SEQ ID NO.9 to SEQ ID NO.10; The kit further comprises a single base extension primer set, wherein: The extension primer for rs7668258 is shown in SEQ ID NO.11; The extension primer for rs915927 is shown in SEQ ID NO.12; The extension primer for rs2854501 is shown in SEQ ID NO.13; The extension primer for rs1143684 is shown in SEQ ID NO.14; The extension primer for rs2279744 is shown in SEQ ID NO.

15.

2. The kit according to claim 1, characterized in that The kit comprises a first container, wherein the first container contains the PCR amplification primer pair set.

3. The kit according to claim 2, characterized in that The kit further comprises a second container, wherein the second container contains the single-base extension primer set.

4. The kit according to claim 3, characterized in that The kit also includes a third container, which contains a PCR premix solution, and the PCR premix solution includes a hot start Taq enzyme, dNTPs, MgCl2 and a PCR buffer.

5. The kit according to claim 4, characterized in that The kit further comprises a fourth container, wherein the fourth container contains shrimp alkaline phosphatase (SAP Enzyme).

6. The kit according to claim 5, characterized in that The kit further comprises a fifth container, wherein the fifth container contains a SAP buffer.

7. The kit according to claim 6, characterized in that The kit further comprises a sixth container, wherein the sixth container contains an elongation enzyme iPLEX Enzyme.

8. The kit according to claim 7, characterized in that The kit further comprises a seventh container, wherein the seventh container contains ddNTPs.

9. The kit according to claim 8, characterized in that The kit further comprises an eighth container, wherein the eighth container contains an extension reaction buffer.

10. Use of a PCR amplification primer pair set and a single base extension primer set, characterized in that: Used to prepare a detection kit, wherein the detection kit is used to detect the SNP gene mutation site of the epirubicin personalized medication gene; The primer pair group includes primers whose sequences are shown in SEQ ID NO.1 to SEQ ID NO.10; The single-base extension primer set includes extension primers whose sequences are shown as SEQ ID NO.11 to SEQ ID NO.15.

Images