miRNA markers and related products for melanoma diagnosis and treatment

Abstract

The present invention discloses miRNA markers for diagnosis and treatment of melanoma and related products thereof. The miRNA marker is a combination of miR-450a and miR-675. The products for diagnosis of melanoma include chips, kits, and preparations. The chips, kits, and preparations contain probes that specifically recognize miR-450a and miR-675 or primers, probes, or chips that specifically bind to miR-450a and miR-675. Experimental verification of the present invention shows that the miRNA marker has good diagnostic efficacy, and the combination of miR-450a and miR-675 has a synergistic effect, and can be used in the diagnosis and treatment of melanoma.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology. Specifically, the present invention relates to miRNA markers and related products for diagnosis and treatment of melanoma. More specifically, the miRNA markers of the present invention include miR-450a and miR-675. Background Art

[0002] Melanoma, also known as malignant melanoma, is a malignant tumor formed by mutation of melanocytes. Melanoma mostly occurs in the skin and is the most invasive highly malignant skin tumor, with the mortality rate ranking first among skin malignant tumors. The incidence of malignant melanoma is relatively high in the Caucasian population, at 21.6 / 100,000; the incidence in the African population is 1.0 / 100,000; the incidence in the Chinese population is slightly lower than that in the African population. However, the incidence in my country has doubled in recent years, with about 20,000 new cases each year. 50%-80% of patients with advanced malignant melanoma develop liver metastasis, and 8%-46% of patients develop brain metastasis.

[0003] Melanoma is highly malignant and metastasizes early and widely, so it is quite difficult to treat clinically. Its traditional treatment methods include early surgical resection, radiotherapy and chemotherapy. 90%-95% of patients with malignant melanoma choose surgical resection for early treatment. Due to its easy metastasis, the current treatment is mainly chemotherapy. The commonly used chemotherapy regimens are CVD (cisplatin + vincristine + dacarbazine) and CDBT (cisplatin + dacarbazine + carmustine + tamoxifen); radiotherapy is only used for palliative treatment of patients whose surgical resection is incomplete or who cannot undergo surgery. However, the above therapies are not effective and have many adverse reactions.

[0004] In recent years, with the deepening of the exploration of the molecular mechanism of melanoma occurrence, more and more studies have shown that miRNA is closely related to the occurrence of melanoma. miRNA is a 21-22 nt non-coding RNA molecule that exists naturally in the body. It is a type of RNA that regulates the expression of target genes through post-transcriptional gene silencing. It is estimated that about 1 / 3 of the genes in the body are regulated by miRNA. The complex of miRNA and RISC can bind to the complementary sequence in the 5'-UTR or 3'-UTR of the target gene mRNA through base pairing, inhibit protein translation, or induce mRNA degradation, thereby negatively regulating the expression of the target gene.

[0005] miRNA is an endogenous non-coding small molecule RNA that regulates gene expression. It regulates gene expression at the post-transcriptional level and participates in physiological processes such as cell cycle, apoptosis, development, differentiation and metabolism. The dysregulated expression of miRNA in cells can lead to the occurrence of various cancers including melanoma. The latest studies have shown that some miRNAs are abnormally expressed in samples of melanoma patients, but there is still no consensus on which miRNAs are related to the occurrence and development of melanoma and can be used as drug targets for the treatment of melanoma. Therefore, it is necessary to screen and verify miRNAs related to the occurrence and development of melanoma, so as to provide an effective means for early auxiliary diagnosis and auxiliary treatment of melanoma in clinical practice. Summary of the invention

[0006] The object of the present invention is to provide miRNA markers for diagnosis and treatment of melanoma and related products thereof. The miRNA markers include miR-450a and miR-675. The present invention applies the miRNA markers to the diagnosis and treatment of melanoma. It has been verified that the miRNA markers miR-450a and miR-675 are closely related to the occurrence and development of melanoma. The combination of the miRNA markers miR-450a and miR-675 for diagnosis of melanoma has good diagnostic efficacy. The miRNA markers miR-450a and miR-675 are closely related to the apoptosis of melanoma cells, and the combination of miR-450a and miR-675 has a synergistic therapeutic effect.

[0007] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0008] In a first aspect, the present invention provides the use of a reagent for detecting the expression level of miRNA markers miR-450a and miR-675 in the preparation of a product for diagnosing melanoma.

[0009] Furthermore, the reagents include reagents for detecting the expression levels of miRNA biomarkers miR-450a and miR-675 using sequencing technology, nucleic acid hybridization technology, and nucleic acid amplification technology.

[0010] Further, the reagent is selected from:

[0011] Probes that specifically recognize the miRNA markers miR-450a and miR-675; or

[0012] Primers that specifically amplify the miRNA markers miR-450a and miR-675.

[0013] Furthermore, the sequences of the primers for specifically amplifying the miRNA markers miR-450a and miR-675 are shown in SEQ ID NO:4-SEQ ID NO:5 and SEQ ID NO:6-SEQ ID NO:7, respectively.

[0014] The sequencing technology described in the present invention refers to high-throughput sequencing technology, which is also called next-generation sequencing technology. It is a revolutionary change to traditional sequencing technology. High-throughput sequencing technology can sequence hundreds of thousands to millions of DNA molecules at a time, greatly improving sequencing efficiency. This type of large-scale sequencing technology greatly improves the speed of interpreting genetic information of multiple species, and provides a guarantee for obtaining sequence information of all miRNAs and decrypting miRNA maps. At the same time, high-throughput sequencing makes it possible to conduct a detailed and comprehensive analysis of the transcriptome and genome of a species, so it is also called deep sequencing. Representatives of high-throughput sequencing platforms are Roche's 454 sequencer (RochGSFLX sequencer), Illumina's Solexa genome analyzer (Illumina Genome Analyzer) and ABI's SOLiD sequencer (ABI SOLiD sequencer).

[0015] The nucleic acid hybridization technology described in the present invention includes probe hybridization technology and gene chip technology. The probe hybridization technology refers to hybridizing a labeled probe with a miRNA sample, and then performing signal detection to determine the expression level of miRNA. The probe hybridization method includes northern hybridization method, miRNA expression spectrum chip, ribozyme protection analysis technology, RAKE method, in situ hybridization, microsphere-based flow cytometry and other technologies; the gene chip technology refers to a method of attaching high-density DNA fragments to a solid surface such as a membrane or glass sheet in a certain order or arrangement through a microarray technology by a high-speed robot or in situ synthesis method, and using isotope or fluorescent labeled DNA probes, with the help of the principle of base complementary hybridization, to conduct a large number of gene expression and monitoring and other aspects of research. Its sequencing principle is a hybridization sequencing method, that is, a method of determining nucleic acid sequences by hybridizing with a group of nucleic acid probes of known sequences, and a probe of a target nucleotide with a known sequence is fixed on the surface of a substrate. When the nucleic acid sequence with a fluorescent label in the solution produces a complementary match with the nucleic acid probe at the corresponding position on the gene chip, a group of probe sequences with completely complementary sequences are obtained by determining the probe position with the strongest fluorescence intensity. Based on this, the sequence of the target nucleic acid can be reconstructed.

[0016] In a second aspect, the present invention provides a product for diagnosing melanoma.

[0017] Further, the product comprises reagents for detecting the expression levels of miRNA markers miR-450a and miR-675;

[0018] The products include chips, test kits, and preparations;

[0019] The chip includes probes that specifically recognize miRNA markers miR-450a and miR-675;

[0020] The kit includes primers, probes or chips that specifically bind to miRNA markers miR-450a and miR-675;

[0021] The preparation includes probes that specifically recognize miRNA markers miR-450a and miR-675, and primers that specifically bind to miRNA markers miR-450a and miR-675.

[0022] Furthermore, the chip can be prepared by conventional methods for preparing biochips known to those skilled in the art, including (but not limited to): using a solid phase carrier of a modified glass slide or silicon wafer, the 5' end of the probe contains an amino-modified poly dT string, the oligonucleotide probe is prepared into a solution, and then it is spotted on the modified glass slide or silicon wafer using a spotter, arranged into a predetermined sequence or array, and then fixed by leaving it overnight to obtain the miRNA chip of the present invention.

[0023] Furthermore, the kit also includes instructions or labels, positive controls, negative controls, buffers, adjuvants or solvents; the instructions or labels describe in detail how to use the kit to test samples and that the kit is used to detect melanoma.

[0024] Furthermore, the kit may include a variety of different reagents suitable for practical use (such as for different detection methods), and is not limited to the reagents currently listed in the present invention. As long as the reagent is based on the detection of miR-450a and miR-675 to diagnose melanoma, it is included in the scope of the present invention.

[0025] In a third aspect, the present invention provides the use of miRNA markers miR-450a and miR-675 in the preparation of a pharmaceutical composition for treating melanoma.

[0026] Further, the pharmaceutical composition includes an inhibitor that reduces the expression levels of miR-450a and miR-675;

[0027] The sequence of the inhibitor that reduces the expression level of miR-450a is shown in SEQ ID NO: 1;

[0028] The sequence of the inhibitor that reduces the expression level of miR-675 is shown in SEQ ID NO:2.

[0029] In a fourth aspect, the present invention provides a pharmaceutical composition for treating melanoma.

[0030] Further, the pharmaceutical composition includes an inhibitor that reduces the expression levels of miR-450a and miR-675;

[0031] The sequence of the inhibitor that reduces the expression level of miR-450a is shown in SEQ ID NO: 1;

[0032] The sequence of the inhibitor that reduces the expression level of miR-675 is shown in SEQ ID NO:2.

[0033] Furthermore, the pharmaceutical composition may also include one or more pharmaceutically acceptable carriers, diluents, fillers, binders and other excipients, mainly depending on the administration method and the designed dosage form.

[0034] Inorganic or organic carriers known to those skilled in the art for therapeutic inertness include (but are not limited to): lactose, corn starch or its derivatives, talc, vegetable oils, waxes, fats, polyols such as polyethylene glycol, water, sucrose, ethanol, glycerol, and the like, various preservatives, lubricants, dispersants, flavoring agents. Moisturizers, antioxidants, sweeteners, colorants, stabilizers, salts, buffers, and the like may also be added thereto, and these substances are used as needed to help the stability of the formulation or to help improve the activity or its biological effectiveness or to produce an acceptable taste or smell in the case of oral administration. The preparations that can be used in this composition may be in the form of the original compound itself, or optionally in the form of its pharmaceutically acceptable salt. The composition thus prepared may be administered in any appropriate manner known to those skilled in the art as needed. When using the pharmaceutical composition, a safe and effective amount of the drug of the present invention is administered to a person, and the specific dosage should also take into account factors such as the route of administration and the patient's health status, which are all within the skill range of skilled physicians.

[0035] In a fifth aspect, the present invention provides a method for screening candidate drugs for preventing and / or treating melanoma.

[0036] Further, the method comprises the following steps:

[0037] (1) contacting the test substance with a system containing or expressing miR-450a and miR-675;

[0038] (2) detecting the expression levels of miR-450a and miR-675 in the system;

[0039] (3) Select substances that can reduce the expression levels of miR-450a and miR-675 as candidate drugs for preventing and / or treating melanoma.

[0040] Furthermore, the system includes (but is not limited to): a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.

[0041] Furthermore, the substances to be tested include (but are not limited to): interfering molecules, nucleic acid inhibitors, and small molecule compounds designed for miR-450a and miR-675 or their upstream or downstream genes.

[0042] In a sixth aspect, the present invention provides the use of miRNA markers miR-450a and miR-675 in screening candidate drugs for preventing and / or treating melanoma.

[0043] Unless otherwise defined, all technical and scientific terms used in the context of the present invention have the same meanings as understood by those of ordinary skill in the art. The terms used in the specification of the present invention are only for describing specific embodiments and are not intended to limit the present invention. In addition, some terms are explained as follows.

[0044] The term "expression level" used herein refers to the extent to which a specific miRNA sequence is transcribed from its genomic locus, i.e., the concentration of the miRNA in one or more analyzed bloods. In a specific embodiment of the present invention, the specific miRNAs are miR-450a and miR-675.

[0045] The term "miRNA marker" as used herein refers to a molecular indicator (miRNA) having specific biological properties, biochemical characteristics or other characteristics, which can be used to determine the presence or absence of a particular disease or condition and / or the severity of a particular disease or condition. In a specific embodiment of the present invention, the particular disease or condition refers to melanoma.

[0046] As used herein, the term "treatment" refers to treatment involving humans or animals (e.g., used by veterinarians) in which certain desired therapeutic effects can be achieved, such as inhibiting the development of a disease (including reducing the rate of development, stopping the development), improving the disease, and curing the disease. Treatment as a preventive measure (e.g., prophylaxis) is also included. Use on patients who have not yet developed the disease but are at risk of developing the disease is also included in the term "treatment".

[0047] The term "differential expression" as used herein refers to the expression level of miRNA in the target sample is changed compared to the control sample, and the control sample can be a sample of a healthy person, which can be up-regulated (i.e., the concentration of miRNA in the target sample increases) or down-regulated (i.e., the concentration of miRNA in the target sample decreases or disappears). In a specific embodiment of the present invention, the miRNA is miR-450a and miR-675.

[0048] The term "inhibitor" or "inhibitor that reduces the expression level of biomarkers" used in this article refers to miRNA inhibitors. MiRNA inhibitors are chemically modified inhibitors specifically targeting specific target miRNAs in cells. They specifically target and knock out single miRNA molecules, which can weaken the gene silencing effect of endogenous miRNAs, increase protein expression, and conduct loss-of-function studies. They can be used to screen miRNA target sites, screen miRNAs that regulate the expression of a certain gene, and screen miRNAs that affect cell development. MiRNA inhibitors are chemically modified single-stranded RNAs that can competitively bind to mature miRNA sequences. They are easy to obtain, simple to operate, and have a short experimental cycle. They can be well applied to miRNA functional analysis studies, such as functional studies on cell proliferation, cell apoptosis, cell differentiation, cell migration, and stem cell growth. MiRNA inhibitors can be transfected into cells by simply wrapping them with transfection reagents, without the tedious operation of constructing vectors or worrying about virus protection. Transfection efficiency can be observed using transfection controls.

[0049] The sequences of the miRNA markers miR-450a and miR-675 disclosed in the present invention can be queried in the miRBase database (http: / / microrna.sanger.ac.uk / ), wherein the sequence of miR-450a is shown in SEQ ID NO: 10, and the sequence of miR-675 is shown in SEQ ID NO: 11;

[0050] Sequence of miR-450a:

[0051] AAACGAUACUAAACUGUUUUUGCGAUGUGUUCCUAAUAUGCACUAUAAAUAUAUUGGGAACAUUUUGCAUGUAUAGUUUUGUAUCAAUAUA (SEQ ID NO: 10)

[0052] Sequence of miR-675:

[0053] CCCAGGGUCUGGUGCGGAGAGGGCCCACAGUGGACUUGGUGACGCUGUAUGCCCUCACCGCUCAGCCCCUGGG (SEQ ID NO: 11)

[0054] Further, the miR-450a and miR-675 described in the present invention are selected from: miR-450a and miR-675 initial miRNA, miR-450a and miR-675 precursor miRNA, and miR-450a and miR-675 mature miRNA. It should be known to those skilled in the art that the miR-450a and miR-675 in the embodiments of the present invention include functional equivalents of the constitutive nucleic acid molecules, i.e., variants, which show the same functions of the complete miR-450a and miR-675 nucleic acid molecules, although they are mutated by deletion, substitution or insertion of nucleotide residues. It is well known to those skilled in the art that in order to ensure the stability of miRNA, protective bases, such as TT, can be added at one or both ends of the miRNA, and the miRNA bases can also be modified, but the function of the miRNA is not affected. Therefore, it is well known to those skilled in the art that, without affecting the functions of miR-450a and miR-675, the sequences obtained by base modification of miR-450a and miR-675 or adding bases at both ends are also included in the protection scope of the present invention.

[0055] The present invention has the following beneficial effects:

[0056] (1) The present invention first discovered that the combination of miRNA markers miR-450a and miR-675 has a high diagnostic efficacy for melanoma, showing significant differential expression in melanoma, and can be applied to the diagnosis of melanoma;

[0057] (2) The present invention is the first to discover that the combination of miRNA markers miR-450a and miR-675 has a synergistic effect in the treatment of melanoma. Reagents that inhibit the expression of miRNA markers miR-450a and miR-675 can be used simultaneously in the treatment of melanoma, which has a good clinical application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0059] Figure 1 The results of the differential expression of miR-450a and miR-675 between the control group and the melanoma group are shown in Figure A: miR-450a, Figure B: miR-675;

[0060] Figure 2The ROC curve results of the diagnostic efficacy validation of miR-450a and miR-675 for melanoma are shown, where A: miR-450a, B: miR-675;

[0061] Figure 3 The ROC curve results of the combined diagnostic efficacy of miR-450a+miR-675 for melanoma are shown;

[0062] Figure 4 The result graphs showing the relative expression levels of miR-450a and miR-675, wherein, graph A: miR-450a, graph B: miR-675;

[0063] Figure 5 The graphs show the effects of miR-450a inhibitor, miR-675 inhibitor, and the combination of miR-450a inhibitor + miR-675 inhibitor on the apoptosis rate of melanoma cells, wherein Figure A: blank control group, Figure B: negative control group, Figure C: miR-450a inhibitor group, Figure D: miR-675 inhibitor group, and Figure E: miR-450ainhibitor + miR-675 inhibitor group. DETAILED DESCRIPTION

[0064] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and are not to be construed as limiting the present invention. It will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and purposes of the present invention, and that the scope of the present invention is defined by the claims and their equivalents. The experimental methods for which specific conditions are not specified in the following examples are usually tested under conventional conditions or under conditions recommended by the manufacturer.

[0065] Example 1 Screening for differentially expressed genes in melanoma

[0066] 1. Data Source and Processing

[0067] Public gene expression data and complete clinical annotations were searched in the Gene Expression Omnibus (GEO) database, and the melanoma gene expression dataset GSE20994 was downloaded from the GEO database (http: / / www.ncbi.nlm.nih.gov / geo / ). The dataset included blood sample data of healthy controls and melanoma patients, and the sample size of the dataset was Case: Normal = 35:22. The dataset was annotated using an annotation file, and the average value of multiple probes corresponding to the same gene was taken as its expression value, and then the gene expression matrix file was obtained.

[0068] 2. Differential Expression Analysis

[0069] The “limma” package in R software was used to perform differential expression analysis on the above data, where the screening criteria for differentially expressed genes were: |log 2 FC|>0.5, adj.P value<0.05.

[0070] 3. Experimental results

[0071] The experimental results showed that a total of 397 differentially expressed genes were screened, of which 190 were upregulated and 207 were downregulated. Among them, the biomarkers miR-450a and miR-675 involved in the present invention were significantly upregulated in the blood samples of melanoma patients. The results are shown in Tables 1 and Figure 1 A. Figure 1 B.

[0072] Table 1 Differential expression results of miR-450a and miR-675

[0073]

[0074] Example 2 Verification of the diagnostic efficacy of miR-450a and miR-675

[0075] 1. Experimental methods

[0076] The R package "pROC" was used to perform receiver operating characteristic (ROC) analysis, draw ROC curves, and analyze the AUC values, sensitivity and specificity of the differentially expressed genes miR-450a, miR-675, and miR-450a+miR-675 screened in Example 1 as detection variables, respectively, to determine the diagnostic efficacy of the above indicators miR-450a, miR-675, and miR-450a+miR-675 for melanoma. When determining the diagnostic efficacy of a single miRNA, the expression level of miRNA was directly used for analysis. First, the pROC package was called, and then the expression matrix constructed by the target miRNA was read in, and the command for drawing the ROC curve was run, in which the command used a for loop, and involved adding commands for AUC, Thres (threshold), and Smooth (fitting curve). When judging the diagnostic efficacy of miRNA combination, we first used glmnet to perform Logistic regression analysis on miRNA. Using the established Logistic regression model, we used the predict function to observe the influence of a certain predictor variable on the probability of the result at each level, calculated the prediction probability, and drew the ROC curve of the prediction result. We then analyzed the diagnostic efficacy of miR-450a, miR-675, and miR-450a+miR-675.

[0077] 2. Experimental results

[0078] The results are shown in Table 2 and Figure 2 A. Figure 2 B. Figure 3 From the results, it can be seen that the combined use of miR-450a and miR-675 in the diagnosis of melanoma has high accuracy, sensitivity and specificity, with an AUC value of 0.860, which is significantly better than the diagnostic efficacy of single genes miR-450a and miR-675, indicating that the combination of miR-450a and miR-675 has better diagnostic efficacy.

[0079] Table 2 Diagnostic efficacy results of miR-450a, miR-675, and miR-450a+miR-675

[0080]

[0081] Example 3 Study on the relationship between the expression of miR-450a and miR-675 and apoptosis of melanoma cells

[0082] 1. Experimental Materials

[0083] The main experimental equipment, reagents and consumables involved in the experiment are shown in Tables 3 and 4.

[0084] Table 3 Main equipment involved in the experiment

[0085]

[0086] Table 4 Main reagents involved in the experiment

[0087]

[0088] 2. Cell source

[0089] Melanoma cell A375 was purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, and was cultured in this laboratory for a long time after introduction. The A375 culture medium was DMEM + 10% FBS + 1% P / S solution, 37°C, 5% CO 2 The culture was carried out under the conditions of 95% air and saturated humidity.

[0090] 3. Cell culture

[0091] (1) A375 melanoma cell recovery

[0092] The cell recovery method uses a rapid thawing method in a water bath. Before the experiment, take out a cryopreserved tube of A375 melanoma cells from liquid nitrogen, pay attention to the label name, freezing date and other information, confirm that it is the required cell, and then quickly put it into the prepared 37°C water bath. The whole process must be fast, and it is best to completely thaw the cryopreserved solution within 1 minute. At this time, pay attention to aseptic operation to prevent infection, and pay special attention to the protection of the bottle cap. After the thawing is completed, use a pipette to transfer the frozen cells to a centrifuge tube, add PBS buffer solution and blow evenly to ensure that it is completely integrated into the PBS buffer solution, then put the centrifuge tube into the centrifuge, adjust the speed to 1000 rpm / min, and maintain the time for about 5 minutes. Take out the supernatant, retain the material at the bottom of the centrifuge tube, add an appropriate amount of DMEM complete medium to resuspend, and plant it in a T25 culture bottle at a ratio of 1:2. Add 5 mL of DMEMF complete medium to each culture bottle. Suspended round cells can be seen under the microscope, indicating that the cells have been successfully transferred, and then put them into a centrifuge containing 5% CO 2 , cultured in a cell incubator at a constant temperature of 37°C;

[0093] (2) A375 melanoma cell culture medium replacement

[0094] The time for A375 melanoma cells to begin to adhere to the wall is generally about 4-6 hours, and they can be completely attached to the wall in one day. The cells after attachment are polygonal. The medium can be changed according to the color of the culture medium and the observation under the microscope. Note that the DMEM complete culture medium must be preheated in a 37°C constant temperature water bath in advance. The old culture medium on top can be sucked with a Pasteur tube. Try not to touch the bottom of the culture dish to prevent scratches on the bottom cells and uneven cell growth. Then slowly add PBS buffer solution preheated in a 37°C water bath along the side wall for washing to remove some necrotic cells. You can rinse it three times with PBS preheated in a 37°C water bath. Finally, add 5 mL of DMEM complete culture medium preheated in a 37°C water bath to the culture dish and put it in 5% CO 2 , 37℃ constant temperature incubator. Pay attention to aseptic operation during the whole process, and discard the Pasteur tube in time after it comes into contact with the outside world. The process should be clean and not too long;

[0095] (3) A375 melanoma cell passaging

[0096] In about 2-3 days, A375 melanoma cells can reach 80%-100% cell confluence, at which time the cells are passaged. Personal protection should be performed before the experiment. In the clean bench that has been disinfected for 30 minutes in advance, use a Pasteur tube to aspirate the old culture medium, rinse three times with PBS preheated in a 37°C water bath, add 1 mL of 0.25% trypsin, put it in a 37°C constant temperature incubator, and time it for about 1 minute. To determine whether the cells are completely digested, you can observe under an inverted microscope. If most of the round cells are suspended, stop the trypsin digestion, add 1-2 mL of 5-10 mL DMEM / F-12 complete medium preheated in a 37°C water bath, and blow the cells in time to make the cells completely suspended in the solution, then transfer them to a centrifuge tube, balance the centrifuge, adjust the speed to 1000 rpm / min, centrifuge for about 5 minutes, and pass them at a ratio of 1:3-1:5. Put 5-10 mL DMEM / F-12 complete medium in the culture dish and put it in a 37°C, 5% CO 2 The cells were cultured in a constant temperature incubator.

[0097] 4. Cell transfection

[0098] (1) Take A375 cells in the logarithmic growth phase and the cells in good growth condition and adjust the cell density to 1×10 5 / mL, inoculated into 6-well plates, 2 mL of cell suspension per well, two wells per group, cultured at 37°C overnight;

[0099] (2) 2 hours before transfection, change to serum-free medium;

[0100] (3) Transfection step: For each transfection sample, prepare as follows:

[0101] 1) Count the cells one day before transfection and add 1 mL to a 6-well plate so that the cell density in the well plate is not less than 2×10 5 indivual;

[0102] 2) For each well of cells, dilute 10 μL of 100 nM inhibitor with 250 μL of serum-free medium and incubate at room temperature for 5 min;

[0103] 3) For each well of cells, dilute 5 μL of Lipo2000 with 250 μL of serum-free medium and incubate at room temperature for 5 minutes;

[0104] 4) Mix the liquids in step 2) and step 3) and incubate at room temperature for 20 min;

[0105] 5) Change the pre-split adherent cells into serum-free medium, add the above complex, and incubate at 37°C, 5% CO 2 The cells were cultured for 6 hours and then replaced with growth medium with serum and continued to be cultured at 37°C with 5% CO 2 Culture for 48 hours. Collect cell samples, wash twice with PBS, discard the liquid, and perform subsequent RNA extraction;

[0106] The experiment was set up into three groups: blank control group (A375 melanoma cells), negative control group (inhibitor-NC) and experimental group (inhibitor group).

[0107] Among them, the sequence information of the inhibitor targeting miR-450a is as follows:

[0108] 5'-AUAUUAGGAACACAUCGCAAAA-3' (SEQ ID NO:1)

[0109] The sequence information of the inhibitor against miR-675 is as follows:

[0110] 5'-CACUGUGGGCCCUCUCCGCACCA-3' (SEQ ID NO: 2)

[0111] The sequence information of inhibitor-NC is as follows:

[0112] 5'-CAGUACUUUUGUGUAGUACAAA-3' (SEQ ID NO:3)

[0113] 5. QPCR detection of miR-450a and miR-675 expression levels in cells

[0114] (1) Extraction of total RNA from samples (Trizol method)

[0115] 1) Take an appropriate amount of the sample to be tested, add liquid nitrogen and grind it into powder;

[0116] 2) Transfer the ground sample to a 1.5 mL EP tube with 1 mL Trizol;

[0117] 3) Add 500 μL of phenol chloride to a 1.5 mL EP tube, shake and mix, and let stand for 5 minutes;

[0118] 4) Centrifuge at 12000 rpm at 4°C for 10 minutes and carefully transfer the supernatant to a new 1.5 mL EP tube;

[0119] 5) Add 700 μL of isopropanol to the separated supernatant and mix thoroughly;

[0120] 6) Centrifuge at 12,000 rpm for 10 minutes at 4°C and carefully discard the supernatant;

[0121] 7) Wash the precipitate once with 75% ethanol and dry it at room temperature;

[0122] 8) Dissolve the RNA precipitate in 50 μL DEPC water;

[0123] 9) Agarose gel electrophoresis detection.

[0124] (2) Total RNA quality detection

[0125] 1) Use a nucleic acid concentration meter to measure RNA concentration and purity. Before measuring, use DEPC water for dissolving RNA to adjust the zero. The operation method is as follows: lift the sample arm and add the sample to the detection base; lower the sample arm and use the software on the computer to start the absorbance value detection. A sample column will be automatically pulled out between the upper and lower optical fibers, and then the test will be carried out; when the test is completed, lift the sample arm and wipe the samples on the upper and lower bases with clean dust-free paper;

[0126] 2) Concentration determination: A reading of 1 at 260 nm represents 40 ng RNA / µL. The formula for calculating the sample RNA concentration is: A260 X 40 ng / µL;

[0127] 3) Purity test: The A260 / A280 ratio of the RNA solution is a method for detecting RNA purity, and the ratio ranges from 1.8 to 2.1.

[0128] (3) Reverse transcription and cDNA synthesis

[0129] Reverse transcription was performed using Invitrogen's reverse transcription kit Superscript III;

[0130] The reaction system 1 was set up as shown in Table 5, mixed, centrifuged, 65°C, 5 minutes, and placed on ice after completion;

[0131] Table 5 Composition of reaction system 1

[0132]

[0133] The establishment of reaction system 2 is shown in Table 6;

[0134] Table 6 Composition of reaction system 2

[0135]

[0136] Mix well, centrifuge, and place in a 42°C water bath for 60 minutes; take out and place at 85°C for 10 minutes to inactivate the reverse transcriptase. After the reaction is completed, place the product at -20°C for later use.

[0137] (4) Real-time fluorescence quantitative detection

[0138] First, design the amplification primers for QPCR. The specific primer sequences are as follows:

[0139] miR-450a:

[0140] The forward primer was 5′-TTTTGCGATGTGTTCCTAAT-3′ (SEQ ID NO: 4);

[0141] The reverse primer was 5′-CTCAACTGGTGTCGTG-3′ (SEQ ID NO: 5);

[0142] miR-675:

[0143] The forward primer was 5′-TGGTGCGGAGAGGGCCCAC-3′ (SEQ ID NO: 6);

[0144] The reverse primer was 5′-CTCAACTGGTGTCGTG-3′ (SEQ ID NO: 7);

[0145] U6 internal reference primer:

[0146] The forward primer was 5′-GCTTCGGCAGCACATATACTAAAAT-3′ (SEQ ID NO: 8);

[0147] The reverse primer was 5′-CGCTTCACGAATTTGCGTGTCAT-3′ (SEQ ID NO: 9);

[0148] The establishment of the Real time PCR reaction system is shown in Table 7;

[0149] Table 7 Real time PCR reaction system

[0150]

[0151] After the system is mixed, centrifuge briefly, place on a fluorescent quantitative PCR instrument, and react according to the conditions described in Table 8;

[0152] Table 8 Realtime PCR reaction conditions

[0153]

[0154] The relative quantitative results of each group of samples were analyzed, and the calculation formula for the relative expression of miR-450a and miR-675 was as follows:

[0155]

[0156] 6. Cell apoptosis experiment

[0157] In this example, flow cytometry was used to detect the effect of the expression of miR-450a, miR-675, and miR-450a+miR-675 on apoptosis of A375 melanoma cells. First, A375 melanoma cells that were not transfected, transfected with miR-450a inhibitor, transfected with miR-675 inhibitor, and transfected with both miR-450a inhibitor and miR-675 inhibitor were collected, and the cells were washed and fixed with ethanol, and the cells were resuspended and filtered, and stained with PI dye solution, and then detected by flow cytometry;

[0158] Among them, in the detection of cell apoptosis, different quadrants in the flow cytometry detection result graph represent different meanings. Q1-1 (AnnexinV-FITC)- / PI+ represents necrotic cells, Q1-2 (AnnexinV+FITC)+ / PI+ represents cells with middle and late apoptosis, Q1-4 (AnnexinV-FITC)+ / PI- represents cells with early apoptosis, and Q1-3 (AnnexinV-FITC)- / PI- represents normal living cells. The percentage of each quadrant represents the proportion of the corresponding cells, and the total cell apoptosis rate = middle and late apoptosis rate + early apoptosis rate.

[0159] 7. Experimental results

[0160] The results of transfection showed that the expression level of miR-450a in the blank control group was set as a reference of 1. Compared with the expression level of miR-450a in the blank control group (relative expression level was 1) and the expression level of miR-450a in the negative control group (NC group) transfected with inhibitor-NC, the expression level of miR-450a in the experimental group transfected with miR-450a inhibitor was significantly downregulated, and the difference was statistically significant (P < 0.05), while there was no significant difference between the blank control group and the negative control group (see Figure 4 A);

[0161] The results of transfection showed that the expression level of miR-675 in the blank control group was set as 1 as the reference. Compared with the expression level of miR-675 in the blank control group (relative expression level was 1) and the expression level of miR-675 in the negative control group (NC group) transfected with inhibitor-NC, the expression level of miR-675 in the experimental group transfected with miR-675 inhibitor was significantly downregulated, and the difference was statistically significant (P < 0.05), while there was no significant difference between the blank control group and the negative control group (see Figure 4 B);

[0162] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group transfected with miR-450a inhibitor (10.27%) was significantly higher than that in the blank control group (3.10%) and the negative control group (3.06%) (see Table 9 and Figure 5 A. Figure 5 B. Figure 5 C), indicating that miR-450a can affect the apoptosis of melanoma cells, and inhibiting the expression of miR-450a can promote the apoptosis of melanoma cells;

[0163] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group transfected with miR-675 inhibitor (10.35%) was significantly higher than that in the blank control group (3.10%) and the negative control group (3.06%) (see Table 9 and Figure 5 A. Figure 5 B. Figure 5 D) showed that miR-675 could affect the apoptosis of melanoma cells, and inhibiting the expression of miR-675 could promote the apoptosis of melanoma cells;

[0164] The results of the cell apoptosis experiment showed that the total apoptosis rate of the cells in the experimental group co-transfected with miR-450a inhibitor and miR-675 inhibitor (25.88%) was significantly higher than that in the experimental group transfected with miR-450a inhibitor alone (10.27%) and the experimental group transfected with miR-675 inhibitor alone (10.35%) (see Table 9 and Figure 5 C. Figure 5 D. Figure 5 E);

[0165] In addition, the cell inhibition rate of each group was calculated. The results are shown in Table 10. Using the Jin's formula expression q = E A+B / (E A +E B -E A ×E B ) to determine whether the effect of the combined use of the two is better than that of the single use, where E A+B is the inhibition rate of miR-450a inhibitor+miR-675 inhibitor on melanoma cells, E A is the inhibition rate of miR-450a inhibitor on melanoma cells, E B is the inhibition rate of miR-675 inhibitor on melanoma cells; if q=0.85-1.15, it is simple superposition; 1.15<q<20 is synergy; q>20 is significant synergy; q<0.85 is antagonism, that is, when q>1.15, it can be determined that the apoptosis-promoting effects of miR-450a inhibitor and miR-675 inhibitor on melanoma cells are synergistic, rather than simple superposition;

[0166] According to the results of cell inhibition rate calculated in Table 10, the synergistic q value was calculated using King's formula to evaluate whether the combined effect of miR-450a inhibitor and miR-675 inhibitor was stronger than the effect of each alone. Substituting the results of cell inhibition rate calculated into the formula, it can be seen that q=E A+B / (E A +E B -E A ×E B)=0.2278 / (0.0717+0.0725-0.0717×0.0725)=1.639, that is, q=1.639, q>1.15, indicating that the promoting effects of miR-450a inhibitor and miR-675 inhibitor on the apoptosis of melanoma cells are synergistic, further proving that the combination of miR-450a inhibitor and miR-675 inhibitor is a synergistic treatment rather than a simple additive effect.

[0167] Table 9 Statistics of cell apoptosis experiments

[0168]

[0169] Table 10 Calculation results of cell inhibition rate of each group

[0170]

[0171] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention. Sequence Listing <110> Beijing Bioscience Biomedical Technology Co., Ltd. <120> miRNA markers and related products for melanoma diagnosis and treatment <141> 2021-10-11 <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> RNA <213> Artificial Sequence <400> 1 auauuaggaa cacaucgcaa aa 22 <210> 2 <211> twenty three <212> RNA <213> Artificial Sequence <400> 2 cacugugggc ccucuccgca cca 23 <210> 3 <211> twenty two <212> RNA <213> Artificial Sequence <400> 3 caguacuuuu guguaguaca aa 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 ttttgcgatg tgttcctaat 20 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <400> 5 ctcaactggt gtcgtg 16 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <400> 6 tggtgcggag agggcccac 19 <210> 7 <211> 16 <212> DNA <213> Artificial Sequence <400> 7 ctcaactggt gtcgtg 16 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <400> 8 gcttcggcag cacatatact aaaat 25 <210> 9 <211> twenty three <212> DNA <213> Artificial Sequence <400> 9 cgcttcacga atttgcgtgt cat 23 <210> 10 <211> 91 <212> RNA <213> Artificial Sequence <400> 10 aaacgauacu aaacuguuuu ugcgaugugu uccuaauaug cacuauaaau auauugggaa 60 cauuuugcau guauaguuuu guaucaauau a 91 <210> 11 <211> 73 <212> RNA <213> Artificial Sequence <400> 11 cccagggucu ggugcggaga gggcccacag uggacuuggu gacgcuguau gcccucaccg 60 cucagccccu ggg 73

Claims

1. Use of a reagent for detecting the expression levels of miRNA markers miR-450a and miR-675 in the preparation of a product for diagnosing melanoma.

2. The use according to claim 1, characterized in that: The reagents include reagents for detecting the expression levels of miRNA markers miR-450a and miR-675 using sequencing technology, nucleic acid hybridization technology, and nucleic acid amplification technology.

3. The use according to claim 2, characterized in that: The reagent is selected from: Probes that specifically recognize the miRNA markers miR-450a and miR-675; or Primers that specifically amplify the miRNA markers miR-450a and miR-675.

4. The use according to claim 3, characterized in that: The sequences of the primers for specifically amplifying the miRNA markers miR-450a and miR-675 are shown in SEQ ID NO:4-SEQ ID NO:5 and SEQ ID NO:6-SEQ ID NO:7, respectively.

5. Use of inhibitors that reduce the expression levels of miRNA markers miR-450a and miR-675 in the preparation of a pharmaceutical composition for the treatment of melanoma.

6. The use according to claim 5, characterized in that: The sequence of the inhibitor that reduces the expression level of miR-450a is shown in SEQ ID NO: 1; The sequence of the inhibitor that reduces the expression level of miR-675 is shown in SEQ ID NO:2.

Images