A method and application of MMEJ targeted genome modification based on palindromic sequence within the target site

Abstract

The present invention belongs to the field of biotechnology and discloses a method and application of MMEJ targeted genome modification based on palindromic sequences within the target site. The present invention uses the CRISPR / Cas9 system to form a 6bp microhomology sequence after reverse complementation of the same target site, which can be used to mark endogenous modification of fish genes. Taking zebrafish as an example, the applicant has targeted genes specifically expressed in the zebrafish heart. myl7 Perform targeted genome modification to establish a transgenic strain of zebrafish heart-specific marker green fluorescent protein. MMEJ-targeted genome modification mediated by palindromic sequences within the target site is a precise and efficient repair method that achieves tissue-specific labeling without destroying the function of endogenous genes, and truly, accurately and sensitively reflects gene expression. myl7 The molecular expression level of myl7 The study of gene function.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a MMEJ targeted genome modification method and application based on palindromic sequence mediation within a target site. Background Art

[0002] Fine editing of the genome is a key technology for achieving complex and fine targeted modification of the genome. This technology can insert artificially designed DNA fragments at specific points in the genome. This DNA fragment can be a single or multiple DNA molecules encoding functional proteins, a regulatory element with transcriptional activity, or a genomic sequence with regulatory activity. Therefore, targeted genome modification methods are a key technology for achieving "site-specific integration and controllable expression" of genes.

[0003] In recent years, with the rapid development of various targeted nuclease-mediated genome editing technologies in the field of biological genomes, CRISPR (clustered regularly interspersed short palindromic repeats) / Cas9 system components are relatively simple and have higher efficiency, becoming the most commonly used targeted nuclease. Some researchers have tried to use the host DNA double strand breaks (DSBs) induced by targeted nucleases, combined with a variety of DSBs repair mechanisms, to initially achieve site-specific integration in the model animal zebrafish. For example, Zhang Bo's team at Peking University was the first to use targeted nuclease-mediated homologous recombination (HR) to achieve precise integration in zebrafish, but the efficiency of the passage was low at only 1.5%. Therefore, the use of HR for site-specific integration was limited to a limited number of genomic target sites, and this technology has not been widely accepted and applied in the field. At the same time, many research teams have carried out targeted integration by adjusting the length of homology arms or linearizing plasmids. Although these studies have reported the knock-in of genes at different target sites, they have a common problem that has not been completely overcome in their studies, namely, low efficiency of passage and precise integration. In 2015, Du Jiulin's team at the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, cleverly designed the break position of DSBs on the last intron of the target gene, and used the nonhomologous end-joining (NHEJ) mechanism of DSBs to successfully introduce exogenous genes without destroying the expression of endogenous genes, and the efficiency of passage reached 12%. This method provides a new idea for the establishment of gene knock-in technology. Furthermore, they used this design idea to increase the efficiency of gene knock-in to 28% (2 / 7) in recent studies. However, since introns often contain a large number of repetitive sequences, it is not conducive to the design of gRNA targets. At the same time, the random loss of DNA sequences caused by NHEJ often leads to unsatisfactory integration and expression of target genes. Therefore, whether it is HR or NHEJ mechanism-based site-specific knock-in technology in fish genome, there are problems in various aspects such as target selection, vector construction and knock-in efficiency.

[0004] In recent years, the applicant and the laboratory of Professor Alexander Schier of Harvard Medical School have successively found that microhomology mediated end joining (MMEJ) is the main repair method of DSBs during the early development of fish. Subsequently, the MMEJ mechanism was used to achieve precise integration in zebrafish embryos. It was found that when the NHEJ-mediated exogenous gene knock-in efficiency was as high as 56%, the efficiency of precise integration of exogenous genes could be promoted to 60%-77% by introducing homologous fragments of different lengths (10-40bp) near the target site. However, due to the way in which vector DSBs were generated in the aforementioned reports, the application scope of the methods in these reports is relatively limited.

[0005] In vivo imaging of fluorescently labeled proteins is an important tool for understanding gene function. The most accurate way to reproduce physiological gene expression levels and patterns is to directly tag the gene at its endogenous genomic locus to produce the corresponding fusion protein. The key technology to achieve this specific tagging is targeted nuclease-mediated gene knock-in technology. Although the CRISPR / Cas9 system has made gene knock-in technology possible in many model organisms, and gene knock-in of multiple gene loci has also been achieved in zebrafish, the reported methods still have certain limitations in knock-in efficiency, accuracy, and universality. So far, these reported strategies cannot be applied to all genomic target sites. Therefore, it is urgent to seek to establish an efficient, accurate and universal gene knock-in technology. Summary of the invention

[0006] The purpose of the present invention is to provide a preparation method for MMEJ targeted genome modification mediated by palindromic sequences within the target site, wherein the modification is specifically site-directed gene knock-in.

[0007] Another object of the present invention is to provide a method for MMEJ targeted genome modification mediated by palindromic sequences within the target site and its application in gene knock-in of fish.

[0008] In order to achieve the above-mentioned purpose, the present invention adopts the following technical measures:

[0009] A method for MMEJ targeted genome modification based on palindromic sequences within a target site, comprising the following steps:

[0010] 1) Selecting a target sequence containing a palindromic sequence in the target gene as gRNA; the palindromic sequence is CCNMGG, where NM represents AT, TA, CG or GC;

[0011] 2) Amplifying the target knock-in gene, wherein the 5' end of the gene carries the reverse complementary sequence of the gRNA in step 1); after the amplification is completed, constructing a gene knock-in vector carrying the exogenous gene;

[0012] 3) Microinject gRNA, gene knock-in vector, and Cas9 mRNA into fish 1-cell embryos.

[0013] In the steps described above, preferably, after selecting the gRNA, the effectiveness of the target is verified first, that is, the synthetic target is injected into the zebrafish 1-cell stage by microinjection using the CRISPR / Cas9 system, and the injection components are Cas9 mRNA and gRNA. After the injected embryo develops, the genome is extracted and sequenced to verify the effectiveness of the designed target.

[0014] The above method can be used for gene knock-in or endogenous marking of fish genes.

[0015] In the above steps, preferably, CCGCGGCCAAGAGGGGGAAAACT of the zebrafish myl7 gene is selected as the gRNA, and finally the gene knock-in vector pGT-myl7 (shown in SEQ ID NO.1) is constructed, and the pGT-myl7 plasmid, Cas9 mRNA, target gRNA and phenol red are mixed and the sample is injected into the zebrafish embryo at the 1-cell stage by microinjection to screen and obtain the target product.

[0016] In the above steps, preferably, the exogenous gene is an exogenous modified gene, preferably a fluorescent marker gene, including but not limited to a green fluorescent protein gene, a red fluorescent protein gene, a blue fluorescent protein gene, etc.

[0017] Compared with the prior art, the present invention has the following advantages and effects:

[0018] The endogenous target of the present invention is reverse-complemented as the target of the exogenous vector, and after the CRISPR / Cas9 system cuts, the end of the exogenous cutting will form a 6bp micro-homology sequence, and the mechanism of using MMEJ to repair DSBs with the help of the micro-homology sequence can realize accurate targeted modification of the endogenous gene, successfully introduce the exogenous vector sequence, and complete the fluorescence or Tag labeling of the endogenous gene. This design realizes that the endogenous efficient target is the exogenous vector target, and the 6bp micro-homology-mediated DNA connection mode has both the accuracy of HR-mediated gene knock-in and the efficiency higher than NHEJ-mediated gene knock-in, and the construction of the MMEJ exogenous vector is much more convenient and fast than the construction of the HR exogenous vector, and is not limited to the interference of single base polymorphisms widely present in the endogenous genome like HR. Therefore, the use of MMEJ-mediated DNA repair mechanism to establish accurate and efficient gene knock-in technology in fish has obvious advantages.

[0019] Using this strategy, the design of the exogenous vector is relatively simple, and very specific fluorescent protein expression can be observed in the P0 generation, with a high knock-in efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 A schematic diagram of the target site location in the genome;

[0021] Among them, the designed targets ( CCG CGGCCAAGAGGGGGAAAACT, PAM ) is located in exon 2 of the myl7 gene. The palindromic sequence of the target site is CCGCGG, and the target site was verified to be an effective target site by sequencing of the PCR product.

[0022] Figure 2 The schematic diagram of the constructed pGT-myl7 targeted modified exogenous vector;

[0023] The target sequence (myl7-TS-RC) on the vector is the reverse complementary sequence of the endogenous target (AGTTTTCCCCCTCTTGGCCG CGG , PAM ), and the targeted modified endogenous gene myl7 is complemented with the ΔCDS on the exogenous vector without destroying the function of the endogenous gene itself.

[0024] Figure 3 Schematic diagram of the myl7 genome targeted modification based on MMEJ;

[0025] a is a strategy for MMEJ targeted genome modification based on palindromic sequences within the target site; b is an early embryo after specific targeted modification in the P0 generation, where specific green fluorescence expression can be seen. c is an early verification of integration efficiency in the P0 generation embryo; d is a cloning analysis of the target band in Figure c, where sequencing revealed that the efficiency of precise integration can reach 80% (4 / 5).

[0026] Figure 4 The F1 embryos that were successfully screened;

[0027] a is an F1 embryo with fluorescent protein specifically expressed in early cardiomyocytes; b is specific imaging of cardiomyocytes; c is the efficiency of precise integration of F1 embryos (5 / 5). DETAILED DESCRIPTION

[0028] The technical solutions of the present invention, unless otherwise specified, are conventional techniques in the art. All primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0029] Embodiment 1:

[0030] In Example 1 of the present invention, the zebrafish myl7 gene (ENSDARG00000019096) having a palindromic sequence CCGCGG in the exon is used as an example for specific description. Genes of other fish having the palindromic sequence are also applicable to the method of the present invention to achieve efficient integration.

[0031] A method for targeted genome modification based on MMEJ mediated by palindromic sequences within the target site:

[0032] (1) Verification of endogenous targets with palindromic sequence characteristics

[0033] A target site with this sequence feature was found in exon 2 of the zebrafish myl7 gene ( CCG CGGCCAAGAGGGGGAAAACT, PAM )( Figure 1 ). The gRNA was synthesized by in vitro transcription, and the effectiveness of the target was further verified using the CRISPR / Cas9 system. Cas9 mRNA, gRNA and phenol red were mixed and injected into zebrafish 1-cell embryos. The injection dose was Cas9 mRNA 500ng / μL, gRNA 100ng / μL. The genome was extracted from the injected embryos after 1 day of development. The PCR amplification using myl7-test-F and myl7-test-R primers was then sent for sequencing to detect the effectiveness of the designed target. After sequencing, it was found that there was an overlapping peak at the designed target position ( Figure 1 ), indicating that the target has a high knockout efficiency and can be used as a target for subsequent gene knock-in.

[0034] Table 1 Primer sequences used for myl7 gene targeted modification in this application

[0035]

[0036]

[0037] (2) Construction of gene knock-in vector

[0038] According to step (1), the reverse complement sequence of the endogenous effective target can be used as the target of the exogenous vector. Therefore, the design is a micro-homologous end joining mediated by the palindromic sequence in the same target. Compared with the construction of exogenous vectors for gene knock-in using HR and NHEJ methods, it is much easier to construct an exogenous vector for MMEJ targeted genome modification. It only needs to add the reverse complement sequence of the endogenous target (including the PAM region) to the primer of the amplified fragment. The effective target found on exon 2 of the myl7 gene ( CCG CGGCCAAGAGGGGGAAAACT, PAM), the reverse complement sequence (AGTTTTCCCCCTCTTGGCCG CGG , PAM ) can be used as the target of the exogenous vector and added to the upstream primer myl7-FHR-F (AGTTTTCCCCCTCTTGGCCG CGG CGAAAAGAGGCAAGACCGCTCAAAGAGGCTCTTCCA), and the fragment between the myl7 gene target site and its stop codon was amplified using the myl7-FHR-R primer and the 3dpf zebrafish embryo cDNA as a template, and then the myl7-VHR-F and myl7-VHR-R primers were used to reverse PCR amplify the plasmid pMD18T-EGFP as a template to obtain the vector backbone, and the above fragments and the amplified vector backbone were used to construct a gene knock-in vector by homologous recombination to prepare the vector pGT-myl7. The sequence of the vector pGT-myl7 is shown in SEQ ID NO.1 ( Figure 2 ), which carries both myl7 and EGFP genes.

[0039] The plasmid pMD18T-EGFP is obtained by connecting the green fluorescent protein EGFP gene to pMD18-T.

[0040] (3) Microinjection, early embryo fluorescence screening and culture

[0041] The prepared pGT-myl7 plasmid, Cas9 mRNA, target gRNA and phenol red were mixed and injected into zebrafish embryos at the 1-cell stage using a microinjection instrument. The final concentration of each component was 50 ng / μL for pGT-myl7 plasmid, 500 ng / μL for Cas9 mRNA and 100 ng / μL for gRNA ( Figure 3 Injected embryos at 2-3 dpf can clearly express green fluorescent protein in the heart ( Figure 3 b), and has a high efficiency (16 / 50). The insertion event was detected by primers myl7-test-F and EGFP-R2, and the target band of the genome after targeted modification can also be amplified ( Figure 3 c), the target band was purified and recovered, connected to the T vector, and then a single clone was selected for sequencing. The sequencing results showed that the efficiency of accurate integration through MMEJ can reach 80% (4 / 5) ( Figure 3 In d), the efficiency of integration through NHEJ is 20% (1 / 5). Therefore, targeted genome modification using microhomology ligation mediated by palindromic sequences within the same target site has high accuracy and efficiency.

[0042] However, it should be noted that although the injected plasmid is extracted by a detoxification kit, there will still be a high number of deaths or deformities in the embryos after injection of plasmid-containing samples. Therefore, as many embryos as possible should be injected in the early stage, so that at least 50 healthy positive embryos can be selected later for lineage establishment.

[0043] (4) Efficient germline delivery of precisely targeted genome modifications

[0044] The positive embryos of step (3) were carefully cultured to sexual maturity, and cross-crossed with wild-type adult fish to observe whether there were embryos in the F1 generation that specifically expressed green fluorescent protein in the heart, in order to obtain a gene knock-in strain with stable inheritance. Five positive fish with specific expression of green fluorescent protein in the heart were selected in the P0 generation, and one strain fish with stable inheritance was successfully screened, and had a high reproductive transmission efficiency of 22 / 150 ( Figure 4 In a), the germline transmission efficiency is the number of positive embryos that appear in the P0 generation and the F1 generation, which is called the germline transmission efficiency. That is, there are 22 positive embryos in 150 F1 generation embryos, and the heart expresses specific green fluorescent protein in the early embryos ( Figure 4 b). In the early stage of embryonic development, the tail fins of 5 F1 positive embryos were randomly selected to detect their targeted integration events. Sequencing revealed that all 5 embryos were integrated in the pre-designed manner, and the precise integration efficiency reached 100% (5 / 5) ( Figure 4 c). This further illustrates the efficient germline transmission of intra-target palindromic sequence-mediated microhomologous end joining targeted genome modification with precise and targeted integration events.

[0045] Embodiment 2:

[0046] MMEJ targeted genome modification methods based on other palindromic sequences within the target site:

[0047] Using the method of Example 1, the remaining palindromic sequences (CCNMGG, NM represents AT, TA, CG) mediated MMEJ targeted genome modification methods were verified and established in other zebrafish genes. For example, a target site with a CCATGG sequence feature (CCTTCAAAGATCACCCTCCA TGG ), a target with a CCTAGG sequence feature (AGGTCTACAAAGACAGCCCTAGG) was found in exon 2 of the tuba1a gene (ENSDARG00000001889), and a target with a CCCGGG sequence feature (CTATGGACCGAAGCAGGCCC) was found in exon 6 of the cyp11a1 gene (ENSDARG00000002347). GGG), and it has been experimentally verified that these targets with the sequence characteristics can well achieve targeted modification of the target genome, further illustrating the universality of this technology in application. Table 2 shows the primers required for each gene during the operation, and the specific strategy is referenced to Example 1.

[0048] Table 2 Primer sequences used for other palindromic sequence targeted genome modification

[0049]

[0050] Sequence Listing <110> Institute of Hydrobiology, Chinese Academy of Sciences <120> A method and application of MMEJ targeted genome modification based on palindromic sequence within the target site <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 4207 <212> DNA <213> Artificial Sequence <400> 1 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcatgc ctgcaggtcg 420 acgattagtt ttccccctct tggccgcggc gaaaagaggc aagaccgctc aaagaggctc 480 ttccaatgtc ttctccatgt ttgagcaatc acaaatacag gagtttaagg aggcttttgg 540 ctgcatagat cagaaccggg atggagttat caacaaatct gatctgaagg aaacttatgc 600 acaactaggg aagctgaatg tgagtgatga agagctggag tccatgctaa cagaaggaaa 660 agggcccata aacttcactg tcttcctcac cctctttgga gagaagctca atggcacaga 720 cccagaggaa accatccttg ctgcttttaa attgttcgac cctaatgcca caggagttgt 780 caataaagat gagttcaaga ggctgctaat gacccaagct gataaattta cagcagaaga 840 ggttgaccag gcttttgcag tggctccaat agacgtggct ggaaatattg attataagtc 900 gctttgttac attatcacac atggtgatga aaaagaggaa tctggatccg gagccacgaa 960 cttctctctg ttaaagcaag caggagacgt ggaagaaaac cccggtcctg ccaccatggt 1020 gagcaagggc gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga 1080 cgtaaacggc cacaagttca gcgtgtccgg cgagggaa ggtgacgcta cgtatggcaa 1140 gctgaccctg aagttcatct gcaccaccgg caagctgccc gtgccctggc caccaccgt 1200 gaccaccctg acctacggcg tgcagtgctt cagccgctac cccgaccaca tgagcagca 1260 cgacttcttc aagtccgcca tgccgaagg ctacgtccag gagcgcacca tcttcttcaa 1320 ggacgacggc actacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa 1380 ccgcatcgag ctgaagggca tcgactca ggaggacggc aacatcctgg ggcacaagct 1440 ggagtacaac tacacagcc acaacgtcta tatcatggcc ghaagcaga agaacggcat 1500 caggtgaac ttcagatcc gccacacat cgaggacggc agcgtgcagc tcgccgacca 1560 ctaccagcag aacaccccca tcggcgacgg cccgtgctg ctgcccgaca accactact 1620 gagcacccag tccgccctga gcaagaccc caacgagaag cgcgatcaca tggtcctgct 1680 ggagttcgtg accgccgccg ggatcactct cggcatggac gagctgtaca agtaagaatt 1740 ctagatccag acatgataag atacattgat gagttttggac aaaccacac tegatgcag 1800 tgaaaaaaat gctttatttg tgaaatttgt gatgctattg ctttatttgt aaccattata 1860 agctgcaata aacaagttaa caacaacaat tgcattcatt ttatgtttca ggttcagggg 1920 gaggtgtggg aggtttttta atctctagag gatccccggg taccgagctc gaattcgtaa 1980 tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata 2040 cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta 2100 attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa 2160 tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg 2220 ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag 2280 gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 2340 ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc 2400 cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 2460 ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg 2520 accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 2580 catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 2640 gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 2700 tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 2760 agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac 2820 actagaagaa cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga 2880 gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc 2940 aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg 3000 gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca 3060 aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt 3120 atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca 3180 gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg 3240 attack gcttaccac tggcccagt gctgcaatga taccgcgaga cccacgctca 3300 ccggctccag atttatcagc aaaaaccag ccagccggaa gggccgagcg cagaagtggt 3360 cctgcaactt tatccgcctc catccagtct atttattgtt gccgggaagc tagtagt 3420 agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca 3480 cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca 3540 tgatccccca tgttgtgcaa aaagcggtt agctccttcg gtcctccgat cgttgtcaga 3600 agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttcttact 3660 gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga 3720 gatagtgta tgcggcgacc gagttgctt tgcccggcgt caatacggga taataccgcg 3780 ccacatagca gaactttaaa agtgctcatc attggaaac gttctcggg gcgaaaactc 3840 tcaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga 3900 tcttcagcat cttttactt caccagcgtt tctgggtgag caaaaacagg aaggcaaat 3960 gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt 4020 caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt 4080 atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac 4140 gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat cacgaggccc 4200 tttcgtc 4207 <210> 2 <211> 59 <212> DNA <213> Artificial Sequence <400> 2 tgtaatacga ctcactataa gttttccccc tcttggccgg ttttagagct agaaatagc 59 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 agcaccgact cggtgccact ttttc 25 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <400> 4 tttgaggaaa ccgattgcta ca 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <400> 5 gtttgctcga atgccaatgt g 21 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 ggatccggag ccacgaactt c 21 <210> 7 <211> 42 <212> DNA <213> Artificial Sequence <400> 7 cggccaagag ggggaaaact aatcgtcgac ctgcaggcat gc 42 <210> 8 <211> 59 <212> DNA <213> Artificial Sequence <400> 8 agttttcccc ctcttggccg cggcgaaaag aggcaagacc gctcaaagag gctcttcca 59 <210> 9 <211> 41 <212> DNA <213> Artificial Sequence <400> 9 aagttcgtgg ctccggatcc agattcctct ttttcatcac c 41 <210> 10 <211> twenty two <212> DNA <213> Artificial Sequence <400> 10 agttcacctt gatgccgttc tt 22 <210> 11 <211> 59 <212> DNA <213> Artificial Sequence <400> 11 tgtaatacga ctcactatac cttcaaagat caccctccag ttttagagct agaaatagc 59 <210> 12 <211> 59 <212> DNA <213> Artificial Sequence <400> 12 tgtaatacga ctcactataa ggtctacaaa gacagccctg ttttagagct agaaatagc 59 <210> 13 <211> 59 <212> DNA <213> Artificial Sequence <400> 13 tgtaatacga ctcactatac tatggaccga agcaggcccg ttttagagct agaaatagc 59 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 cccacttgac tatccagccc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 cacggagcac aggatcaatg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 cacggagcac aggatcaatg 20 <210> 17 <211> twenty two <212> DNA <213> Artificial Sequence <400> 17 cagctgacgg tatgtcccag tg 22 <210> 18 <211> twenty one <212> DNA <213> Artificial Sequence <400> 18 gtgcaatact ctacaccgat c 21 <210> 19 <211> twenty one <212> DNA <213> Artificial Sequence <400> 19 ccagtacacc aggatacttc c 21

Claims

1. A method for MMEJ targeted genome modification based on palindromic sequences within the target site, comprising the following steps: 1) Based on the requirement of CRISPR / Cas9 system for sequence specificity of the motif region adjacent to the protospacer sequence, a target sequence containing a palindromic sequence in the target gene is selected as the gRNA; the palindromic sequence is CCNMGG 6 bp upstream of the Cas9 protein cleavage site, where NM represents AT, TA, CG or GC; 2) Amplifying the target knock-in gene, wherein the 5' end of the gene carries the reverse complementary sequence of the gRNA in step 1); after the amplification is completed, a gene knock-in vector carrying the exogenous gene is constructed; 3) Microinject gRNA, gene knock-in vector, and Cas9 mRNA into fish 1-cell embryos.

2. The method according to claim 1, characterized in that: After selecting gRNA, the effectiveness of the target is verified first. That is, the synthetic target is injected into the zebrafish 1-cell stage by microinjection using the CRISPR / Cas9 system. The injection components are Cas9 mRNA and gRNA. After the injected embryo develops, the genome is extracted and sequenced to verify the effectiveness of the designed target.

3. The method according to claim 1, wherein the exogenous gene is an exogenous modified gene.

4. The method according to claim 3, wherein the exogenous modified gene is a fluorescent marker gene.

5. The method according to claim 1, comprising the steps of: selecting zebrafish myl7 The CCGCGGCCAAGAGGGGGAAAACT of the gene was used as gRNA, and the gene knock-in vector pGT-myl7 was finally constructed. The gene knock-in vector was shown in SEQ ID NO.

1. pGT-myl7, Cas9 mRNA, target gRNA and phenol red were mixed and the sample was injected into zebrafish embryos at the 1-cell stage by microinjection to screen and obtain the target product.

6. Use of the method according to claim 1 in gene knock-in of fish.

7. Use of the method according to claim 1 in genetic modification of fish.

Images