An in vitro large-fragment DNA cloning method based on CRISPR / Cas12a and its application

Abstract

The present invention relates to a large fragment DNA in vitro cloning method, a kit and related uses mediated by CRISPR / Cas12a system. The mechanism of the DNA cloning is that Cas12a / crRNA is used to perform specific cutting at both ends of the target DNA to obtain a target DNA sequence, a cloning vector is constructed by cloning the DNA sequences at both ends of the target DNA, and a linearized vector is obtained by cutting the cloning vector using Cas12a / crRNA, and the sticky ends formed after cutting are connected by DNA ligase, so as to achieve cloning of the target DNA. The large fragment DNA cloning method of the present invention, the kit and its related uses can not only save time and cost when cloning a large fragment DNA (up to 140kb) with high GC content (e.g., more than 70%), but also have a high positive rate and the potential for market application.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to an in vitro large-fragment DNA cloning method, a kit and applications thereof based on CRISPR / Cas12a. Background Art

[0002] With the continuous advancement of gene sequencing technology and the continuous reduction of sequencing costs, whole genome sequencing has become easier and easier, and people have found that there are rich untapped resources in the genome. In particular, with the new generation of sequencing technology, a large number of cryptic secondary metabolite biosynthetic gene clusters (biosynthetic gene clusters, BGC, whose size ranges from a few kb to hundreds of kb) have been accumulated. For example, huge cryptic biosynthetic gene clusters (BGC) have been found in microbial genomes or intestinal metagenomes, and the activation or expression of these cryptic BGCs has become the most important method for natural product discovery. However, a large number of BGCs come from species that are not suitable for genetic manipulation or cannot be cultivated (such as some microorganisms). Therefore, efficiently cloning these large fragments of DNA clones is a key step in promoting in-depth mining of genomes and metagenomes.

[0003] At present, for the cloning of large DNA fragments (for example, greater than 10kb), the commonly used cloning methods mainly include the following categories: 1) genomic library; 2) recombinase-based Red / ET and ExoCET systems; 3) Gibson assembly; 4) TAR technology using yeast recombination system; and 5) CRIPR / Cas9-mediated CATCH, etc. (see the table below).

[0004] As a traditional method, genomic library construction and screening are not only complex, time-consuming and laborious, but the target DNA fragments are often scattered on several different clones. When conducting gene function research, it is often necessary to subclone them, delete redundant sequences or stitch them into a complete biosynthetic pathway.

[0005] The principle of Rec / ET cloning technology is that Rac bacteriophage recombination protein, i.e., full-length RecE and RecT, can efficiently mediate homologous recombination (linear recombination) between linear DNA molecules in E. coli cells. Among them, RecE is a 5'-3' nuclease, and RecT is a single-stranded DNA annealing protein. The protein-protein interaction between RecE and RecT is necessary for linear recombination. The linear recombination efficiency of Rec / ET combined is 1000 times that of single action. However, it is difficult to clone DNA fragments larger than 50kb from bacterial genomes, and it is also impossible to clone DNA fragments from mammalian genomes using Rec / ET cloning technology. This is because the Rec / ET cloning technology relies on the RecET recombinase expressed intracellularly. Homologous recombination can only occur when the cloning vector and the target DNA fragment enter an E. coli cell at the same time and meet. This leads to the following limitations of the technology: (1) It is limited by the size of genomic DNA fragments. For example, it is impossible to clone DNA fragments larger than 50 kb from bacterial genomes or clone genomic fragments larger than 10 kb from mammals (such as mice and humans); (2) It is affected by the number of DNA fragments. For multi-fragment assembly, when the number of DNA fragments exceeds 4, the assembly efficiency drops sharply. Currently, the RecET direct cloning technology can only assemble up to 5 DNA fragments.

[0006] Based on the Rec / ET cloning technology, the ExoCET cloning technology was further developed: the genomic DNA and cloning vector were first treated with nuclease exonucleases in vitro, and then the in vitro reaction products were homologously recombined in the presence of RecET recombinase, thereby establishing the ExoCET cloning technology. The ExoCET technology can directly clone DNA fragments >100kb from the bacterial genome, and can clone DNA fragments >50kb from mammalian cells and human blood. The ExoCET technology can also assemble at least 20 DNA fragments to form a complete plasmid. However, since this technology is based on gene recombination for cloning, mismatches will occur for high GC fragments and repetitive sequences.

[0007] With the advancement of synthetic biology technology, large DNA fragments larger than 10 kb can also be assembled from small fragments by Gibson in vitro assembly or DNA assembler in vivo assembly. However, the above DNA assembly requires PCR or chemical synthesis to prepare small fragments, which is easy to introduce random mutations and bring inconvenience to later gene function research. At the same time, the above method has high requirements for the amount of DNA fragments to be assembled, and requires the use of target DNA fragments with relatively high purity and concentration. It cannot be used to assemble the target DNA fragment directly from the mixture of enzymatically hydrolyzed genomic DNA fragments.

[0008] In recent years, with the development of gene editing technology (ZFN (zinc finger protease), TALEN (transcription activator-like effector nucleases) and CRISPR / Cas9, etc.), people have further developed large-fragment DNA cloning technology based on gene editing technology. For example, Larionov et al. combined CRISPR / cas9 technology with yeast transformation-associated recombination (TAR) cloning technology. This method can improve the efficiency of TAR cloning but cannot significantly increase the length of cloned large-fragment DNA. And because the copy number of YAC vectors in yeast is low, it is difficult to separate and purify to obtain sufficient DNA for the next step of cloning and gene editing.

[0009] The recently established CATCH (Cas9-Assisted Targeting of Chromosome Segments) technology uses Cas9 in vitro cleavage and Gibson assembly to clone large DNA fragments into BAC. This method is currently only applied to prokaryotic genomes, and PCR pre-screening of colonies is required before restriction enzyme digestion identification of recombinant DNA. In addition, the in vitro recombination technology combined with CRISPR and Gibson technology can only effectively clone DNA fragments below 100kb.

[0010] In addition, gene editing technology can also be combined with bacterial Red / ET cloning technology to clone large fragments of DNA. For example, Baker et al. transformed the DNA fragments cut by CRISPR and the linear vector into bacteria expressing the lambda phage Red / ET recombination system. The DNA fragments can be assembled into a single recombinant in the bacteria through sequence-dependent enzymatic reactions. However, due to the limitations of the Red / ET cloning technology itself, it is theoretically difficult to obtain a single recombinant of more than 50kb.

[0011] Existing technologies for in vitro cloning of large DNA fragments (taking BGC as an example)

[0012]

[0013]

[0014] BAC: bacterial artificial chromosome; ULCC: upper limit of cloning capacity; BGC: biosynthetic gene cluster; NP: natural product; CATCH: Cas9-assisted chromosomal segment targeting; TAR: transformation-associated recombination; YA: yeast assembly; GA: Gibson assembly; ExoCET: exonuclease-coupled RecET recombination.

[0015] Therefore, for large DNA fragments, especially for samples with high GC content, a simpler and more efficient gene cluster cloning method is still needed.

[0016] With the progress of gene editing technology, CRISPR / Cas12a has gradually been recognized by people. CRISPR / Cas12a is a single RNA-guided (crRNA) endonuclease of the class II CRISPR / Cas system. Unlike Cas9, Cas12a recognizes T-rich protospacer-motif (PAM) instead of Cas9's G-rich PAM, and produces sticky ends, which has broad application prospects. In addition to genome editing applications, CRISPR / Cas12a is also widely used in nucleic acid-based diagnostic applications, small molecule detection, etc. In addition, it is worth noting that CRISPR / Cas12a has obvious advantages in DNA assembly in terms of its programmable endonuclease activity and 4 or 5nt overhanging DNA sticky ends. In 2016, Wang Jing's team took the lead in reporting a modular assembly method C-Brick based on CRISPR / Cas12a DNA sequence, which achieved the assembly and expression of three pigment protein genes; subsequently, a DNA in vitro group transfer method-CCTL was reported to complete the replacement of the promoter of the actinomycete rhodopsin gene cluster and significantly increase its yield. However, there is no in vitro large-fragment DNA cloning technology based on CRISPR / Cas12a to date. Summary of the invention

[0017] In order to solve the above problems, the present invention provides a large fragment DNA cloning method based on CRISPR / Cas12a for cloning large DNA fragments. This method can simply, quickly and efficiently clone large fragment DNA (e.g., >10kb, even >100kb) from a DNA sample (e.g., a genome); more surprisingly, this method is particularly effective for cloning large fragment DNA with a high G+C content (>60%).

[0018] Specifically, the present invention combines the CRISPR / Cas12a system with a cloning vector, and combines the sticky ends generated at or near the ends of the target DNA fragments with the complementary sticky ends formed by the homologous arms at the ends of the target DNA fragments, so that large DNA fragments can be efficiently cloned and the integrity of the large DNA fragments is ensured.

[0019] In a first aspect, the present invention provides an in vitro large-fragment DNA cloning method based on the CRISPR / Cas12a system, the method comprising:

[0020] (1) Construction and cutting of capture vector: preparing homologous arms at both ends of the target DNA fragment, and connecting the homologous arms to the vector to obtain the capture vector, wherein the homologous arms contain at least one PAM site that can be recognized by Cas12a or its biologically active functional fragment or variant; based on the crRNA that is at least partially complementary to the homologous arm, using the Cas12a or its biologically active functional fragment or variant, the capture vector is cut to obtain a cut capture vector;

[0021] (2) Preparation of target DNA fragments: Based on the crRNA and using the Cas12a or its biologically active functional fragment or variant, a sample containing the target DNA fragment is cut to obtain the target DNA fragment; and

[0022] (3) Ligation and transformation: The cut capture vector is linked to the target DNA fragment and transferred / introduced into a host cell to obtain a recombinant host cell having the target DNA fragment.

[0023] In one embodiment, the sample is an isolated nucleic acid sample, such as an isolated DNA sample. As an example, the sample can be a genome and / or a metagenome, or a DNA sample derived from a genome and / or a metagenome (e.g., a DNA library, including a BAC library and a YAC library).

[0024] In some embodiments, the cloning methods described herein are used to clone biosynthetic gene clusters.

[0025] The biosynthetic gene cluster can be predicted by antiSMASH.

[0026] In some embodiments, the present invention provides an in vitro biosynthetic gene cluster (BGC) cloning method based on the CRISPR / Cas12a system, the method comprising:

[0027] (1) BGC prediction: predict BGC through online tools;

[0028] (2) Construction and cutting of capture vector: preparing homology arms at both ends of the BGC, and connecting the homology arms to the vector to obtain the capture vector, wherein the homology arms contain at least one PAM site that can be recognized by Cas12a or its biologically active functional fragment or variant; based on the crRNA that is at least partially complementary to the homology arm, using the Cas12a or its biologically active functional fragment or variant, the capture vector is cut to obtain a cut capture vector;

[0029] (3) Preparation of BGC: Based on the crRNA and using the Cas12a or its biologically active functional fragment or variant, cutting the sample containing the BGC to obtain the BGC; and

[0030] (4) Ligation and transformation: The cleaved capture vector is linked to the BGC and transferred / introduced into a host cell to obtain a recombinant host cell having the BGC.

[0031] In a preferred embodiment, the sample is an actinomycete genome. For example, the sample is a Streptomyces genome.

[0032] In another aspect, the present invention also provides a method for improving the cutting efficiency of the CRISPR / Cas12a system, the method comprising performing in a hydrochloride buffer at a temperature of 35°C-38°C, preferably 37°C, for 40min-120min, preferably 50min-100min, more preferably 60min-80min.

[0033] In addition, the present invention also provides a kit for in vitro large-fragment DNA cloning, the kit comprising a vector, Cas12a or its biologically active functional fragment or variant, or an expression vector expressing the Cas12a or its biologically active functional fragment or variant; and instructions for use.

[0034] In a preferred embodiment, the kit may further comprise a buffer for CRISPR / Cas12a cleavage, wherein the buffer is a hydrochloride buffer having a pH of 7.5-8.0, preferably 7.9.

[0035] The present invention relates to an in vitro large-fragment DNA cloning method, a kit and related uses mediated by the CRISPR / Cas12a system, which has the advantages of being able to quickly clone large-fragment DNA with a high GC content, being simple to operate, not relying on expensive equipment, saving time and cost, having a high positive rate and having the potential for market application.

[0036] Since the cloning method of the present invention can also be used for the genome mining method of biosynthetic gene clusters (BGCs), it is also named CAT-FISHING (CRISPR / Cas12a-mediated fast direct biosynthetic gene cluster cloning platform). This method does not use restriction endonucleases to randomly cut the genome, but uses Cas12 and targeted crRNA to accurately cut the target fragment. In theory, CAT-FISHING will become a simpler and more effective method for direct in vitro cloning of large BGCs with high GC. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The schematic diagram is a working principle diagram of the cloning method according to the present invention. LHA: left homology arm, RHA: right homology arm, BGC: biosynthetic gene cluster.

[0038] Figure 2 Optimization results for the Cas12a enzyme digestion system buffer.

[0039] Figure 3 This is the result of optimizing the reaction time of the Cas12a enzyme cleavage system.

[0040] Figure 4 The optimization result of the molar ratio of PCR product and Cas12a in the Cas12a digestion system is Figure 4 A.

[0041] Figure 5 The figure is a flow chart showing the cloning efficiency according to the cloning method of the present invention and the NEB restriction endonuclease method.

[0042] Figure 6 PCR verification and sequencing of transformants obtained according to the cloning method of the present invention. A. Schematic diagram of PCR screening. B. PCR results of ten randomly selected clones. "-" indicates a blank control, with the genome of Escherichia coli DH10B as a PCR template. C. Schematic diagram of crRNA design and sticky end connection. Using crRNA with an 18nt spacer sequence, Cas12a mainly cuts after the 14th base, producing 8nt sticky ends. D. Sequencing results at the vector-fragment junction.

[0043] Figure 7 The figure shows the comparison of the clone numbers and accuracy rates between the cloning method according to the present invention and the NEB restriction enzyme method.

[0044] Figure 8 This is the optimization result of 50kb-BAC-up / dn-crRNA.

[0045] Fig. 9 Shown are the cloning of large DNA fragments of different lengths from BAC plasmids. A. Illustration of 50kb and 80kb target fragments in BAC plasmids. B. PFGE results of BAC plasmids after CRISPR / Cas12a digestion.

[0046] Fig.10The correct clones containing pBAC2015-50 kb-BAC were screened by PCR. A. Schematic diagram of the pBAC2015-50kb-BAC plasmid junction and PCR products. F1, F2 and F3 are PCR products, which were amplified using 50-BAC-scr-up-F / R, 50-BAC-scr-middle-F / R and BAC-scr-dn-F / R primers, respectively. B, C and D. are PCR amplification results, and 12 random clones were screened for PCR verification in three independent repeated experiments.

[0047] Fig.11 The correct clone containing pBAC2015-80 kb-BAC is screened by PCR. A. Schematic diagram of the crRNA connection end and PCR product of pBAC2015-80kb-BAC plasmid. F1, F2 and F3 are PCR products, amplified with 80-BAC-scr-up-F / R, 80-BAC-scr-middle-F / R and BAC-scr-dn-F / R primers, respectively. B, C and D. are PCR amplification results, and 12 random clones were screened for PCR verification in three independent repeated experiments.

[0048] Fig.12 The results of enzyme digestion verification of the recombinant plasmids are shown. A. pBAC2015-50 kb-BAC enzyme digestion verification results. B. pBAC2015-80kb-BAC enzyme digestion verification results.

[0049] Fig.13 The clone numbers and positive rates of 50 kb and 80 kb target fragments are shown.

[0050] Fig.14 The operation flow of in vitro cloning of a target BGC according to the present invention is shown.

[0051] Fig.15 Restriction enzyme verification of five randomly selected positive clones is shown. A. XhoI digestion map of the recombinant plasmid cloned from the Paulomycin gene cluster. B. SmLI digestion map of the recombinant plasmid cloned from the Surugamides gene cluster. The digestion bands are indicated by arrows. DETAILED DESCRIPTION

[0052] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the content disclosed herein belongs. Although methods and materials similar or identical to the methods and materials described herein can be used in the practice or testing of the content disclosed herein, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In addition, materials, methods and examples are illustrative only and are not intended to be limiting.

[0053] All patents, published patent applications, other publications, and sequences from GenBank and other databases mentioned herein are incorporated by reference in their entirety with respect to related technologies. Unless otherwise noted, the implementation of the provided embodiments will employ conventional techniques of molecular biology, etc., which are within the skill of those skilled in the art. These techniques are fully explained in the literature. See, e.g., Molecular Cloning: A Laboratory Manual, (J. Sambrook et al., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989); Current Protocols in Molecular Biology (F. Ausubel et al., ed., 1987 and latest); Essential Molecular Biology (Brown ed., IRL Press 1991); Gene Expression Technology (Goeddel ed., Academic Press 1991); Methods for Cloning and Analysis of Eukaryotic Genes (Bothwell et al., ed., Bartlett Publ. 1990); Gene Transfer and Expression (Kriegler, Stockton Press 1990); Recombinant DNA Methodology (R. Wu et al., ed., Academic Press 1989); PCR: A Practical Approach (M. McPherson et al., IRL Press at Oxford University Press 1991); Cell Culture for Biochemists (edited by R. Adams, Elsevier Science Publishers 1990).

[0054] For convenience, certain terms employed in the specification, examples, and appended claims are collected here.

[0055] As used herein, the term "target DNA fragment" refers to a target DNA fragment to be cloned, which can be a genomic fragment or an artificially synthesized exogenous fragment, or a complete gene.

[0056] The term "genome" includes naturally occurring genomes and synthetic genomes, and includes genetically modified genomes, such as genomes that did not exist in the laboratory and nature before, including modified genomes and hybrid genomes containing nucleic acids and / or partial genomes from more than one species. The term "genome" includes organelle genomes (such as mitochondrial and chloroplast genomes), genomes (cellular genomes) of self-replicating organisms, including prokaryotes and eukaryotes, fungi, yeasts, bacteria (e.g., mycoplasmas), archaea, vertebrates, mammals and other organisms, and viral genomes and other genomes that rely on host proliferation. Genomes also include those of organisms and synthetic organisms that do not fall into any known Linnaean classification. Exemplary genomes can be microbial genomes, such as genomes of unicellular organisms including bacteria and yeast.

[0057] "Metagenome" (also known as microbial environmental genome Microbial Environmental Genome, or metagenome) refers to the sum of all the genetic materials of microorganisms in the environment. It contains the genes of culturable and unculturable microorganisms, mainly referring to the sum of the genomes of bacteria and fungi in environmental samples.

[0058] In the present invention, the term "large fragment DNA" refers to a DNA molecule with a length of more than 10 kb, for example, a DNA molecule with a length of more than 20 kb, more than 30 kb, more than 40 kb, more than 50 kb, more than 60 kb, more than 70 kb, more than 80 kb, more than 90 kb, more than 100 kb, more than 105 kb, more than 110 kb, more than 115 kb, more than 120 kb, more than 125 kb, more than 130 kb, more than 135 kb, or even more than 140 kb.

[0059] In the present invention, "high GC content" means that the G+C content in the nucleic acid molecule is higher than 60%, for example, above 65%, including above 65%, above 70%, above 75% or above 80%.

[0060] In the present invention, the term "vector" refers to a vector capable of assembling with or inserting foreign fragments, and usually contains a replication origin and nucleic acid sequences of other entities necessary for replication and / or maintenance in host cells.

[0061] The vector can be a circular plasmid or a linear vector, such as but not limited to a host-specific plasmid, a shuttle plasmid, a cosmid, a bacterial artificial chromosome (BAC) or a yeast artificial chromosome (YAC). The vector can also be a cloning vector or an expression vector. As a host-specific plasmid, the vector can be a plasmid that can only be replicated in Escherichia coli, Streptomyces, Bacillus subtilis, Corynebacterium glutamicum, fungi (for example, Saccharomyces cerevisiae, S. pombe, Pichia membranaefaciens), mammalian cells. Or, the carrier can be a shuttle plasmid, such as an Escherichia coli-Saccharomyces cerevisiae shuttle plasmid, an Escherichia coli-Streptomyces shuttle plasmid, an Escherichia coli-Bacillus subtilis shuttle plasmid, an Escherichia coli-Corynebacterium glutamicum shuttle plasmid, a bacteria-mammalian cell shuttle plasmid, a bacteria-plant cell shuttle plasmid, an Escherichia coli-filamentous fungus shuttle plasmid, an Escherichia coli-Streptomyces cerevisiae shuttle plasmid, an Escherichia coli-filamentous fungus-Saccharomyces cerevisiae shuttle plasmid, an Escherichia coli-Bacillus subtilis-Saccharomyces cerevisiae shuttle plasmid, an Escherichia coli-Corynebacterium glutamicum-Saccharomyces cerevisiae shuttle plasmid, a bacteria-mammal-Saccharomyces cerevisiae cell shuttle plasmid or a bacteria-plant cell-Saccharomyces cerevisiae shuttle plasmid. The filamentous fungus is, for example, but not limited to, Aspergillus niger, Aspergillus oryzae, Aspergillus flavus. Or, a bacterial artificial chromosome (BAC) or a yeast artificial chromosome (YAC). In an embodiment of the present invention, the vector may be a vector known in the art. In a preferred embodiment, the vector is capable of accommodating large fragments of DNA, such as pCC2FOS (from EpicentreBio) or pBAC2015 (Wang H et al., Nature Protocols, 2016, 11 (7): 1175-1190.).

[0062] Other forms of expression vectors known to those skilled in the art that serve equivalent functions may also be used, such as self-replicating extrachromosomal vectors or vectors that integrate into the host genome.

[0063] For the purposes of the present invention, "identity" or "homology" is calculated by comparing two aligned sequences in a comparison window. Alignment of the sequences enables the determination of the number of positions (nucleotides or amino acids) shared by the two sequences in the comparison window. The number of shared positions is then divided by the total number of positions in the comparison window and multiplied by 100 to obtain the homology percentage. The determination of the sequence identity percentage can be done manually or using a known computer program.

[0064] The term "complementary" as used herein refers to a hierarchy of hydrogen bond base pairing preferences between the nucleotide bases G, A, T, C and U, such that when two given polynucleotides or polynucleotide sequences are annealed to each other, A pairs with T, G pairs with C in DNA, G pairs with C, and A pairs with U in RNA. "Substantially complementary" as used herein means that a nucleic acid molecule or a portion thereof (e.g., a primer) has at least 90% complementarity with a second nucleotide sequence over the entire length of the molecule or portion thereof, for example, 90% complementary, 95% complementary, 98% complementary, 99% complementary, or 100% complementary.

[0065] As used herein, the term "operably linked" means that the promoter is in the correct functional position and / or orientation relative to the nucleic acid sequence regulated by the promoter (to control the transcription initiation and / or expression of the sequence).

[0066] As used herein, the term "isolated" refers to a nucleic acid or polypeptide that is separated from at least one other component (e.g., nucleic acid or polypeptide) with which it is present in its natural source and / or which it would be present with when expressed by a cell or, in the case of a secreted polypeptide, secreted by a cell. Chemically synthesized nucleic acids or polypeptides or nucleic acids or polypeptides synthesized using in vitro transcription / translation are considered "isolated."

[0067] In the present invention, the terms "left homology arm" and "upstream homology arm" are used interchangeably; the terms "right homology arm" and "downstream homology arm" are used interchangeably.

[0068] Without wishing to be bound by any theory, the large fragment DNA cloning method of the present invention is based on the complementary binding between the sticky ends produced by Cas12a / crRNA, which enables to improve the efficiency of large fragment DNA cloning (i.e., short cloning time and high positive rate), while ensuring the integrity of the target DNA fragment. Even more unexpectedly, for sequences with high GC content (>60%), the method of the present invention shows similar high-efficiency cloning.

[0069] In one aspect, the present invention provides an in vitro large fragment DNA cloning method based on the CRISPR / Cas12a system, the method comprising:

[0070] (1) Construction and cutting of capture vector: preparing homologous arms at both ends of the target DNA fragment, and connecting the homologous arms to the vector to obtain the capture vector, wherein the homologous arms contain at least one PAM site that can be recognized by Cas12a or its biologically active functional fragment or variant; based on the crRNA that is at least partially complementary to the homologous arm, using the Cas12a or its biologically active functional fragment or variant, the capture vector is cut to obtain a cut capture vector;

[0071] (2) Preparation of target DNA fragments: Based on the crRNA and using the Cas12a or its biologically active functional fragment or variant, a sample containing the target DNA fragment is cut to obtain the target DNA fragment; and

[0072] (3) Ligation and transformation: The cut capture vector is linked to the target DNA fragment and transferred / introduced into a host cell to obtain a recombinant host cell having the target DNA fragment.

[0073] In some embodiments, the homology arm is at least 100 bp away from the 5' end or 3' end of the target DNA fragment, preferably at least 200 bp, more preferably at least 500 bp, further preferably at least 1 kb, more preferably at least 1.2 kb, and more preferably at least 1.5 kb. That is to say, taking the upstream homology arm as an example, its 3' end is at least 100 bp away from the 3' end of the target DNA fragment, preferably at least 200 bp, more preferably at least 500 bp, further preferably at least 1 kb, more preferably at least 1.2 kb, and more preferably at least 1.5 kb.

[0074] The selection of homology arms can be considered non-restrictive, and sequences rich in PAM sites (TTTN) can be selected to provide more options for crRNA.

[0075] In a preferred embodiment, the length of the homology arm is 100bp or more. For example, the length of the homology arm is 200bp or more, 300bp or more, 400bp or more, 500bp or more, 600bp or more, 700bp or more, 800bp or more, 900bp or more, 1000bp or more, 1100bp or more, 1200bp or more, 1300bp or more, 1400bp or more, or 1500bp or more. In a preferred embodiment, the length of the homology arm is 800bp-1500bp, preferably 800bp-1200bp, more preferably 900bp-1200bp.

[0076] In some embodiments, the homology arm comprises 1, 2, 3, 4, 5 or more PAM sites that can be recognized by Cas12a or its biologically active functional fragment or variant. Preferably, the homology arm comprises 2 or 3 PAM sites that can be recognized by Cas12a or its biologically active functional fragment or variant.

[0077] In the present invention, the homology arms at both ends of the target DNA fragment may be located inside the target DNA fragment, outside the target DNA fragment, or include the 5' end or 3' end of the target DNA fragment.

[0078] Preferably, the homology arms at both ends of the target DNA fragment are located outside the target DNA fragment.

[0079] In the present invention, one of the purposes of the homology arm is to form a sticky end that can be complementary to the sticky end of the 5' and 3' ends of the target DNA fragment, therefore, the homology arm only needs to include the sequence required for Cas12a enzyme cutting in the sequence of the 5' and 3' ends of the target DNA fragment, wherein, including the sequence bound to the crRNA at least partially complementary (e.g., more than 70%), the PAM sequence and the sequence of Cas12a enzyme cutting, and the sequence between them. It should be noted that when the sticky end of the 5' and / or 3' end of the target DNA fragment is located within the target DNA fragment, the corresponding 5' and / or 3' end homology arm also includes the terminal sequence of the target DNA fragment in addition to the sticky end intended to produce complementary, so that the obtained target DNA fragment is complete.

[0080] The vector for connecting the homology arms can be determined based on the length of the specifically cloned DNA fragment, the host cell used, and subsequent operations (whether to express, etc.). In the present invention, the vector for preparing the capture vector is a circular plasmid or a linear vector. For example, the capture vector is selected from plasmids, cosmids, bacterial artificial chromosomes (BAC) or yeast artificial chromosomes (YAC). In some embodiments, a BAC vector, or a variant thereof, such as a pBAC2015 vector, can be selected. When it is necessary to operate and / or express between different host cells, a specific shuttle vector can be selected.

[0081] The homology arms can be ligated into the vector by techniques known in the art, such as homologous recombination or enzymatic ligation, such as Gibson ligation.

[0082] According to the composition of Cas (CRISPR-associated proteins) genes and the number of subunits of effector proteins, CRISPR / Cas systems are divided into two categories: class 1 CRISPR / Cas systems use multiple effector protein complexes to interfere with target genes; class 2 CRISPR / Cas systems use a single nuclease-nucleic acid complex to cut exogenous nucleic acids to resist foreign invasion. Class 2 systems are simple and efficient, and therefore have received widespread attention. Typical representatives of class 2 CRISPR / Cas systems include Cas9, Cas12a (Cpf1) and Cas13, which have been successfully applied in the fields of DNA editing, gene regulation and small molecule detection.

[0083] The CRISPR / Cas12a system has the following characteristics: (1) The PAM sequence recognized by Cas12a is located at the 5' end of the original spacer sequence and is rich in T, such as 5'-TTTV (V = A, G or C). In addition, Acidaminococcus sp Cas12a (AsCas12a) and Lachnospiraceae bacterium Cas12a (LbCas12a) can also recognize PAM containing cytosine, such as 5'-TCTA, 5'-TCCA and 5'-CCCA. In addition to TTV, Francisella novicida Cas12a (FnCas12a) can also recognize CTV (A / C / G). The designed Cas12a can recognize more PAM sequences, such as 5'-TYCV, 5'-TATV. (2) Cas12a can cut RNA, process pre-crRNA to produce mature crRNA, and use this RNA to cut the target gene without the participation of RNase III. (3) Cas12a only needs one crRNA to achieve the cutting of the target gene, without the need for tracrRNA. (4) After Cas12a cuts dsDNA, it forms a sticky end, which is conducive to DNA insertion. (5) The Cas12a cutting site is far away from the recognition site, providing a larger optional space for the location of gene editing.

[0084] The CRISPR enzyme in the CRISPR / Cas system can interact with the gRNA to form a gRNA-CRISPR enzyme complex, i.e., a CRISPR complex, and can allow the guide sequence to approach the target sequence containing the PAM sequence under the cooperation of the gRNA. For CRISPR / Cas12a, only crRNA guidance is required, without tracrRNA. In the present invention, the terms "gRNA", "guide nucleic acid" and / or "crRNA" are used interchangeably.

[0085] Here, the ability of the Class II CRISPR enzyme to interact with the target gene or nucleic acid depends on the PAM sequence. The PAM sequence is a sequence present in the target gene or nucleic acid that can be recognized by the Class II CRISPR enzyme. The PAM sequence can be changed according to the source of the Class II CRISPR enzyme. That is, depending on the species, there are different PAM sequences that can be specifically recognized. For example, the PAM sequence recognized by the Cas12a enzyme can also be 5'-TTT / N-3' (N is A, T, C or G). However, although it is generally understood that the PAM is determined according to the source of the enzyme as described above, the PAM may change as research progresses on mutants of the enzyme from the source.

[0086] The Cas12a enzyme may be a Cas12a enzyme derived from Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clos tridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium, or Acidaminococcus.

[0087] In the present invention, the biologically active functional fragment or variant of Cas12a refers to a biologically active fragment, variant or fusion protein of a naturally occurring Cas12a polypeptide, comprising an amino acid sequence having at least 80%, 85% and preferably at least 90%, 95%, 97%, 98%, 99% or 100% identity with naturally occurring Cas12a. "Fragment" or "variant" as used herein is understood to include biologically active fragments or biologically active variants showing "biological activity" as described herein. That is, the biologically active fragment or variant of Cas12a exhibits biological activity that can be measured and tested. For example, a biologically active fragment or variant exhibits the same or substantially the same biological activity as a natural (i.e., wild or normal) Cas12a protein, and such biological activity can be evaluated by the fragment or variant, for example, in terms of cutting a target DNA sequence.

[0088] In addition, in addition to the original function of the wild-type CRISPR enzyme (i.e., the function of cutting double-stranded DNA), the variant of the CRISPR enzyme may further include an optional functional domain. Here, the CRISPR enzyme mutant may have additional functions in addition to the original function of the wild-type CRISPR enzyme.

[0089] The functional domain may be a domain having methylase activity, demethylase activity, histone modification activity, RNA cleavage activity or nucleic acid binding activity, or a tag or reporter gene for separating and purifying proteins (including peptides), but the present invention is not limited thereto. Tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags; reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, autofluorescent proteins (including green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and blue fluorescent protein (BFP)), but the present invention is not limited thereto.

[0090] As used herein, crRNA refers to a target DNA-specific RNA that can form a complex with the Cas12a protein and guide the Cas12a protein to the target sequence.

[0091] The crRNA may include a plurality of domains. Each domain may have a three-dimensional form or an active form of the intra-chain or inter-chain interaction of the gRNA. In an embodiment of the present invention, the crRNA includes a spacer sequence, and a binding sequence for the Cas12a protein, for example, the crRNA may be composed of 5'-[Cas12 protein binding sequence]-[spacer sequence]-3', but the present invention is not limited thereto. In a preferred embodiment, there is also a linker sequence between the binding sequence and the spacer sequence, and the length of the linker sequence is 1-15bp, preferably 2-10bp.

[0092] The binding sequence of the Cas12a protein may be a binding sequence of the Cas12a protein contained in a naturally occurring species, may be derived from a binding sequence of the Cas12a protein contained in a naturally occurring species, or may have partial or complete homology with a binding sequence of the Cas12a protein contained in a naturally occurring species. The binding sequence of the Cas12a protein may be a sequence of 16-32, 18-25, more preferably 20-21, most preferably 21 bases, or a sequence comprising 16-32, 18-25, more preferably 20-21, most preferably 21 bases.

[0093] The binding sequence of the Cas12a protein may have partial (i.e., at least 50% or more) or complete homology with the binding sequence of the Cas12a protein of the following bacteria or the binding sequence of the Cas12a protein derived therefrom: Parcubacteriabacterium (GWC2011_GWC2_44_17), Lachnospiraceae bacterium (MC2017), Butyrivibrio proteoclasiicus, Peregrinibacteria bacterium (GW2011_GWA_33_10), Acidaminococcus sp. (BV3L6), Porphyromonas macacae, Lachnospiraceae (ND2006), Porphyromonas crevioricanis, Prevotelladisiens, Moraxella bovoculi (237), Smiihella sp. (SC_KO8D17), Leptospira inadai, Lachnospira (MA2020), Francisella novicida (U112), Candidatus Methanoplasma termitum, or Eubacterium eligens.

[0094] The spacer sequence may be a nucleic acid sequence having complementarity with the target sequence, for example, having at least 70%, 75%, 80%, 85%, 90% or 95% or more (e.g., 100%) complementarity or complete complementarity. The spacer sequence may be a sequence of 15-50, preferably 16-25, more preferably 17-19, most preferably 18 bases, or a sequence comprising 15-50, preferably 16-25, more preferably 17-19, most preferably 18 bases. In a preferred embodiment, the spacer sequence is preferably 17-19, for example, 17, 18 or 19 bases; in a further preferred embodiment, the spacer sequence is preferably 18 bases.

[0095] In one embodiment, the spacer sequence can bind to the target sequence with 0-5 mismatches. For example, the spacer sequence can bind to the target sequence with 0, 1, 2, 3, 4 or 5 mismatches.

[0096] Here, the target sequence may be a base sequence near the PAM sequence of the homology arm. For example, the spacer sequence can at least partially complementarily bind to a continuous 15-50 bp, preferably 16-25 bp, more preferably 17-19 bp target nucleic acid sequence near the PAM in the homology arm. In a specific embodiment, the target sequence may be a continuous sequence of 15-50, preferably 16-25, more preferably 17-19, and most preferably 18 bases at the 3' end or 5' end of the PAM.

[0097] In an embodiment of the present invention, crRNA can be synthesized by in vitro transcription or artificial chemical synthesis. The in vitro transcription synthesis method of crRNA is known in the art. The crRNA primer template for crRNA in vitro reverse transcription may include three parts, a spacer sequence that is reverse complementary to the target gene fragment at the 5' end, a binding sequence for the Cas12a protein in the middle, and a binding sequence for the T7 promoter at the 3' end during in vitro transcription. The selection of the 5' spacer sequence is the key to crRNA design. The guide sequence can be designed with the aid of crRNA design software (e.g., CRISPR RGEN Tools).

[0098] In order to better implement the present invention, crRNA with excellent cleavage effect can be selected based on the PAM on the homology arm.

[0099] In an embodiment of the present invention, the length of the target DNA fragment may be 10 kb or more, for example, 50 kb or more, 60 kb or more, 70 kb or more, 80 kb or more, 90 kb or more, 100 kb or more, 110 kb or more, 120 kb or more, 130 kb or more, or even 140 kb or more. In a further embodiment, the length of the target DNA fragment may be 50 kb-140 kb.

[0100] In the method of the present invention, there is no particular requirement for the GC content of the target DNA fragment. That is, the target DNA fragment may have a GC content of more than 60% (even a high GC content of more than 70%) or more than 60%.

[0101] Since the cutting and connecting operations in the cloning method of the present invention are all performed in vitro, the target DNA fragments targeted by the cloning method of the present invention are not limited to their sources, and can be DNA fragments from prokaryotes or eukaryotes. In some embodiments, they can be DNA fragments existing in a natural state or in a non-natural state, for example, artificially synthesized or modified DNA fragments.

[0102] In some embodiments, the target DNA fragment may be contained in a sample. In some embodiments, the sample may further contain proteins, cells, fluids, biological fluids, protective agents, and / or other substances.

[0103] In some embodiments, the sample is an isolated nucleic acid sample. For example, the isolated nucleic acid sample is an isolated DNA sample.

[0104] In some embodiments, the sample is a genome and / or a metagenome, or a DNA sample derived from a genome and / or a metagenome (eg, a DNA library, including a BAC library and a YAC library).

[0105] By way of non-limiting example, the sample may be a DNA library, genomic DNA, metagenomic DNA, or other artificial DNA, or a combination thereof. In some embodiments, the sample may be a phage-based library (e.g., lambda phage, P1 phage, and fosmid, etc.) and an artificial chromosome library (e.g., a bacterial artificial chromosome (BAS) library, a yeast artificial chromosome (YAC), a P1 artificial chromosome (PAC) library, and a mammalian artificial chromosome (MAC) library, etc.). In some embodiments, the sample may be a genomic library or a cDNA library.

[0106] In some embodiments, the sample can be obtained from mammalian cells, viruses, bacteria, fungi, yeast, protozoa, microorganisms, parasites, etc. In some embodiments, the sample can be a bacterial genome, for example, an actinomycete genome.

[0107] In some embodiments, the sample can be freshly collected. In some embodiments, the sample can be stored before the sample is used in the methods and kits described herein. In some embodiments, the sample is an untreated sample. "Untreated sample" as used herein refers to a biological sample that has not undergone any prior sample pretreatment except dilution in a solution and / or suspension in a solution. In some embodiments, the sample can be obtained from mammalian cells, viruses, bacteria, fungi, yeasts, protozoa, microorganisms, parasites, etc., and can be stored or processed before being used in the methods and kits described herein. By way of non-limiting example, the sample can be embedded in paraffin, refrigerated or frozen. The frozen sample can be thawed before the nucleic acid is processed according to the methods and kits described herein. In some embodiments, the sample can be a processed or treated sample. Exemplary methods for processing or processing samples include, but are not limited to, centrifugation, filtration, ultrasound, homogenization, heating, freezing and thawing, contact with a protective agent (e.g., a nuclease inhibitor), and any combination of the above methods. In some embodiments, the sample can be processed with chemical reagents and / or biological reagents. Chemical reagents and / or biological reagents can be used to protect and / or maintain the stability of samples or nucleic acids contained in samples during processing and / or storage. Alternatively or additionally, chemical reagents and / or biological reagents can be used to release nucleic acids from other components of the sample. Sample processing, preservation or treatment methods and processes for nucleic acid processing and / or analysis are well known to those skilled in the art.

[0108] In some embodiments, nucleic acids present in a sample may be separated, enriched or purified prior to use in the methods and kits described herein. Methods for separating, enriching or purifying nucleic acids from a sample are well known to those of ordinary skill in the art. By way of non-limiting example, kits for separating genomic DNA from various sample types are commercially available (e.g., catalog numbers 51104, 51304, 56504, and 56404; Qiagen; Germantown, MD).

[0109] In some embodiments, before or during the operation of the sample by the method and kit according to the present invention, the DNA sample can be embedded in low melting point agarose. By using low melting point agarose to embed DNA, mechanical shearing of large fragment DNA sequences can be avoided.

[0110] In a preferred embodiment, the bacterial genomic DNA is separated by the following method: embedding the bacterial body whose genome is to be extracted with low melting point agarose; then, treating the embedded bacterial body with lysozyme and proteinase K.

[0111] In a preferred embodiment, the bacterial cell from which the genome is to be extracted is a freshly cultured bacterial cell. In a preferred embodiment, when the bacterium is Streptomyces, the bacterial cell is a mycelium cultured aerobically at 30°C for 24h-30h.

[0112] In a preferred embodiment, the amount of bacteria in each embedding block is 4-5 mg, and the lysozyme lysis takes 1-2 hours, which can shorten the proteinase K digestion time to 2 hours.

[0113] In an embodiment of the present invention, the sequence information of the target DNA fragment may be known or unknown. In an optional embodiment, the sequences at both ends of the target DNA are known, or can be inferred from known sequence information of species that are closely related to the target DNA. For example, the DNA sample containing the target DNA has complete sequencing information, or has partial sequencing information.

[0114] In step (1), before cutting the capture vector, the method further includes the steps of screening and separating the capture vector.

[0115] For the purpose of screening, a selection marker can be introduced into a capture vector with homology arms. The selection marker is selected from, without limitation, a resistance selection marker, a reverse screening gene (e.g., sacB gene), a lacZ selection system reporter gene, etc. Resistance markers are well known. The technician can determine suitable resistance markers for different host / donor combinations. In some embodiments, the selection marker is located between the homology arms, or the selection marker can be located on a carrier. In a preferred embodiment, the selection marker can be lacZ. In one embodiment, the lacZ can be located between the 5' and 3' end homology arms.

[0116] Furthermore, separation of a plurality of capture vectors can be performed using techniques known in the art.

[0117] In an embodiment of the present invention, the Cas12a / crRNA enzyme cleavage system comprises Cas12a protein and crRNA and optionally an appropriate enzyme cleavage buffer.

[0118] The Cas12a enzyme used in the present invention or its biologically active functional fragment or variant can be obtained commercially, or can be prepared by a protein purification method known in the art. For the present invention, it is preferred that the Cas12a enzyme or its biologically active functional fragment or variant has the function of cutting double-stranded DNA of the Cas12a enzyme. Preferably, Cas12a can be LbCas12a.

[0119] In the present invention, the buffer for the Cas12a / crRNA enzyme digestion system has a pH value of 7.5-8.0, such as pH 7.9. The buffer is preferably a hydrochloride buffer. For example, the hydrochloride buffer is a hydrochloride buffer containing NaCl and / or Tris-HCl. The buffer for the Cas12a / crRNA enzyme digestion system may include Tris acid, sodium salt and magnesium salt. In a preferred embodiment, the buffer comprises Tris-HCl, NaCl and MgCl2. In a further preferred embodiment, the buffer comprises 10mM to 50mM Tris-HCl, 50mM to 100mM NaCl and 10mM MgCl2. In some embodiments, the buffer for the Cas12a / crRNA enzyme digestion system further comprises bovine serum albumin. In a preferred embodiment, the buffer for the Cas12a / crRNA enzyme digestion system comprises 100mM NaCl, 50mM Tris-HCl, 10mM MgCl2 and 100μg / mL bovine serum albumin, and its pH value is 7.9.

[0120] In the present invention, the buffer for Cas12a / crRNA digestion system can use commercially available products, or it can be configured according to known schemes. In a preferred embodiment, the buffer for Cas12a / crRNA digestion system can be a commercially available product, for example, NEBuffer 3.1.

[0121] The Cas12a / crRNA cleavage can be performed at 35°C-38°C, preferably 37°C.

[0122] Wherein, the mol ratio of DNA to be cut and Cas12a can be more than 1:25, for example, more than 1:50, more than 1:100, more than 1:200, more than 1:1000, more than 1:2000, more than 1:3000, more than 1:5000, more than 1:10000 or more than 1:20000. For better cutting effect, when the target fragment is longer, the amount of Cas12a can be appropriately increased. For example, for PCR fragments or capture plasmids or simple samples (such as carriers containing target DNA fragments <10kb), the mol ratio of DNA to be cut and Cas12a can be more than 1:25, preferably 1:50, 1:100 or 1:200. For genomic samples or vector samples containing a target fragment of more than 10 kb (e.g., more than 20 kb, more than 50 kb, more than 60 kb, more than 70 kb, more than 80 kb, etc.), the molar ratio of DNA to be cut to Cas12a may be 1:1000 or more, for example, more than 1:2000, more than 1:5000, more than 1:10000 or 1:20000.

[0123] In an embodiment of the present invention, the enzyme digestion is performed for 40 min to 180 min, depending on the different DNA to be digested. In a preferred embodiment, when a PCR fragment or a captured plasmid or a simple sample (e.g., a vector containing a target DNA fragment <10 kb) is cut, the enzyme digestion is performed for 40 min to 120 min. When a sample or a vector sample with a target fragment of more than 10 kb (e.g., more than 20 kb, more than 50 kb, more than 60 kb, more than 70 kb, more than 80 kb, etc.) is cut, the enzyme digestion is performed for 80 min to 180 min.

[0124] After the enzyme cleavage is completed, Cas12a can be inactivated. In a preferred embodiment, Cas12a is inactivated by heat treatment (e.g., above 65°C). In a preferred embodiment, Cas12a is inactivated by a cationic chelator (e.g., EDTA).

[0125] In a preferred embodiment, Cas12a is used to digest the capture vector at 37°C for 60 min, wherein the buffer used for the Cas12a / crRNA digestion system is a hydrochloride buffer with a pH of 7.9; the molar ratio of the capture vector to Cas12a is 1:25; after the digestion is completed, Cas12a is inactivated by heat treatment at 85°C for 10 min.

[0126] In a preferred embodiment, Cas12a is used to perform enzyme digestion on a sample containing a target DNA fragment at 37°C for 60 min, wherein the buffer used for the Cas12a / crRNA enzyme digestion system is a hydrochloride buffer with a pH of 7.9; the molar ratio of the sample to Cas12a is 1:200; after the enzyme digestion is completed, LbCas12a is inactivated by heat treatment at 85°C for 10 min.

[0127] In a preferred embodiment, Cas12a is used to perform enzyme digestion on a sample containing a target DNA fragment at 37 ° C for 120 min, wherein the buffer used for the Cas12a / crRNA enzyme digestion system is a hydrochloride buffer with a pH of 7.9; the molar ratio of the sample containing the target DNA fragment to Cas12a is 1:20000; after the enzyme digestion is completed, LbCas12a is inactivated by heat treatment at 85 ° C for 10 min.

[0128] In a preferred embodiment, the genome is digested with Cas12a at 37 ° C for 120 min, wherein the genome is embedded in low melting point agarose; the buffer used for the Cas12a / crRNA digestion system is a hydrochloride buffer with a pH of 7.9; the molar ratio of the J1074 genome to Cas12a is 1:20000; after the digestion is completed, LbCas12a is inactivated by heat treatment at 85 ° C for 10 min.

[0129] In the present invention, the ligation of the cleaved target DNA fragment and the cleaved vector with homology arms is performed by a ligase, any ligase used for sticky end ligation. In some embodiments, the ligase is selected from T4 DNA ligase and Taq ligase.

[0130] In a preferred embodiment, the target DNA fragment and the vector with homology arms are mixed at a molar ratio of 1:2-2:1 for ligation. In a further preferred embodiment, the target DNA fragment and the vector with homology arms are mixed at a molar ratio of 2:1 to 1:1 for ligation. For the genome, without isolating the target DNA fragment, it is estimated that the molar ratio of the target DNA fragment and the vector with homology arms is 1:(5-10).

[0131] In the case of using a low melting point agarose embedding block (wherein the amount of the low melting point agarose is 1wt%-2wt%), before step (3), a step of digesting the low melting point agarose embedding block is included.

[0132] When the ligase is T4 DNA ligase, the ligation can be performed at 4°C to 25°C, preferably 16°C; the ligation can be performed for 1 to 12 hours.

[0133] After ligation is complete, the ligase can be inactivated by heat treatment (eg, 65°C).

[0134] The host cells used in the present invention can be obtained commercially or prepared by methods known in the art. The ligation product can be transferred into the host cell and screened and verified by a scheme known in the art. The host cell can be selected as needed, for example, commercial Escherichia coli, yeast cells, etc.

[0135] In a preferred embodiment, the electroporation competent cell is Escherichia coli DH10b, which is characterized in that the sequence genes related to recombination are knocked out in the strain, which is conducive to maintaining the stability of the clone.

[0136] The technology of screening and obtaining transformants with cloning vectors is known to those skilled in the art. For cloning vectors without screening markers, single or multiple PCR for amplifying one or more target fragments can be used to detect transformants, thereby screening transformants of cloning vectors containing target DNA fragments.

[0137] The in vitro large-fragment DNA cloning method based on the CRISPR / Cas12a system provided by the present invention can efficiently realize the cloning of gene clusters. In the present invention, the gene clusters and their ranges are new gene clusters predicted by online tools such as antiSMASH, and then these gene clusters are cloned by the method of the present invention and then heterologously expressed.

[0138] In another aspect, the present invention provides a kit for cloning large fragments of DNA by the above method, wherein the kit may comprise a vector, Cas12a or a biologically active variant thereof, or an expression vector expressing the Cas12a or a biologically active variant thereof; and instructions for use.

[0139] In a preferred embodiment, the kit further comprises a reagent for isolating a genome, a Cas12a nuclease cleavage buffer, a crRNA in vitro transcription reagent, a host cell, or any combination thereof.

[0140] The present invention relates to an in vitro large-fragment DNA cloning method, a kit and related uses mediated by the CRISPR / Cas12a system, which has the advantages of being able to quickly clone large-fragment DNA with a high GC content, being simple to operate, not relying on expensive equipment, saving time and cost, having a high positive rate and having the potential for market application.

[0141] Implementation of the various aspects described herein may be described by the following numbered paragraphs:

[0142] [1]. An in vitro large-fragment DNA cloning method based on the CRISPR / Cas12a system, the method comprising:

[0143] (1) Construction and cutting of capture vector: preparing homologous arms at both ends of the target DNA fragment, and connecting the homologous arms to the vector to obtain the capture vector, wherein the homologous arms contain at least one PAM site that can be recognized by Cas12a or its biologically active functional fragment or variant; based on the crRNA that is at least partially complementary to the homologous arm, using the Cas12a or its biologically active functional fragment or variant, the capture vector is cut to obtain a cut capture vector;

[0144] (2) Preparation of target DNA fragments: Based on the crRNA and using the Cas12a or its biologically active functional fragment or variant, a sample containing the target DNA fragment is cut to obtain the target DNA fragment; and

[0145] (3) Ligation and transformation: The cut capture vector is linked to the target DNA fragment and transferred / introduced into a host cell to obtain a recombinant host cell having the target DNA fragment.

[0146] [2] The method according to paragraph [1], wherein the sample is an isolated nucleic acid sample.

[0147] [3] The method according to paragraph [2], wherein the isolated nucleic acid sample is an isolated DNA sample.

[0148] [4] The method according to any one of paragraphs [1] to [3], wherein the sample is a genome and / or a metagenome, or a DNA sample derived from a genome and / or a metagenome.

[0149] [5] The method according to paragraph [4], wherein the DNA sample derived from the genome and / or metagenome is a DNA library, including a BAC library and a YAC library.

[0150] [6]. The method according to any one of paragraphs [1] to [5], wherein the homologous arms at both ends of the target DNA fragment are located within the target DNA fragment, outside the target DNA fragment, or include the 5' end or 3' end of the target DNA fragment.

[0151] [7]. The method according to paragraph [6], wherein the homology arms at both ends of the target DNA fragment are located outside the target DNA fragment.

[0152] [8]. The method according to paragraph [7], wherein the homology arm is at least 100 bp away from the 5' end or the 3' end of the target DNA fragment, preferably at least 200 bp, more preferably at least 500 bp, further preferably at least 1 kb, more preferably at least 1.2 kb, and more preferably at least 1.5 kb.

[0153] [9]. The method according to any one of paragraphs [1]-[7], wherein the length of the homology arm is greater than 100 bp.

[0154]

[10] . The method according to paragraph [9], wherein the length of the homology arm is greater than 200 bp, greater than 300 bp, greater than 400 bp, greater than 500 bp, greater than 600 bp, greater than 700 bp, greater than 800 bp, greater than 900 bp, greater than 1000 bp, greater than 1100 bp, greater than 1200 bp, greater than 1300 bp, greater than 1400 bp, or greater than 1500 bp.

[0155]

[11] . The method according to paragraph [9], wherein the length of the homology arm is 800bp-1500bp, preferably 800bp-1200bp, and more preferably 900bp-1200bp.

[0156]

[12] . A method according to any one of paragraphs [1]-

[11] , wherein the homology arm comprises 1, 2, 3, 4, 5 or more PAM sites that can be recognized by Cas12a or its biologically active functional fragment or variant.

[0157]

[13] The method according to any one of paragraphs [1] to

[12] , wherein the vector used to prepare the capture vector is a circular plasmid or a linear vector.

[0158]

[14] The method according to any one of paragraphs [1]-

[13] , wherein the capture vector is selected from a plasmid, a cosmid, a bacterial artificial chromosome (BAC) or a yeast artificial chromosome (YAC).

[0159]

[15] . The method according to any one of paragraphs [1] to

[14] , wherein the homology arms are ligated into the vector by homologous recombination or enzyme ligation.

[0160]

[16] The method according to any one of paragraphs [1]-

[15] , wherein in step (1), before cutting the capture vector, it also includes the step of screening and separating the capture vector.

[0161]

[17] . The method of any one of paragraphs [1]-

[16] , wherein the capture vector comprises a selectable marker.

[0162]

[18] . The method according to paragraph

[17] , wherein the selection marker is a drug resistance selection marker, a counter-selection gene or a lacZ selection system.

[0163]

[19] . The method according to paragraph

[17] , wherein the selection marker is operably linked between the homology arms.

[0164]

[20] . A method according to any one of paragraphs [1]-

[19] , wherein the crRNA comprises a spacer sequence and a binding sequence, wherein the spacer sequence is capable of at least partially complementary binding to the homology arm, and the binding sequence is capable of binding to the Cas12a or its biologically active functional fragment or variant.

[0165]

[21] . The method according to paragraph

[20] , wherein the spacer sequence is capable of at least partially complementary binding to a continuous 15-50 bp, preferably 16-25 bp, more preferably 17-19 bp target nucleic acid sequence near the PAM in the homology arm.

[0166]

[22] . The method according to paragraph

[21] , wherein the spacer sequence has at least 70% complementarity with the target nucleic acid sequence, preferably at least 80%, more preferably at least 90%, further preferably at least 95%, and most preferably 100%.

[0167]

[23] . The method according to any one of paragraphs

[20] -

[22] , wherein the length of the spacer sequence is 15-50 nt, preferably 16-25 nt, more preferably 17-19 nt, and most preferably 18 nt.

[0168]

[24] The method according to paragraph

[20] , wherein the length of the binding sequence is 16-32 bp, preferably 18-25 bp, more preferably 20-21 bp, and most preferably 21 bp.

[0169]

[25] The method according to any one of paragraphs

[20] -

[24] , wherein the crRNA is 5'-[binding sequence]-[spacer sequence]-3'.

[0170]

[26] . The method according to any one of paragraphs

[20] -

[25] , wherein there is a linker sequence between the binding sequence and the spacer sequence, and the length of the linker sequence is 1-15 bp, preferably 2-10 bp.

[0171]

[27] . A method according to any one of paragraphs [1] to

[26] , wherein in step (1), the cutting is carried out at a temperature of 35°C-38°C, preferably 37°C, for 40 min-120 min, preferably 50 min-100 min, more preferably 60 min-80 min.

[0172]

[28] . A method according to any one of paragraphs [1] to

[27] , wherein in step (1), the molar ratio of the Cas12a or its biologically active functional fragment or variant to the capture carrier is 50:1 or more, preferably 80:1 or more, more preferably 100:1 or more, further preferably 150:1 or more, and even more preferably 200:1 or more.

[0173]

[29] . The method according to any one of paragraphs [1] to

[28] , wherein in step (1), the molar ratio of the Cas12a or its biologically active functional fragment or variant to the crRNA is 1:1 or more, preferably 2:1 or more, more preferably 4:1 or more, further preferably 8:1 or more, and even more preferably 10:1 or more.

[0174]

[30] A method according to any one of paragraphs [1] to

[29] , wherein, before the cutting step in step (1), a step of screening the crRNA is also included.

[0175]

[31] . A method according to any one of paragraphs [1] to

[29] , wherein in step (1), it also includes a step of inactivating the Cas12a or its biologically active functional fragment or variant; and / or a step of separating the cut capture vector.

[0176]

[32] The method according to paragraph

[31] , wherein the Cas12a or its biologically active functional fragment or variant is inactivated by heating to above 65°C, preferably above 75°C, and more preferably above 85°C.

[0177]

[33] The method according to paragraph

[32] , wherein the heating is carried out for more than 10 minutes.

[0178]

[34] . A method according to any one of paragraphs [1] to

[33] , wherein, in step (2), when the sample is a genome or a metagenome, the sample is provided in the form of a low melting point agarose embedding block.

[0179]

[35] The method according to paragraph

[34] , wherein the size of the low melting point agarose embedding block is preferably 50-150 μL.

[0180]

[36] The method described in paragraph

[34] or

[35] , wherein the genome or metagenome provided in the form of a low-melting point agarose embedding block is a bacterial genome or metagenome provided by the following method: embedding the bacterial cells from which the genome is to be extracted with low-melting point agarose to form a low-melting point agarose embedding block; then, treating the embedded bacterial cells with lysozyme and proteinase K.

[0181]

[37] The method according to paragraph

[36] , wherein the low melting point agarose embedding block preferably contains 4 mg to 5 mg of the bacterial cells.

[0182]

[38] The method according to paragraph

[36] or

[37] , wherein the low melting point agarose embedding block is lysed with lysozyme for 1 to 2 hours.

[0183]

[39] The method according to paragraph

[36] or

[37] , wherein the low melting point agarose embedding block is digested with proteinase K for 2 to 6 hours until the embedding block is completely transparent.

[0184]

[40] . A method according to any one of paragraphs [1] to

[39] , wherein in step (2), the cutting is carried out at a temperature of 35°C-38°C, preferably 37°C, for 80 min-180 min, preferably 100 min-160 min, more preferably 100 min-140 min.

[0185]

[41] . The method according to any one of paragraphs [1] to

[40] , wherein in step (2), the molar ratio of the Cas12a or its biologically active functional fragment or variant to the target DNA fragment is greater than 2000, preferably greater than 5000, more preferably greater than 10000, and further preferably greater than 20000.

[0186]

[42] . A method according to any one of paragraphs [1] to

[41] , wherein in step (2), it also includes a step of inactivating the Cas12a or its biologically active functional fragment or variant; and / or a step of separating the cut target DNA fragment.

[0187]

[43] A method according to any one of paragraphs [1] to

[41] , wherein when the sample is a genome or a metagenome, there is no need to separate and purify the target DNA fragments after cutting.

[0188]

[44] . A method according to any one of paragraphs [1] to

[43] , wherein in step (1) and step (2), the cleavage is carried out in a buffer having a pH of 7.5-8.0, preferably a pH of 7.9.

[0189]

[45] The method according to paragraph

[44] , wherein the buffer is a hydrochloride buffer.

[0190]

[46] The method according to paragraph

[45] , wherein the buffer comprises 10 mM to 50 mM Tris-HCl and 50 mM to 100 mM NaCl.

[0191]

[47] . The method according to any one of paragraphs

[44] -

[46] , wherein the buffer comprises 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2 and 100 μg / mL bovine serum albumin.

[0192]

[48] ​​The method according to any one of paragraphs [1] to

[47] , wherein in step (3), T4 DNA ligase and Taq ligase are used for ligation.

[0193]

[49] . The method according to any one of paragraphs [1]-

[48] , wherein in step (3), the target DNA fragment and the capture vector are mixed in a molar ratio of 2:1 to 1:10 for ligation.

[0194]

[50] A method according to any one of paragraphs [1] to

[49] , wherein, in the case of using a low-melting point agarose embedding block, prior to step (3), a step of digesting the low-melting point agarose embedding block is included.

[0195]

[51] . A method according to any one of paragraphs [1] to

[50] , wherein in step (3), when the enzyme is T4 DNA ligase, the ligation is carried out at a temperature of 4°C-25°C, preferably 16°C, for 1-12 hours.

[0196]

[52] A method according to any one of paragraphs [1] to

[51] , wherein in step (3), the ligation product is transferred into the host cell by electroporation.

[0197]

[53] The method according to paragraph

[52] , wherein the ligation product is desalted before electro-transformation.

[0198]

[54] The method according to any one of paragraphs [1]-

[53] , wherein the host cell is selected from Escherichia coli or yeast.

[0199]

[55] . A method according to any one of paragraphs [1]-

[54] , wherein the length of the target DNA fragment is greater than 10 kb.

[0200]

[56] . The method according to paragraph

[55] , wherein the length of the target DNA fragment is greater than 50 kb, greater than 60 kb, greater than 70 kb, greater than 80 kb, greater than 90 kb, greater than 100 kb, greater than 110 kb, greater than 120 kb, greater than 130 kb or even greater than 140 kb.

[0201]

[57] . The method according to paragraph

[55] , wherein the length of the target DNA fragment is 10kb-140kb, preferably 50kb-140kb, more preferably 50kb-100kb, and further preferably 50kb-90kb.

[0202]

[58] A method according to any one of paragraphs [1]-

[57] , wherein the sample is an actinomycete genome.

[0203]

[59] The method according to paragraph

[58] , wherein the sample is a Streptomyces genome.

[0204]

[60] A method according to any one of paragraphs [1]-

[59] , used to clone a biosynthetic gene cluster.

[0205]

[61] . The method according to paragraph

[60] , wherein the biosynthetic gene cluster is predicted by antiSMASH.

[0206]

[62] . A method for cloning an in vitro biosynthetic gene cluster (BGC) based on a CRISPR / Cas12a system, the method comprising:

[0207] (1) BGC prediction: predict BGC through online tools;

[0208] (2) Construction and cutting of capture vector: preparing homology arms at both ends of the BGC, and connecting the homology arms to the vector to obtain the capture vector, wherein the homology arms contain at least one PAM site that can be recognized by Cas12a or its biologically active functional fragment or variant; based on the crRNA that is at least partially complementary to the homology arm, using the Cas12a or its biologically active functional fragment or variant, the capture vector is cut to obtain a cut capture vector;

[0209] (3) Preparation of BGC: Based on the crRNA and using the Cas12a or its biologically active functional fragment or variant, cutting the sample containing the BGC to obtain the BGC; and

[0210] (4) Ligation and transformation: The cleaved capture vector is linked to the BGC and transferred / introduced into a host cell to obtain a recombinant host cell having the BGC.

[0211]

[63] The method according to paragraph

[62] , wherein the sample is an actinomycete genome.

[0212]

[64] The method according to paragraph

[63] , wherein the sample is a Streptomyces genome.

[0213]

[65] . A method for improving the cleavage efficiency of a CRISPR / Cas12a system, the method comprising performing the cleavage in a hydrochloride buffer at a temperature of 35°C-38°C, preferably 37°C, for 40 min-120 min, preferably 50 min-100 min, more preferably 60 min-80 min.

[0214]

[66] . The method according to paragraph

[65] , wherein the molar ratio of Cas12a enzyme to the fragment to be cleaved is 50:1 or more, preferably 80:1 or more, more preferably 100:1 or more, further preferably 150:1 or more, and even more preferably 200:1 or more.

[0215]

[67] The method according to paragraph

[65] or

[66] , wherein the hydrochloride buffer contains sodium hydrochloride, magnesium hydrochloride and / or Tris-HCl.

[0216]

[68] A method according to any one of paragraphs

[65] to

[67] , wherein the pH of the buffer is 7.5-8.0, preferably 7.9.

[0217]

[69] The kit according to paragraph

[68] , wherein the buffer comprises 10 mM to 50 mM Tris-HCl and 50 mM to 100 mM NaCl.

[0218]

[70] A kit according to any one of paragraphs

[65] to

[69] , wherein the buffer comprises 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2 and 100 μg / mL bovine serum albumin.

[0219]

[71] . A kit for in vitro large-fragment DNA cloning, the kit comprising a vector, Cas12a or its biologically active functional fragment or variant, or an expression vector expressing the Cas12a or its biologically active functional fragment or variant; and instructions for use.

[0220]

[72] A kit according to paragraph

[71] , wherein the kit further comprises a buffer for CRISPR / Cas12a cleavage, wherein the buffer is a hydrochloride buffer having a pH of 7.5-8.0, preferably 7.9.

[0221]

[73] The kit according to paragraph

[72] , wherein the buffer comprises 10 mM to 50 mM Tris-HCl and 50 mM to 100 mM NaCl.

[0222]

[74] A kit according to any one of paragraphs

[72] -

[73] , wherein the buffer comprises 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2 and 100 μg / mL bovine serum albumin.

[0223] Example

[0224] The present invention is further described below in conjunction with the examples and drawings, but the present invention is not limited by the following examples. It should be understood by those skilled in the art that the equivalent replacements made to the technical features of the present application, or corresponding improvements, still belong to the protection scope of the present application. Unless otherwise specified, the reagents used in the following examples are all commercially available products, and the preparation of the solutions can adopt conventional techniques in the art.

[0225] In the following examples, the crRNA used was prepared in the following manner:

[0226] Based on the desired crRNA sequence, an oligonucleotide was synthesized as a crRNA transcription template (the 5' end had a spacer sequence that was reverse complementary to the target gene fragment, the middle was a collection sequence of Cas12a protein, and the 3' end was a binding sequence for the T7 promoter during in vitro transcription), and annealed using Taq DNA polymerase PCR buffer (Thermo Fisher Scientific); HiScribe TM T7 Rapid High Yield RNA Synthesis Kit (NEB) was used for in vitro transcription of crRNA; RNA Clean&Concentrator was used TM The crRNA was purified using the ELISA kit (Zymo Research) and quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). RNase-free materials (Axygen Scientific, Union City, CA, USA) were used throughout the experiment.

[0227] In the following examples, the homology arm fragments and the vector were assembled into a capture vector by Ezmax assembly, and the molar ratio of the vector to the fragments was generally 1:2.

[0228] The plasmids constructed by the present invention and the preparation methods thereof involved in the examples are as follows:

[0229] BAC plasmid pBAC-ZL: With BAC plasmid as the backbone, the size is 137 kb, and there is an insert sequence of 128 kb, which exists in DDBJ / EMBL / GenBank, accession number: AEYC00000000.

[0230] The capture plasmid (pBAC2015-C50) for cloning 50 kb from pBAC-ZL uses pBAC2015 as the backbone, and the upstream and downstream homology arm sequences are respectively 50 kb-BAC-arm-up-F and 50 kb-BAC-arm-up-R (SEQ ID NO: 1-SEQ ID NO: 2, the sequence of the upstream homology arm 50 kb-BAC-arm-up is SEQ ID NO: 3, 990 bp) and BAC-arm-dn-F and BAC-arm-dn-R (SEQ ID NO: 4-SEQ ID NO: 5, the sequence of the downstream homology arm 50 kb-BAC-arm-dn is SEQ ID NO: 6, 228 bp), and there is a LacZ selection marker between the upstream and downstream homology arms (the nucleic acid sequence of which is shown in SEQ ID NO: 7, 620 bp, and the upstream and downstream primers are respectively BAC-lacZ-F (SEQ ID NO: 8) and BAC-lacZ-R (SEQ ID NO: 9). NO:9)).

[0231] The capture plasmid (pBAC2015-C80) used to clone 80kb from pBAC-ZL uses pBAC2015 as the backbone, and the upstream and downstream homology arm sequences are respectively 80kb-BAC-arm-up-F and 80kb-BAC-arm-up-R (SEQ ID NO: 10-SEQ ID NO: 11, the sequence of the upstream homology arm 80kb-BAC-arm-up is SEQ ID NO: 12, 880bp) and BAC-arm-dn-F and BAC-arm-dn-R (SEQ ID NO: 4-SEQ ID NO: 5, the sequence of the downstream homology arm 80kb-BAC-arm-dn is SEQ ID NO: 6, 228bp), and there is a LacZ selection marker between the upstream and downstream homology arms (its nucleic acid sequence is shown in SEQ ID NO: 7, 620bp).

[0232] Example 1. Optimization of Cas12a cutting

[0233] 1-1. Buffer for Cas12a cleavage

[0234] Buffer is an important factor affecting the efficiency of enzyme cutting. Under the premise that other conditions remain unchanged, different buffer solutions have different pH, ionic strength, etc., and the Cas12a cutting efficiency varies significantly.

[0235] Cas12a protein was prepared as follows: LbCas12a protein was overexpressed in pET28a and then purified by fast protein liquid chromatography (FPLC; AKTAExplorer 100, GE Healthcare), as described in Liang, Mindong et al., "ACRISPR-Cas12a-derived biosensing platform for the highly sensitive detection of diverse small molecules." Nature communications vol.10, 1 3672.14Aug.2019, doi:10.1038 / s41467-019-11648-1.

[0236] The DNA fragment for Cas12a cleavage was prepared as follows: using the capture plasmid pBAC2015-C50 as a template, and using the forward primer (50kb-BAC-arm-up-F, SEQ ID No: 1) and the reverse primer (BAC-lacZ-R, SEQ ID NO: 9) as primers for PCR to obtain a test fragment 1 (i.e., upstream homology arm + lacZ) with a length of 1610 bp.

[0237] The sequence of the crRNA used for cutting test fragment 1 (50kb-BAC-up-crRNA, also referred to as test fragment 1-crRNA) is shown in SEQ ID No: 13.

[0238] Different buffers purchased from New England Biolabs (NEB) were used: cutsmart buffer (B7204S), NEBuffer 2.1 (B7202S), NEBuffer 3.1 (B7203S), and NEBuffer 4 (B7004S).

[0239] Among them, NEBuffer 2.1 and NEBuffer 3.1 are hydrochloric acid buffers, and the difference between the two lies in the salt ion concentration. The components of the medium-salt buffer NEBuffer2.1 (pH 7.9) are 50mM sodium chloride, 10mM Tris-hydrochloric acid, 10mM magnesium chloride, and 100μg / mL bovine serum albumin; the components of the high-salt buffer NEBuffer 3.1 (pH 7.9) are 100mM sodium chloride, 50mM Tris-hydrochloric acid, 10mM magnesium chloride, and 100μg / mL bovine serum albumin. NEBuffer 4 and CutSmart Buffer are both acetate buffers. The components of NEBuffer 4 (pH 7.9) are 50mM potassium acetate, 20mM Tris-acetic acid, 10mM magnesium acetate, and 1mM dithiothreitol. CutSmart Buffer is an upgraded version of NEBuffer 4, which no longer contains dithiothreitol and has added bovine serum albumin.

[0240] As the enzyme digestion buffer, an enzyme digestion system was added. The enzyme digestion system is shown in the following table. Each enzyme digestion system was reacted at 37° C. for 1 h.

[0241] Table 1

[0242] Reagents System (μL) 1 Buffer 5 2 Cas12a (10 μM) 3.2 3 Test fragment 1-crRNA (10μM) 3.2 4 Test snippet 1 1 μg 5 <![CDATA[H2O]]> To50

[0243] The results of enzyme digestion were analyzed by nucleic acid electrophoresis, wherein the 1 kb test fragment 1 without enzyme digestion was used as a control. The results are as follows Figure 2 As shown; Among them, Cas12a has higher cleavage activity in hydrochloric acid buffer NEBuffer 2.1 and NEBuffer 3.1, and Cas12a has the best cleavage efficiency in NEBuffer 3.1, and the target fragment is almost completely cleaved. However, the activity is poor in NEBuffer4 and CutSmart Buffer, and there are obvious uncut target fragments in the gel image. It can be seen that for Cas12a cleavage, it has better activity in high-salt hydrochloride buffer.

[0244] 1-2. Cutting time

[0245] Similarly, the reaction time in the enzyme cleavage system is one of the important factors affecting the cleavage efficiency. Without changing other conditions, the longer the reaction time, the higher the Cas12a cleavage efficiency; however, as the reaction time continues to increase, non-specific cleavage of Cas12a may be caused.

[0246] Test fragment 1 was used; the same Cas12a protein and crRNA as 1-1 were used for enzyme digestion reaction, and the enzyme digestion system was shown in the following table. The enzyme digestion system was reacted at 37°C for 20min, 40min, 60min and 80min respectively.

[0247] Table 2

[0248] Reagents System (μL) 1 NEBuffer 3.1 5 2 Cas12a (10 μM) 3.2 3 Test fragment 1-crRNA (10μM) 3.2 4 Test snippet 1 1 μg 5 <![CDATA[H2O]]> To50

[0249] The results of enzyme digestion were analyzed by nucleic acid electrophoresis, wherein the 1610 bp test fragment 1 without enzyme digestion was used as a control. Figure 3 shown. Figure 3 The results show that when the cutting time is less than 60 minutes, the electrophoresis results show that there is an obviously uncut target PCR fragment. When the cutting time is extended to 60 minutes and 80 minutes, Cas12a almost completely cuts the target PCR fragment, and there is no significant difference in the cutting efficiency at 60 minutes and 80 minutes. However, the enzymolysis time is not proportional to the enzymolysis efficiency. Due to the presence of non-specific cutting and trans-cutting activity in Cas12a, the target fragment will also be degraded if the reaction time is too long. In another experiment, the above-mentioned target fragment is subjected to overnight digestion (greater than 12 hours), and the electrophoresis result is diffuse, without target band.

[0250] 1-3. About the molar ratio of PCR fragment and capture plasmid to Cas12a enzyme

[0251] The effect of the molar ratio of DNA template and Cas12a enzyme on the cutting efficiency was further analyzed.

[0252] (1) Test fragment 1 as a template for enzyme digestion

[0253] The same test fragment 1 and crRNA as 1-1 were used for enzyme digestion reaction, and the enzyme digestion system was shown in Table 2. Among them, the molar ratio of test fragment 1 to Cas12a protein was 1:12.5, 1:25, 1:50, 1:100 and 1:200. Each enzyme digestion system was carried out at 37°C for 60min.

[0254] The cutting results are as follows Figure 4 A, Control is a template PCR fragment, and there is no significant difference in the cutting effect when the template-protein molar ratio is 1:25-1:100, and the template DNA is almost completely cut. When the template-protein molar ratio is 1:12.5, that is, when the amount of Cas12a and crRNA added is small, a large amount of template DNA is not cut.

[0255] In order to further optimize the amount of plasmid-protein capture in the cutting system, the Cas12a protein identical to 1-1 is used, as well as crRNA (50kb-BAC-up-crRNA, SEQ ID No: 13) for the upstream homology arm and crRNA (BAC-dn-crRNA, SEQ ID No: 14) for the downstream homology arm, and the cutting experiment is continued with the capture plasmid pBAC2015-C50 as a template. Four groups of systems with a template-protein ratio of 1: 25, 1: 50, 1: 100, and 1: 200 are selected to compare the cutting efficiency. The reaction system is shown in Table 3 below. The results show that when the template-protein molar ratio is 1: 25, there is almost no double enzyme digestion product, but compared to the control plasmid (uncut), its supercoiled band darkens and the open-loop plasmid band becomes brighter. The above phenomenon shows that the amount of Cas12a is too small, only part of the plasmid template is single-digested by Cas12a, a large amount of template DNA is not cut, and almost no plasmid template is fully cut. The cutting efficiency was better when the template-protein molar ratio was 1:100, with no supercoiled plasmid bands, but still darker single-enzyme-cut plasmid bands. When the template-protein molar ratio was 1:200, there were no supercoiled plasmid bands and single-enzyme-cut plasmids, and the template DNA was almost completely cut. In order to avoid the influence of incomplete vector linearization on the subsequent T4 connection experiment, the capture plasmid:Casl2a / crRNA was finally determined to be 1:200.

[0256] The Cas12a cleavage system for PCR fragments or captured plasmids can be performed using Table 3 below.

[0257] Table 3 Cas12a cleavage system of PCR fragments and captured plasmids

[0258]

[0259] Example 2 Evaluation of cloning efficiency according to the method of the present invention (also known as CAT-FISHING)

[0260] The principle of CAT-FISHING is to connect the sticky ends of two linear DNA fragments by DNA ligase. However, unlike the traditional restriction endonuclease-based DNA assembly method, the sticky ends here are generated by CRISPR / Cas12a cleavage guided by paired crRNA. Therefore, this study first used Amp R The small fragment capture experiment (ampicillin resistance gene) compared the efficiency of two different sticky ends produced by commercial NEB restriction endonucleases and CRSIPR / Cas12a enzymatic digestion in cloning assembly. The specific process is as follows Figure 5 This step verified the feasibility of the CAT-FISHING gene manipulation platform and completed the evaluation of the CAT-FISHING cloning efficiency.

[0261] pGY2020 (pCC2-FOS plasmid with Chl resistance gene (purchased from EpicentreBio)) and pUC19 plasmid (purchased from NEB) were used. Figure 5 The crRNA used was 50kb-BAC-up-crRNA and BAC-dn-crRNA. Figure 6 As shown in A, the capture plasmid pGY2020 assembled by the pCC2-FOS plasmid backbone contains two PAM sites (PAM1 and PAM2) and two NEB restriction endonuclease sites (EcoR I and Hind III). We used CRISPR / Cas12a and NEB restriction endonucleases to capture the plasmid and target fragment Amp R The enzymatic hydrolysis was performed. From the results of agarose gel electrophoresis, there was no significant difference in the cutting effect of the two on the vector and the target fragment. Then the target fragment was cloned into the capture plasmid pGY2020 by T4 DNA ligase, and all the ligation products were transferred and mixed with Escherichia coli competent cells, and transformants were obtained by heat shock transformation. This experiment set up three parallel groups, and 6 transformant plates were counted respectively, and 10 transformants were picked for shaking and PCR verification. Cas12a mediated by 18nt crRNA usually cuts the 14th position of the non-complementary chain to produce a sticky end with a length of 8nt, but sometimes the cutting point position will also swing, resulting in base deletion at the junction. In order to further verify whether the cloned junction obtained by the CAT-FISHING method is complete, we randomly selected three PCR-positive clones for gene sequencing. The specific data are shown in Table 4.

[0262] Table 4 PCR fragment capture results

[0263]

[0264] There was no significant difference in the positive rate obtained by PCR results between the two cloning methods (Table 4, Figure 7 ). From the sequencing results, there is no base deletion or mutation at the junction of the three samples sent for sequencing ( Figure 6 D) These results indicate that CAT-FISHING can clone target DNA fragments with high efficiency comparable to that of commercial NEB restriction endonucleases.

[0265] Example 3.50 kb and 80 kb DNA sequence cloning and restriction endonuclease analysis

[0266] According to our previous research, the crRNA used in the experiment was prepared by in vitro transcription of DNA primers. The crRNA primer template consists of three parts: the 18bp spacer sequence at the 5' end is reverse complementary to the target gene fragment, the middle 21bp is the binding sequence of the Cas12a protein, and the 3' end is the binding sequence of the T7 promoter during in vitro transcription. The selection of the 5' end guide sequence is the key to crRNA design. We designed the guide sequence with the help of the crRNA design software CRISPR RGEN Tools. Select crRNAs with higher scores from the upstream and downstream homologous arms of each target gene cluster, perform enzyme cutting experiments, and screen the optimal crRNA.

[0267] Figure 8 It is the optimization result of three 50kb-BAC-up-crRNAs. This experiment compares the double enzyme digestion effect of Cas12a on the upstream homologous arm of 50kb-BAC under the mediation of three pairs of different crRNAs, with the capture plasmid pBAC2015-C50 as the template. In order to make the results more convincing, 4 groups of different Cas12a / crRNA:DNA molar ratios were set. The experiment used the same downstream crRNA (BAC-dn-crRNA, sequence is SEQ ID NO: 14). In the figure, Control is a PCR sample of 50kb-BAC upstream homologous arm-lacZ-downstream homologous arm. The results show that when the third pair of crRNA is used, there is a better cutting effect, the two target bands are clear, and the template residue is small; when the first pair of crRNA is used, the DNA template is cut into several fragments of different sizes by Cas12a, indicating that the specificity of the first upstream crRNA is poor. Although the second pair of crRNAs had no nonspecificity, when using the same template-protein molar ratio, the efficiency was significantly lower than that of the first pair of crRNA-mediated cleavage, with only one clearly visible target band, and most of the templates were not fully cleaved. Therefore, the third pair of crRNAs was selected for subsequent experiments (50kb-BAC-up-crRNA and BAC-dn-crRNA).

[0268] The above results show that crRNA has an important influence on Cas12a cutting efficiency. Therefore, optimizing crRNA is an essential step in CAT-FISHING technology. Through this crRNA optimization strategy, we finally screened out 7 related sequences for subsequent experiments, and the specific information is shown in Table 5.

[0269] Table 5 crRNA related data

[0270]

[0271] To further verify the feasibility of the CAT-FISHING method, we will capture large GC-rich gene clusters from the 137kb BAC plasmid pBAC-ZL to evaluate the cloning performance of this method on large DNA fragments. Fig. 9 As shown in A, two groups of target gene fragments from pBAC-ZL plasmid were cloned, with sequence length and GC content of 50 kb (65%) and 80 kb (66%), respectively. They have the same end point, that is, the downstream crRNA is the same, and the downstream homology arms of the capture plasmids pBAC2015-C50 and pBAC2015-C80 are also the same.

[0272] First, a BAC plasmid-specific kit was used in the experiment to prepare a high-purity pBAC-ZL template. The above-screened crRNA was used to further optimize the in vitro cleavage time and Casl2a / crRNA / DNA molar ratio of the 137 kb BAC plasmid. Finally, the in vitro cleavage time and template-protein molar ratio were determined to be 120 min and 1:2000, respectively. The cleavage system is shown in Table 6. Under this cleavage condition, the pBAC-ZL plasmid digested with CRISPR / Cas12a was subjected to pulsed field gel electrophoresis (PFGE) and an obvious target band was observed. Fig. 9 B, pBAC-ZL was cut into two fragments of 87 kb and 49 kb by Cas12a under the guidance of 50 kb-BAC-up / dn-crRNA. Cas12a mediated by 80 kb-BAC-up / dn-crRNA cuts pBAC-ZL into two fragments of 57 kb and 79 kb. The cutting of the capture plasmid is the same as in Example 1.

[0273] The capture plasmid pBAC2015-C50 or pBAC2015-C80 and the digestion product of the target fragment were recovered by alcohol precipitation.

[0274] The linearized capture vector and the target fragment were connected by T4 DNA ligase. Different from the small fragment capture by PCR mentioned above, in order to improve the transformation efficiency, the large fragment clone was introduced into the recipient cell by electroporation. Since the electroporation sample cannot contain too much salt ions, the ligation product should be transferred to the desalting gel after the reaction, and then all the desalted products should be introduced into DH10b.

[0275] Transformants were screened using bacterial liquid PCR, enzyme digestion verification and other methods, and the positive rate was counted.

[0276] Table 6 Cas12a cleavage system of 137 kb BAC plasmid

[0277]

[0278] Among them, larger DNA fragments can be analyzed by pulsed-field gel electrophoresis (PFGE) using a CHEF-DR III instrument (Bio-Rad, Richmond, CA). The electrophoresis conditions are 0.5 V agarose in 0.5× TBE buffer, PFGE at 6 V / cm, with switching pulse times of 1 to 25 seconds for 16 to 18 hours.

[0279] The system for ligation using T4 DNA ligase is as follows:

[0280]

[0281] Desalting: Transfer the ligated sample to 0.1 M glucose / 1% agarose gel and desalt on ice for 1 to 2 h before use for electroporation.

[0282] Electroporation: The electroporation was performed in a 2 mm electroporation cuvette using the Bio-Rad GenePulser XcellTM system (electroporation conditions: 2500 V, 200Ω and 25μF). Then, 1 mL of SOC medium (tryptophan 20 g / L, yeast extract 5 g / L, NaCl 0.5 g / L, KCl 2.5 mM, MgCl2 10 mM, glucose 20 mM) was added to the E. coli cells in the electroporation cuvette, and the mixture was then transferred to a 15 mL Falcom TM After shaking at 200 rpm for 1 hour at 37°C, the strains were collected and plated on selective (chloramphenicol resistance and X·gal) LB agar plates. The plates were incubated at 37°C overnight, and then transformants were screened and verified by PCR using the following primers.

[0283] Through the optimized CAT-FISHING technique, two target DNA fragments of 50 kb (GC 65%) and 80 kb (GC 66%) have been successfully cloned from the pBAC-ZL plasmid. Fig.10 and Fig.11The experiment was set up in three parallel groups. Six transformant plates were counted respectively, and 12 transformants were picked from each group and PCR amplified using three pairs of primers (50 kb 50-BAC-scr-up-F (SEQ ID No: 16) and 50-BAC-scr-up-R (SEQ ID No: 17); 50-BAC-scr-mid-F (SEQ ID No: 18) and 50-BAC-scr-mid-R (SEQ ID No: 19); BAC-scr-down-F (SEQ ID No: 20) and BAC-scr-down-R (SEQ ID No: 21); 80-BAC-scr-up-F (SEQ ID No: 22) and 80-BAC-scr-up-R (SEQ ID No: 23); 80-BAC-scr-mid-F (SEQ ID No: 24) and 80-BAC-scr-mid-R (SEQ ID No: 25); No: 25); BAC-scr-down-F (SEQ ID No: 26) and BAC-scr-down-R (SEQ ID No: 27)) were used for PCR verification. The verification primers were designed at the upstream, midstream and downstream of the target fragment, respectively. The specific data are shown in Table 7. Fig.13 Thus, the cloning vectors pBAC2015-50kb-BAC and pBAC2015-80kb-BAC containing 50kb and 80kb fragments were obtained respectively.

[0284] To exclude the possibility that the target fragment in the recombinant plasmid is incomplete, we transferred two transformants from the positive clones verified by PCR, respectively, and performed shake-up, plasmid extraction, and restriction enzyme verification. The 50 kb recombinant plasmid was verified by two sets of restriction enzymes, XcmI and KpnI&XbaI. The 80 kb recombinant plasmid was verified by restriction enzymes SalI and SmlI. The results are shown in the figure. Fig.12 Regarding the cloning vector pBAC2015-50kb-BAC, the XcmI enzyme spectrum has 9 bands, and the XbaI and KpnI enzyme spectrums have 6 bands. The actual enzyme digestion results are different from the simulation results. Figure 1 Regarding pBAC2015-80kb-BAC, the enzyme patterns of SalI and SmlI had 40 or 26 bands, respectively, most of which overlapped, and the main bands in the enzyme cutting pattern (relatively clear) were consistent with the simulation results.

[0285] Table 7 The number of clones and positive rates of 50 kb and 80 kb target fragments

[0286]

[0287] In summary, the CAT-FISHING technology has a positive rate of about 95% in the clones of dozens to hundreds of transformants for 50 kb DNA fragments. The capture efficiency of 80 kb DNA fragments is greatly reduced, and the number of transformants and the positive rate are lower than those of 50 kb ( Fig.13 ). However, among dozens of transformants, the PCR verification results of about 50% of the transformants were correct. The above results show that CAT-FISHING technology can achieve efficient cloning of 50 kb and 80 kb large fragment gene clusters from the 137 kb pBAC-ZL plasmid. It should be noted that for the 80 kb DNA fragment, the cloning difficulty is significantly increased.

[0288] Example 4. Biosynthetic gene cluster cloning

[0289] 4-1 Optimization of operating conditions

[0290] The size and sequence complexity of bacterial genomes are much larger than those of BAC plasmids. The genome of the donor bacterium S.albusJ1074 (GenBank Assembly: GCA_000359525.1) used in this experiment is 6.8 Mb, with a GC content of up to 73%. When clustering from BAC plasmids, the template 137 kb BAC is a high-purity DNA extracted by a kit, whereas the genome template is prepared by DNA embedding, and its purity is much lower than that of the BAC plasmid template. Taking the above two factors into consideration, we optimized the in vitro enzyme digestion conditions and genome embedding methods.

[0291] Referring to the cutting conditions of 137 kb BAC plasmid, we optimized the digestion time of genome embedding block and the molar ratio of template to protein. The cutting results showed that the genome-protein molar ratio was 1:20000. After 2 h of cutting, the target band was visible, but there was still a lot of diffusion.

[0292] Next, we improved the genome embedding conditions. In order to collect better quality bacteria, TSB liquid culture medium containing 0.5% glycine was used during shaking, and the shaking time of S.albus J1074 did not exceed 30 h. The amount of bacteria in each embedding block was controlled to be 4-5 mg, lysozyme lysis was 1-2 h, and the proteinase K digestion time was shortened from 12 h to 2 h (the embedding block was completely transparent). The entire genome embedding process only takes 4-5 h to complete. Try to use fresh embedding blocks for experiments. The specific genome cutting system is shown in Table 8.

[0293] The specific steps for embedding the Streptomyces genome are as follows:

[0294] Add 25 μL of frozen spore solution to 25 mL of TSB liquid medium (containing 0.5% glycine), seal with 8 layers of gauze, culture at 30°C in a shaker at 220 rpm for 24 to 30 h, and collect mycelium. (A spring should be added to the shake flask to prevent balls from affecting lysis.) Collect bacteria: transfer the cultured bacterial solution to a weighed centrifuge tube, centrifuge at 6000 rpm for 10 minutes, discard the supernatant, weigh again to obtain the wet weight of the bacteria; wash the bacteria: add 10 mL of 0.3 M sucrose solution, pipette to mix, centrifuge at 6000 rpm for 5 minutes, discard the supernatant, and repeat this step 2 to 3 times; resuspend with TE25S buffer to an appropriate concentration (OD=1.8, 1g / mL, 2g / mL); take an appropriate amount of the resuspended solution (100-200μL) and centrifuge to collect the bacteria, controlling the wet weight of the bacteria to about 50mg; add 450μL of TE25S buffer to the bacterial suspension to resuspend the cells, and then add 500μL 1.5% low melting point agarose, mix by pipetting; prepare embedding block: transfer the bacterial solution prepared in step (5) to the mold, about 100 μL per well, and cool at 4°C for 30 min; bacterial cell lysis: take out the embedding block and place it in TE buffer, add lysozyme to a final concentration of 2 mg / mL, and warm it at 37°C for 2 h; release nucleic acid: discard the solution, transfer the gel block to NDS solution containing 2 mg / mL proteinase K, treat at 50°C for 2 to 6 h, and stop the reaction when the embedding block is completely transparent; inactivate proteinase K: discard the solution, soak the gel block in TE buffer containing 0.1 mM PMSF at room temperature for 1 h; discard the solution, and then wash the gel block 3 times with TE buffer at room temperature, each time for 1 h; discard the solution, place the gel block in 75% ethanol solution, and store it at -20°C for a long time.

[0295] Table 8 Genome Cas12a cutting system

[0296]

[0297] 4-2 Cloning of large fragments from the genome of Streptomyces J1074

[0298] Next, we attempted to clone the 49 kb paulomycin gene cluster (GC content 71%), the 87 kb surugamides gene cluster (GC content 76%), and the 139 kb candicidin gene cluster (GC content 75%) from the Streptomyces J1074 genome.

[0299] 50kb-up-crRNA (SEQ ID No: 28) and 50kb-dn-crRNA (SEQ ID No: 29) were used as crRNA for 49kb fragments, 80-up-crRNA (SEQ ID No: 30) and 80kb-dn-crRNA (SEQ ID No: 31) were used as crRNA for 87kb fragments, and 140-up-crRNA (SEQ ID No: 32) and 140kb-dn-crRNA (SEQ ID No: 33) were used as crRNA for 139kb fragments.

[0300] The capture vector is based on pBAC2015, and primers for the 49kb fragment (50kb-up-hom-arm-F (SEQ ID No: 34) and 50kb-up-hom-arm-R (SEQ ID No: 35) and 50kb-dn-hom-arm-F (SEQ ID No: 36) and 50kb-dn-hom-arm-R (SEQ ID No: 37), the upstream homology arm 49kb-up-hom-arm (SEQ ID No: 38) and the downstream homology arm 49kb-dn-hom-arm (SEQ ID No: 39) are 727bp and 611bp respectively) and primers for the 87kb fragment ((80kb-up-hom-arm-F (SEQ ID No: 40) and 80kb-up-hom-arm-R (SEQ ID No: 41) and 80kb-dn-hom-arm-F (SEQ ID No: 42) No: 42) and 80kb-dn-hom-arm-R (SEQ ID No: 43), upstream homology arm 80kb-up-hom-arm (SEQ ID No: 44) and downstream homology arm 80kb-dn-hom-arm (SEQ ID No: 45) are 984bp and 870bp respectively)) The homology arms obtained construct capture vectors pBAC2015-CS49 and pBAC2015-CS87, wherein LacZ is a selection marker located between the two homology arms. The capture vectors pBAC2015-CS49 and pBAC2015-CS87 are digested with the same parameters as in Example 1 for linearization.

[0301] like Fig.14As shown in the figure, CAT-FISHING technology is used for gene cluster cloning. From genome isolation to transformant screening, the entire process only takes 2 to 3 days. The first step is the preparation of embedding blocks, which takes 4 to 5 hours. Prepare the genome embedding blocks according to the optimized method. Wash the embedded blocks prepared for cutting twice with ultrapure water and soak them in 100μL 1×NEBuffer3.1 for 30 minutes. The remaining embedded blocks are placed in 75℃ ethanol and frozen at -20℃. The second step is the enzymatic hydrolysis of the genome, which takes 2 hours. According to the optimized cutting conditions, the corresponding crRNA is used to mediate CRISPR / Cas12a to specifically cut the embedded blocks and capture plasmids. The target bands can be observed after PFGE of the digested genome embedded blocks. Among them, after 50kb-up / dn-crRNA-mediated Cas12a cuts the embedding block, a 49kb target band is produced, and after 80kb-up / dn-crRNA-mediated Cas12a cuts the embedding block, an 87kb target band is produced. The third step is to digest the cutting product with agarase, which takes 30 minutes. Transfer the genome embedding block treated with enzymes in step 2 to an appropriate amount of agarase solution, digest it at 42°C for 30 minutes, and completely dissolve the embedding block to obtain a target gene cluster mixture. The fourth step is the ligation reaction, which takes 3 to 4 hours. The target gene cluster mixture does not require separation and purification steps and can be directly used for enzyme connection experiments. Take 500ng each of the purified linearized capture plasmid and the target gene cluster. Use T4 DNA ligase for ligation, the ligation system is 30μL, and the reaction is 1 to 2h. The fifth step is to desalt the ligation product, which takes 2h. Transfer all the ligation products to the configured desalted gel and let it stand at 4°C for 2h. The sixth step is electrotransformation, which takes 2 hours. All desalted products (approximately 30 μL) are transferred to 170 μL of high-concentration E. coli DH10b electrotransformation competent medium, placed on ice for 10 minutes, transferred to a 2mm electrotransformation cup, and electrotransformed at a voltage of 2500V, a capacitance of 25 μF, and a resistance of 200Ω. 500 μL of SOC medium is quickly added, incubated at 37°C for 1 hour, and 700 μL of bacterial solution is transferred to an LB plate containing X·gal and chloramphenicol resistance, spread evenly, blow dried on a clean bench, and cultured at 37°C for 16 to 20 hours to see single clones. The efficiency of the competent medium used for electrotransformation is between 0.8 and 1×10 8 cfu / μL. Thus, cloning vectors pBAC2015-49kb-J1074, pBAC2015-87kb-J1074 and pBAC2015-139kb-J1074 containing 49kb paulomycin gene cluster, 87kb surugamides gene cluster and 139kb candidiasis gene cluster were obtained.

[0302] Next is the transformation verification and cloning efficiency statistics, which takes 1 to 2 days. First, the single clones were screened by bacterial liquid PCR. In this experiment, there were three pairs of bacterial liquid PCR primers used to verify each target gene cluster recombinant, namely 50 / 80 / 140-scr-up-F / R, 50 / 80 / 140-scr-middle-F / R) and 50 / 80 / 140-scr-dn-F / R, see Table 9 below. Their amplification products are located in the upstream, midstream and downstream of the target gene cluster, respectively. We picked 90 to 100 single clones from hundreds of transformants of three groups of gene clusters of different sizes for bacterial liquid PCR. The results showed that the 49kb Paulomycin gene cluster, the 87kb Surugamides gene cluster and the 139kb Candicidin gene cluster were all captured successfully.

[0303] Table 9

[0304] Primer Sequence(5'-3') serial number 140-scr-up-F AAGATGTCCAAGCGTGC SEQ ID No: 46 140-scr-up-R AGCCGGCCTACCAGCTG SEQ ID No: 47 140-scr-middle-F CCACCACGGACGACGAGA SEQ ID No: 48 140-scr-middle-R AACTCGGTGAAGAGTTC SEQ ID No: 49 140-scr-down-F TGGTCACCTTCCGGTCTTC SEQ ID No: 50 140-scr-down-R AAAGGCCGGCCCATGAC SEQ ID No: 51 80-scr-up-F GCAGCGAACTGCCTGGT SEQ ID No: 52 80-scr-up-R CCGATGAGGTCGTTCAC SEQ ID No: 53 80-scr-middle-F ATGCCCGTCAACTGCTCCTG SEQ ID No: 54 80-scr-middle-R TGATTTCCCGACCGTTT SEQ ID No: 55 80-scr-down-F GCCGGTTCAGGCGCGCT SEQ ID No: 56 80-scr-down-R AGAAGGGCAAGTTGTGC SEQ ID No: 57 50-scr-up-F TCCATTCCGTGCCATGCG SEQ ID No: 58 50-scr-up-R GCGACGAGAGAGGATGTG SEQ ID No: 59 50-scr-middle-F ACAAGGCTCCTGACAGG SEQ ID No: 60 50-scr-middle-R GAGGTGGTGCACCTGG SEQ ID No: 61 50-scr-down-F GTGTATCGCGCCGCTG SEQ ID No: 62 50-scr-down-R CTATGCTCCAGACATC SEQ ID No: 63

[0305] To further verify the integrity of the recombinant clones, we selected 5 positive clones from each of the PCR-verified clones and extracted the plasmids for restriction enzyme digestion verification. The appropriate restriction enzymes were selected using SnapGene software. After the recombinant plasmids of the Paulomycin gene cluster were digested with Xho I, the electrophoresis bands of the 5 clones were the same as expected ( Fig.15 A). The results of SmL I restriction enzyme digestion of the Surugamides gene cluster recombinant plasmid also showed that all five clones were correct ( Fig.15 B). However, the restriction enzyme data of the Candicidin gene cluster showed that the cloning was incomplete. The specific data are listed in detail in Table 10.

[0306] Table 10 Cloning efficiency of targeted cloning of high GC gene clusters from genomic DNA.

[0307]

[0308]

[0309] *(Optional) Use commercially available electroporation competent cells ElectroMAX TM DH10B TM cell (Thermo Fisher Scientific, Invitrogen TM ) can increase the number of transformants.

[0310] Heterologous expression and product analysis of the surugamides gene cluster in a clusterless fungus

[0311] In order to thoroughly check the sequence and functional integrity of these BGCs captured by CAT-FISHING and prove that the genome mining products obtained by this method can be used for the mining of novel BSMs, we expressed the cloned products of the 87kb Surugamides gene cluster in a Streptomyces chassis strain without background expression products. First, pSET152 (Gao Q et al., 2017) was used as a template to amplify the resistance gene-Streptomyces replicon-integrase-integration site, i.e., aac(3)IV-oriT-attP(ΦC31)-int(ΦC31), and the chloramphenicol resistance gene on pBAC2015-87 kb-J1074 was replaced with a conjugative transfer element by Redαβ linear loop recombination technology. Then, three-parent conjugative transfer was performed to integrate the 87kb Surugamides gene cluster into the chromosome of the heterologous host S.albus Del14. Next, fermentation was performed, and the compounds were isolated, extracted, and detected.

[0312] First, the Streptomyces conjugative transfer element, replicon and selection marker aac(3)IV-oriT-attP(+C31)-int(+C31) were integrated into the recombinant plasmid by Rec / ET recombination technology. The target plasmid pBAC2015-87 kb-J1074-int in DH10b was integrated into the chromosome of S.albus Del14 by triparental conjugative transfer mediated by ET12567 / pUB307. The conjugate was verified and fermented in R5A medium. SurugamidesA (RT=4.53 minutes, m / z=912.6293) and other components (SurugamidesD, G, H and I) were detected in the fermentation broth of S.albus Del14-87 kb. LC-MS / MS analysis further confirmed that SurugamidesA was successfully synthesized in S.albus Del14-87 kb.

[0313] The 49kb Paulomycin gene cluster (GC content = 71%) and the 87kb Surugamides gene cluster (GC content = 76%) were successfully captured from the genome of Streptomyces albus using CAT-FISHING technology.

[0314] When clustering by constructing a BAC library, usually only a few correct clones (i.e. 1 / 1000 to 1 / 2000) can be screened out from thousands of transformants. In comparison, CAT-FISHING technology is undoubtedly a simpler, faster and more efficient BGC cloning method.

[0315] The above results indicate that CAT-FISHING technology can effectively clone large BGC fragments with high GC content and can be widely used as an in vitro operation platform for large gene fragments.

[0316] The above-mentioned embodiments are preferred examples of the present invention and are not intended to limit the protection scope of the present invention. Sequence Listing <110> East China University of Science and Technology <120> An in vitro large-fragment DNA cloning method based on CRISPR / Cas12a and its application <130> 1 <160> 63 <170> PatentIn version 3.5 <210> 1 <211> 32 <212> DNA <213> Artificial sequence <400> 1 ttatctatgc tcgggggatg ccgcgtggta cc 32 <210> 2 <211> 40 <212> DNA <213> Artificial sequence <400> 2 acagacaagc tgtgaccgtc ggcggcatcc cgatcagcgc 40 <210> 3 <211> 990 <212> DNA <213> Saccharopolyspora spinosa <400> 3 ggatgccgcg tggtacctgc acgagctgac tcgggaactc ggtctgtcgg cgttcgtgtt 60 gttctcctcg gtcgcgggcc tgttcggcgg tgcggggcag agcaattacg ctgccggcaa 120 cgctttcctg gatgccttgg cgcattgccg gcaggcccag gggctgcccg cgctgtcgct 180 ggcctccggg ctgtgggcga gtatcgatgg aatggcgggc gacctcgctg cggcagatgt 240 ggagcggctg tcgcgggcag gcattggccc gctttcggca ccgggagggc tggccttgtt 300 cgacgctgcc gttggctcgg acgaaccgtt gctggcaccg gtgcgactgg atgtcgaagc 360 actgcgtgtg caggcccgat ccgtgcagac ccggattccg gaaatgctgc atggcatggc 420 aatggggcca agccgccgca ctccgttcac ttccagggtt gagccgttgc acgaacggct 480 ggccggattg tcggagggcg aacgtcggca gcaagtgctc cagcgcgtcc gcgccgatat 540 cgcggtggta ctggggcacg gcaggtcgag cgatgtggac atcgagaagc ctttggccga 600 gctgggtttc gactcgctga cggccatcga actccgcaac cgtctcgcta ccgccaccgg 660 actgcggctt cccgcgacgc tggccttcga ccacggcact gcggcggcac tcgcccagca 720 cgtgtgcgcg cagctaggca ccgcgaccgc gccggcaccg aggcgaaccg acgacaacga 780 cgccacggag cccgtgaggt cgctcttcca acaggcgtat gcggctggcc ggatacttga 840 cgggatggat ttggtgaagg tcgctgccca gttgcgaccg gtgttcggtt cgcctggcga 900 gctggaatcc ctgccgaaac ccgtccagct ttcccgtggt cccgaagagc ttgccttggt 960 gtgcatgccg gcgctgatcg ggatgccgcc 990 <210> 4 <211> 40 <212> DNA <213> Artificial sequence <400> 4 gcgcggggag aggcggtttg gacattgcac tccaccgctg 40 <210> 5 <211> 33 <212> DNA <213> Artificial sequence <400> 5 tagagaggat accggagatc ctttgatctt ttc 33 <210> 6 <211> 228 <212> DNA <213> Saccharopolyspora spinosa <400> 6 gacattgcac tccaccgctg atgacatcag tcgatcatag cacgatcaac ggcactgttg 60 caaatagtcg gtggtgataa acttatcatc cccttttgct gatggagctg cacatgaacc 120 aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 180 ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatct 228 <210> 7 <211> 620 <212> DNA <213> Artificial sequence <400> 7 gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc 60 gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc 60 agcgggtgtt ggcgggtgtc ggggctggct taactatgcg gcatcagagc agattgtact 120 agcgggtgtt ggcgggtgtc ggggctggct taactatgcg gcatcagagc agattgtact 120 gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat 180 gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat 180 caggcgccat tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc 240 caggcgccat tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc 240 ttcgctatta cgccagctgg cgaaaggggg atgtgctgca aggcgattaa gttgggtaac 300 ttcgctatta cgccagctgg cgaaaggggg atgtgctgca aggcgattaa gttgggtaac 300 gccagggttt tcccagtcac gacgttgtaa aacgacggcc agtgccaagc ttgcatgcct 360 gccagggttt tcccagtcac gacgttgtaa aacgacggcc agtgccaagc ttgcatgcct 360 gcaggtcgac tctagaggat ccccgggtac cgagctcgaa ttcgtaatca tggtcatagc 420 gcaggtcgac tctagaggat ccccgggtac cgagctcgaa ttcgtaatca tggtcatagc 420 tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca 480 tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca 480 taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct 540 taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct 540 cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 600 cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 600 gcgcggggag aggcggtttg 620 gcgcggggag aggcggtttg 620 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <400> 8 gacggtcaca gcttgtctgt aagc 24 <210> 9 <211> 25 <212> DNA <213> Artificial sequence <400> 9 caaaccgcct ctccccgcgc gttgg 25 <210> 10 <211> 33 <212> DNA <213> Artificial sequence <400> 10 ttatctatgc tcgggggtgg agctgcgcaa ccg 33 <210> 11 <211> 40 <212> DNA <213> Artificial sequence <400> 11 acagacaagc tgtgaccgtc tcctggggcg tgacaccacc 40 <210> 12 <211> 880 <212> DNA <213> Saccharopolyspora spinosa <400> 12 ggtggagctg cgcaaccggc tgaacaccgc caccgggatc cagctgcccg ccagcacgat 60 tttcgactac cccaatgccg agtcgctgtc gcgtcacctc tgcgccgagc ttttcccaac 120 ggagactacc gtggactcgg cccttgccga gctcgatcga atcgagcagc agctctcgat 180 gctcaccggc gaagcgcggg cacgggaccg aatcgcgaca cgactgcgag ccctccacga 240 gaagtggaac agcgcagctg aagtaccgac cggagccgat gtcctgagca cgctcgattc 300 gaagtggaac agcgcagctg aagtaccgac cggagccgat gtcctgagca cgctcgattc 300 ggcgacgcac gacgagatat tcgagttcat cgacaacgag ctcgacctgt cctgagcagt 360 ggcgacgcac gacgagatat tcgagttcat cgacaacgag ctcgacctgt cctgagcagt 360 tcctgcggaa cttcaagcgc cgaaatcggg tggaaatcac aatggccaat gaagaaaagc 420 tcctgcggaa cttcaagcgc cgaaatcggg tggaaatcac aatggccaat gaagaaaagc 420 tcttcggcta tctgaagaag gtaactgcgg acctgcatca gacccggcag cgcctgctcg 480 tcttcggcta tctgaagaag gtaactgcgg acctgcatca gacccggcag cgcctgctcg 480 cggccgagag ccggagtcag gagccgatcg cgatcgtctc ggcgagctgc cgactgcccg 540 cggccgagag ccggagtcag gagccgatcg cgatcgtctc ggcgagctgc cgactgcccg 540 gcggcgtcga ctctcccgaa gcgctctggc aactcgtgcg cactggcacc gacgccatct 600 gcggcgtcga ctctcccgaa gcgctctggc aactcgtgcg cactggcacc gacgccatct 600 cggagttccc cgccgaccgg ggctgggatc tcggccggtt gtacgatccc gacccgaacc 660 cggagttccc cgccgaccgg ggctgggatc tcggccggtt gtacgatccc gacccgaacc 660 accagggaac gtcgtacacg cgggccggcg gtttcctcgc aggagcgggc gatttcgacc 720 accagggaac gtcgtacacg cgggccggcg gtttcctcgc aggagcgggc gatttcgacc 720 ccgccatgtt cgggatttcg ccgcgtgagg cgttggcgat ggacccgcag caacggttgt 780 ccgccatgtt cgggatttcg ccgcgtgagg cgttggcgat ggacccgcag caacggttgt 780 tgctggagct gtcctgggag gccctcgaac gggcgggcat agacccgaca tccctgcgcg 840 tgctggagct gtcctgggag gccctcgaac gggcgggcat agacccgaca tccctgcgcg 840 gcagcaagac cggtgtcttc ggtggtgtca cgccccagga 880 gcagcaagac cggtgtcttc ggtggtgtca cgccccagga 880 <210> 13 <210> 13 <211> 38 <211> 38 <212> RNA <212> RNA <213> 人工序列 <213> Artificial sequence <400> 13 <400> 13 gaauuucuac uguuguagau cggaauccgg gucugcac 38 <210> 14 <211> 38 <212> RNA <213> Artificial sequence <400> 14 gaauuucuac uguuguagau caacagugcc guugaucg 38 <210> 15 <211> 38 <212> RNA <213> Artificial sequence <400> 15 gaauuucuac uguuguagau ggcgcuugaa guuccgca 38 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <400> 16 ggcagtttca tcgtggcgta 20 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <400> 17 gcgggactca catgggtttt 20 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <400> 18 caatccgatg acacggcaca 20 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <400> 19 ccgtggttgt cgctgtactc 20 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <400> 20 tgccatcaac tcggcaagat 20 <210> twenty one <211> 20 <212> DNA <213> Artificial sequence <400> twenty one tctttcgcga aggcttgagt 20 <210> twenty two <211> 20 <212> DNA <213> Artificial sequence <400> twenty two tggtgtgttg tcgttgtcgg 20 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <400> twenty three ggagatctgg gcgaactcct 20 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <400> twenty four ggcagtttca tcgtggcgta 20 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25 gcgggactca catgggtttt 20 <210> 26 <211> 20 <212> DNA <213> Artificial sequence <400> 26 tgccatcaac tcggcaagat 20 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <400> 27 tctttcgcga aggcttgagt 20 <210> 28 <211> 38 <212> RNA <213> Artificial sequence <400> 28 gaauuucuac uguuguagau cucacgcugc ccgcguac 38 <210> 29 <211> 38 <212> RNA <213> Artificial sequence <400> 29 gaauuucuac uguuguagau uuggcgaaau cucugucc 38 <210> 30 <211> 38 <212> RNA <213> Artificial sequence <400> 30 gaauuucuac uguuguagau cgggcgggcg cggccagg 38 <210> 31 <211> 38 <212> RNA <213> Artificial sequence <400> 31 gaauuucuac uguuguagau ccgaggaccg aaacug 38 <210> 32 <211> 38 <212> RNA <213> Artificial sequence <400> 32 gaauuucuac uguuguagau ggccacaucg acgccuac 38 <210> 33 <211> 38 <212> RNA <213> Artificial sequence <400> 33 gaauuucuac uguuguagau gcacugcugg cggcgguc 38 <210> 34 <211> 59 <212> DNA <213> Artificial sequence <400> 34 cactcactca ccccggtcac atcgttatct atgctcggcg atcgcgctgg agtccttcg 59 <210> 35 <211> 59 <212> DNA <213> Artificial sequence <400> 35 tctcatgttt gaccgcttt ctggatctgc cctttccact cgacggcgac ccggtgctg 59 <210> 36 <211> 59 <212> DNA <213> Artificial sequence <400> 36 attgatttaa aacttcattt aatcctgtcg accgtcaagc ctgcatgtgc acccatgta 59 <210> 37 <211> 59 <212> DNA <213> Artificial sequence <400> 37 aggaaattta tcttgatcat ataaatagag aggataccgt gaccaagcgg tacgacttc 59 <210> 38 <211> 727 <212> DNA <213> Streptomyces albus <400> 38 cgatcgcgct ggagtccttc gacgccgtcc tcggcgagaa gccgaaccag aaggaccggc 60 tccgcgagga cgtctcggtg gccgccggcg acctcatcgc catcgactcg ctcgacgccg 120 agcccacctt cgacggcctg cgcaacgccg tccaggtcgg catccgctac atcgaggcgt 180 ggctgcgcgg cctcggcgcc gtcgccatct tcaacctgat ggaggacgcg gccaccgccg 240 agatctcccg ctcgcagatc tggcagtgga tcaacgccgg ggtcgaggtg gagcgcgacg 300 gcgccaccgt cctggtcacc cgtgagctgg cccgcgaggt ggcggccggg gaactggccg 360 cgatccgcgc cgagatcggc gaggacgcct tcaccgccgg ccgctggcag caggcccacg 420 acctgctgct gaccgtctcc ctcgacgacg actacgccga cttcctcacg ctgcccgcgt 480 acgagcagct ggtcggctga gctcgcccgg cacctccgca cgcgcctttg ccccggccct 540 cgccggggca aaggcgcgtg cgggcccggg tccgccgcac cgacggctct cagagcaccc 600 ggtcgagcgc caggcaggtc tcgtactccg gcagcagtcc ttgccgcccg gcctcggcca 660 gggtgggggc ctgccggtcg cgcgctgaca gcaccgggtc gccgtcgagt ggaaagggca 720 gatccag 727 <210> 39 <211> 611 <212> DNA <213> Streptomyces albus <400> 39 taatcctgtc gaccgtcaag cctgcatgtg cacccatgta ccgacccagt ccttctttat 60 ccgcagaggc gtccagtata gggtcaaccc tgcgcggggg aacctgaagg atgacaccgg 120 acagagattt cgccaagaag gcatatcatc cgggtagttg aggtatttcg ccggtggcgg 180 tcccgcccgg cgaaccgagc caccggacgc cccccccccc ccgcctcacc ccagatgccg 240 cgaccagtcc ggcgccgcgt ccggcttgcc gtgcagatcc ggtacgtgct ggagccaggc 300 gggccgggcc gcgcgggtgg ccgcggcccg ctcggcgtcg gcctcggcga gttgccgggc 360 cgaggggaac tccagcggca gccactcccc cgagacggcc gcccgctccg cgagctgatg 420 ggcgtacgcc tcgcgcagcg cgtccggcga ggagaagccc ggctcgtccc gcagccaggc 480 gtcggggacg agcgcggtca cctcgcgcag caggtcgagg gtgacccggg gtgccagttc 540 cgcgtcggcc tcggcgacca gcggggcgta cccgccgagg gcgtggtggc ggaagtcgta 600 ccgcttggtc a 611 <210> 40 <211> 39 <212> DNA <213> Artificial sequence <400> 40 catcgttatc tatgctcggg gatgtcgacg tccagggtg 39 <210> 41 <211> 38 <212> DNA <213> Artificial sequence <400> 41 cggtttgcgt attgggcaat tgattcgccg gcgttctg 38 <210> 42 <211> 39 <212> DNA <213> Artificial sequence <400> 42 tgataataat ggtttcttag ggaagcggtc tcctgaagc 39 <210> 43 <211> 41 <212> DNA <213> Artificial sequence <400> 43 ataaatagag aggataccgg ttttcccccg ttgatgagtg g 41 <210> 44 <211> 984 <212> DNA <213> Streptomyces albus <400> 44 gatgtcgacg tccagggtgc gcgggcccca gcgctcgtca cggacccggt ggaacgcctc 60 ctcgacggcc tgcgcgcgct ccagcagcga gccggggggc agcgtcgtcc ggatcaccgc 120 gacggcgttg aagtacgagg gctgggagcc ggggtcgacg ccccacggct ccgtctcgta 180 gacgggggag acggctttga cccgcaggcc gggggtgtcc tccagcgcgt cgacggcgcc 240 ctggagggtc tccaggcggt tgccgaggtt gctgccgagg gagatcacgg cggtcttcgg 300 gttggagagg gtcacgtcgg cggcgtccac ctgctcgacg acggaggccg ggaccggctg 360 cacggtgggg tcgctgctgt tcgggttcat acacggctcc gggtgatggt gacggtcacg 420 tcgtcgaacg ggacggtgat cggggcgtcc ggtttgtgga cggtgacctc gacctcctgg 480 accgcgtccg tcttcaggca ggtccgggcg atgcgctcgg ccagggtctc gatgaggttc 540 accggctcgc cctcgaccac ggccacgacc tcctcggcga cgacgccgta gtggacggtc 600 cgggtcaggt cgtcgctctc ggctgcgggc cgggtgtcca gaccgaggac gaggtcgacg 660 atgaaggtct ggccctcctc gcgctccttg ggaaagacac cgtggtgccc tcggcccttg 720 aggccgcgca gcgcgacacg atccacgcga atcactcctg ctcttgtcgt tgtcggcggg 780 cggtgcgcgg gtgcggccgg cccaccggcc tcaggcgagg ctaccggtgg ccaccggcac 840 ggcccgccca cggggtcggg acagcacggg gaagaaccgg ggaaccccac atgacgcgca 900 cctggccgcg cccgcccgga aaccggtccc ccaccctccg ggcagggacg gcgaagggcc 960 cctacccaga acgccggcga atca 984 <210> 45 <211> 870 <212> DNA <213> Streptomyces albus <400> 45 ggaagcggtc tcctgaagcg cacagggacc cgccttcatc tcggggcgcc gggcgctccc 60 gggcctcccg cagagaactc cacgttcccg ccggcgcagc gtaggtctcc cgttcgttcc 120 cgggccacag tttcggtcct cggtaaaccc tcccggcacc gggggagtcg gccgcctgtc 180 ccgtcgcgga cgggccggcg ggcggtcggg accaccgcca ccgcaccgga gaccggaacg 240 gcgagaatca gccaggtgcg cccctgatgg ccgaaggaca tgcctcggcc gggcgccggg 300 acgcggtggt cccgcccgca ccccgatggc cgggacacgc cccctcaagg ccgccctccg 360 gcgtcccccg cctccgggcc gaccctgcct cgggggcggc ggggacggcc cccggggagg 420 cgctgcccgg ccctgtggcc tcgtaactcg tagtgagggg agtgccacgt tcccgtgccc 480 cggggcggcc gggcggtccc gggggacgcc gtgcggcgcc gaaacccggg acccggaagg 540 gggccgggat ctttccccgg acgccgtccg gagccacacc tgaagaattc atgatcgagg 600 tggtgaatcg gccatggcgg ctcaaggaac gcggcactgt ccgcgcgcca cccgtcatgg 660 caccgtctgg aaaggtctgg acaggagcgg ccgcacgccg gcgcccctgc accagcacca 720 cgaggtattc gtgcgtatcc gtgcgtacgg cacccgcccc cggacaccgt ccggccgggc 780 gggcagcgga acagcgtctc caccgcgacc cggtggcggc ggtccggccg cgtgcctgcc 840 gcgggtgcac cactcatcaa cgggggaaaa 870 <210> 46 <211> 17 <212> DNA <213> Artificial Sequence <400> 46 aagatgtcca agcgtgc 17 <210> 47 <211> 17 <212> DNA <213> Artificial Sequence <400> 47 agccggccta ccagctg 17 <210> 48 <211> 18 <212> DNA <213> Artificial Sequence <400> 48 ccaccacgga cgacgaga 18 <210> 49 <211> 17 <212> DNA <213> Artificial sequence <400> 49 aactcggtga agagttc 17 <210> 50 <211> 19 <212> DNA <213> Artificial sequence <400> 50 tggtcacctt ccggtcttc 19 <210> 51 <211> 17 <212> DNA <213> Artificial sequence <400> 51 aaaggccggc ccatgac 17 <210> 52 <211> 17 <212> DNA <213> Artificial sequence <400> 52 gcagcgaact gcctggt 17 <210> 53 <211> 17 <212> DNA <213> Artificial sequence <400> 53 ccgatgaggt cgttcac 17 <210> 54 <211> 20 <212> DNA <213> Artificial sequence <400> 54 atgcccgtca actgctcctg 20 <210> 55 <211> 17 <212> DNA <213> Artificial sequence <400> 55 tgatttcccg accgttt 17 <210> 56 <211> 17 <212> DNA <213> Artificial sequence <400> 56 gccggttcag gcgcgct 17 <210> 57 <211> 17 <212> DNA <213> Artificial sequence <400> 57 agaagggcaa gttgtgc 17 <210> 58 <211> 18 <212> DNA <213> Artificial sequence <400> 58 tccattccgt gccatgcg 18 <210> 59 <211> 18 <212> DNA <213> Artificial sequence <400> 59 gcgacgagag aggatgtg 18 <210> 60 <211> 17 <212> DNA <213> Artificial sequence <400> 60 acaaggctcc tgacagg 17 <210> 61 <211> 16 <212> DNA <213> Artificial sequence <400> 61 gaggtggtgc acctgg 16 <210> 62 <211> 16 <212> DNA <213> Artificial sequence <400> 62 gtgtatcgcg ccgctg 16 <210> 63 <211> 16 <212> DNA <213> Artificial sequence <400> 63 ctatgctcca gacatc 16

Claims

1. An in vitro large-fragment DNA cloning method based on the CRISPR / Cas12a system, the method comprising: (1) Construction and cutting of capture vector: preparing homologous arms at both ends of the target DNA fragment, and connecting the homologous arms to the vector to obtain the capture vector, wherein the homologous arms contain at least one PAM site that can be recognized by Cas12a; based on the crRNA that is at least partially complementary to the homologous arm, using the Cas12a to cut the capture vector to obtain a cut capture vector; (2) Preparation of target DNA fragments: Based on the crRNA and using the Cas12a, a sample containing the target DNA fragment is cut to obtain the target DNA fragment. Wherein, in step (2), the molar ratio of the target DNA fragment to the Cas12a protein is 1:50 to 1:2000, and the cleavage is performed in a hydrochloride buffer at a temperature of 35°C-38°C for 40min-120min, wherein the pH of the buffer is 7.5-8.0; and (3) Ligation and transformation: the cut capture vector is connected to the target DNA fragment and transferred / introduced into a host cell to obtain a recombinant host cell having the target DNA fragment. Wherein, the length of the target DNA fragment is 40kb-140kb, Wherein, the length of the homology arm is more than 100 bp; Wherein, the crRNA comprises a spacer sequence and a binding sequence, the spacer sequence can at least partially complementarily bind to the homology arm, and the binding sequence can bind to the Cas12a; wherein, the spacer sequence can at least partially complementarily bind to a continuous 15-50bp target nucleic acid sequence near the PAM in the homology arm, and the length of the spacer sequence is 15-50nt, and the length of the binding sequence is 16-32bp.

2. The method according to claim 1, wherein: The sample is an isolated nucleic acid sample.

3. The method according to claim 2, wherein: The isolated nucleic acid sample is an isolated DNA sample.

4. The method according to claim 2, wherein: The sample is a genome and / or a metagenome, or a DNA sample derived from a genome and / or a metagenome.

5. The method according to claim 4, wherein: The DNA sample derived from the genome and / or metagenome is a DNA library, including a BAC library and a YAC library.

6. The method according to claim 1, wherein: The homology arms at both ends of the target DNA fragment are located outside the target DNA fragment.

7. The method according to claim 6, wherein: The homology arm is at least 100 bp away from the 5' end or 3' end of the target DNA fragment.

8. The method according to claim 1, wherein: The length of the homology arm is more than 200 bp.

9. The method according to claim 8, wherein: The length of the homology arm is 800bp-1500bp.

10. The method according to any one of claims 1 to 5, wherein: The vector used to prepare the capture vector is a circular plasmid or a linear vector.

11. The method according to any one of claims 1 to 5, wherein: The capture vector is selected from a plasmid, a cosmid, a bacterial artificial chromosome (BAC) or a yeast artificial chromosome (YAC).

12. The method according to any one of claims 1 to 5, wherein: The homology arms are ligated into the vector by homologous recombination or restriction ligation.

13. The method according to any one of claims 1 to 5, wherein: In step (1), before cutting the capture vector, the method further includes the steps of screening and separating the capture vector.

14. The method according to any one of claims 1 to 5, wherein: The capture vector comprises a selectable marker.

15. The method according to claim 14, wherein: The selection marker is a drug resistance selection marker, a counter screening gene or a lacZ selection system.

16. The method according to claim 14, wherein: The selectable marker is operably linked between the homology arms.

17. The method according to claim 1, wherein: The spacer sequence has 100% complementarity with the target nucleic acid sequence.

18. The method according to claim 1, wherein: The crRNA is 5'-[binding sequence]-[spacer sequence]-3'.

19. The method according to claim 18, wherein: There is also a linker sequence between the binding sequence and the spacer sequence, and the length of the linker sequence is 2-10 bp.

20. The method according to any one of claims 1 to 5, wherein: In step (1), the molar ratio of the Cas12a to the crRNA is 1:1 or more.

21. The method according to any one of claims 1 to 5, wherein: Before the cutting step in step (1), a step of screening the crRNA is also included.

22. The method according to any one of claims 1 to 5, wherein: In step (1), the step of inactivating the Cas12a is also included; and / or the step of separating the cut capture vector is also included.

23. The method according to claim 22, wherein: The Cas12a was inactivated by heating above 65°C.

24. The method according to claim 23, wherein: The heating is performed for more than 10 minutes.

25. The method according to any one of claims 1 to 4, wherein: In step (2), when the sample is a genome or a metagenome, the sample is provided in the form of a low melting point agarose embedding block.

26. The method according to claim 25, wherein: The size of the low melting point agarose embedding block is 50-150 μL.

27. The method according to claim 25, wherein: The genome or metagenome provided in the form of a low-melting-point agarose embedding block is a bacterial genome or metagenome provided by the following method: embedding the bacterial body whose genome is to be extracted with low-melting-point agarose to form a low-melting-point agarose embedding block; then, treating the embedded bacterial body with lysozyme and proteinase K.

28. The method according to claim 27, wherein: The low melting point agarose embedding block contains 4 mg to 5 mg of the bacterial cells.

29. The method according to claim 27 or 28, wherein: The low melting point agarose embedding block is lysed with lysozyme for 1 to 2 hours.

30. The method according to claim 27 or 28, wherein: The low melting point agarose embedding block is digested with proteinase K for 2 to 6 hours until the embedding block is completely transparent.

31. The method according to any one of claims 1 to 5, wherein: In step (2), the cutting is performed at a temperature of 37° C. for 100 min-120 min.

32. The method according to any one of claims 1 to 4, wherein: When the sample is a genome or a metagenome, there is no need to separate and purify the target DNA fragments after cutting.

33. The method according to any one of claims 1 to 5, wherein: In step (1), the cleavage is performed in a buffer at pH 7.9; or, in step (2), the cleavage is performed in a buffer at pH 7.

9.

34. The method of claim 33, wherein: In step (1), the buffer is a hydrochloride buffer.

35. The method of claim 33, wherein: In step (1) and step (2), the buffer contains 10 mM to 50 mM Tris-HCl and 50 mM to 100 mM NaCl.

36. The method of claim 33, wherein: In step (1) and step (2), the buffer contains 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2 and 100 μg / mL bovine serum albumin.

37. The method according to any one of claims 1 to 5, wherein: In step (3), ligation is performed using T4 DNA ligase and Taq ligase.

38. The method according to any one of claims 1 to 5, wherein: In step (3), the target DNA fragment and the capture vector are mixed at a molar ratio of 2:1 to 1:10 for ligation.

39. The method of claim 25, wherein: In the case of using a low melting point agarose embedding block, before step (3), a step of digesting the low melting point agarose embedding block is included.

40. The method according to any one of claims 1 to 5, wherein: In step (3), when the enzyme used is T4 DNA ligase, the ligation is performed at a temperature of 4°C-25°C for 1-12 hours.

41. The method according to any one of claims 1 to 5, wherein: In step (3), the ligation product is transformed into the host cell by electroporation.

42. The method according to claim 41, wherein: Prior to electroporation, the ligation product was desalted.

43. The method according to any one of claims 1 to 5, wherein: The host cell is selected from Escherichia coli or yeast.

44. The method of claim 1, wherein: The length of the target DNA fragment is 50kb-140kb.

45. The method according to any one of claims 1 to 5, wherein: The sample is an actinomycete genome.

46. ​​The method of claim 45, wherein: The sample is a Streptomyces genome.

47. Use of the method of any one of claims 1 to 46 for cloning biosynthetic gene clusters.

48. The use according to claim 47, wherein: The biosynthetic gene cluster was predicted by antiSMASH.

49. An in vitro biosynthetic gene cluster (BGC) cloning method based on the CRISPR / Cas12a system, the method comprising: (1) BGC prediction: predict BGC through online tools; (2) Construction and cutting of capture vector: preparing homology arms at both ends of the BGC, and connecting the homology arms to the vector to obtain the capture vector, wherein the homology arms contain at least one PAM site that can be recognized by Cas12a; based on the crRNA that is at least partially complementary to the homology arm, using the Cas12a, the capture vector is cut to obtain a cut capture vector; (3) Preparation of BGC: Based on the crRNA and using the Cas12a, a sample containing the BGC is cut to obtain the BGC, Wherein, in step (3), the molar ratio of the BGC to the Cas12a protein is 1:50 to 1:2000, and the cleavage is performed in a hydrochloride buffer at a temperature of 35°C-38°C for 40min-120min, wherein the pH of the buffer is 7.5-8.0; and (4) Ligation and transformation: Ligating the cut capture vector with the BGC and transferring / introducing them into a host cell to obtain a recombinant host cell having the BGC. Wherein, the length of the BGC is 40kb-140kb, Wherein, the length of the homology arm is more than 100 bp; Wherein, the crRNA comprises a spacer sequence and a binding sequence, the spacer sequence can at least partially complementarily bind to the homology arm, and the binding sequence can bind to the Cas12a; wherein, the spacer sequence can at least partially complementarily bind to a continuous 15-50bp target nucleic acid sequence near the PAM in the homology arm, and the length of the spacer sequence is 15-50nt, and the length of the binding sequence is 16-32bp.

50. The method of claim 49, wherein: The sample is an actinomycete genome.

51. The method of claim 50, wherein: The sample is a Streptomyces genome.

Images