Random combinatorial library, establishment method thereof and application of random combinatorial library in screening H9 subtype avian influenza virus nano antibody

Abstract

The invention belongs to the technical field of nano antibody libraries, and particularly relates to a random combinatorial library, an establishment method thereof and application of the random combinatorial library in screening of H9 subtype avian influenza virus nano antibodies. The library is obtained by connecting a fragment containing a CDR1 region, a fragment containing a CDR2 region and a fragment containing a CDR3 region which are respectively amplified by three pairs of PCR amplification primers, and the sequences of the three pairs of PCR amplification primers are respectively SEQ ID NO: 1-SEQ ID NO: 6. The positive rate of the library is 95.8%, and the capacity of the library is 2.7 * 10 < 9 >. In the library, the positive rate of the nano antibody capable of being combined with the H9 subtype avian influenza virus is 60%. According to the invention, the blank of the random combinatorial library aiming at the H9 subtype avian influenza virus nano antibody is filled, and a new way and strategy are provided for the establishment of the random combinatorial library aiming at the H9 subtype avian influenza virus nano antibody.

Description

Technical Field

[0001] The invention belongs to the technical field of nano antibody libraries, and in particular relates to a random combination library and a method for establishing the library and the use of the library in screening nano antibodies of H9 subtype avian influenza virus. Background Art

[0002] The H9N2 subtype avian influenza virus is a low pathogenic avian influenza virus. Currently, the H9 subtype avian influenza has a high prevalence in China. Compared with H5 and H7 HPAIV, H9LPAIV can be latently infected clinically. When the external environment changes drastically or is infected by secondary infection, it can cause large-scale deaths in poultry. In addition to poultry, H9LPAIV can naturally infect mammals such as pigs, ferrets, guinea pigs and humans. Studies have shown that when H9 and H7N9, H5N1 and H5N6 subtypes are mixed, they can provide internal genes for HPAIV, accelerate the evolution of the virus, and produce new strains with epidemic potential, which increases the difficulty of influenza epidemic prevention and control and seriously endangers the health and safety of the public. In recent years, although the H9 subtype avian influenza vaccine has been promoted and used, which has significantly reduced the outbreak of the disease, the disease has shown new epidemic characteristics, such as the emergence of virus-carrying production, immune escape and mixed infection, which has complicated the prevention and control of H9 subtype avian influenza, caused huge direct and indirect economic losses, and faced new challenges in prevention and control. Seeking to prevent and control H9 subtype avian influenza has become a major scientific and practical problem that needs to be solved urgently. What is more noteworthy is that there is a lack of targeted prevention and control products for atypical symptoms in immune poultry flocks in the clinic. Therefore, it has become a top priority to develop safe, efficient, cheap and easy-to-standardize biological therapeutic preparations.

[0003] Nanobodies are antibody fragments composed only of a single heavy chain antibody variable region (VHH). The domain of nanobodies contains four conserved framework regions (FR) and three highly variable complementarity-determining regions (CDR). Nanobodies only exhibit the smallest functional antigen-binding active region. Nanobodies have the characteristics of small relative molecular mass, strong specificity, high affinity, high stability, good solubility, strong tissue permeability, low production cost, modular form, and weak immunogenicity, making nanobodies a hot topic in the current research field of developing new biological therapeutic agents.

[0004] At present, the libraries of nano antibodies mainly include natural libraries, immune libraries and random synthetic libraries, each of which is suitable for different antigens and has different advantages and disadvantages. However, there has been no report on the random combination library of nano antibodies against H9 subtype avian influenza virus. Summary of the invention

[0005] Therefore, in order to fill the gap in the random combinatorial library of nanobodies against H9 subtype avian influenza virus, the present invention proposes a random combinatorial library and a method for establishing the library and its use in screening nanobodies against H9 subtype avian influenza virus.

[0006] The technical solution adopted by the present invention to solve the technical problem is as follows:

[0007] A random combinatorial library of the present invention is obtained by connecting a fragment containing a CDR1 region, a fragment containing a CDR2 region and a fragment containing a CDR3 region respectively amplified by three pairs of PCR amplification primers, and the sequences of the three pairs of PCR amplification primers are SEQ ID NO: 1-SEQ ID NO: 6 respectively.

[0008] Preferably, the positive rate of the library is 95.8%.

[0009] Preferably, the library capacity is 2.7×10 9 indivual.

[0010] Preferably, in the library, the positive rate of nanobodies that can bind to H9 subtype avian influenza virus is 60%.

[0011] A method for establishing a random combinatorial library of the present invention comprises the following steps:

[0012] Using the cDNA shown in SEQ ID NO:7 as a template, three pairs of PCR amplification primers were used to amplify a fragment containing the CDR1 region, a fragment containing the CDR2 region, and a fragment containing the CDR3 region, respectively. Each of the recovered fragments was not a single band or a single sequence, but was formed by merging multiple sequences. The length of each fragment was 120 bp to 160 bp. The recovered fragments were connected by homologous recombinase, and then digested with the phage display plasmid pComb3XSS by restriction endonucleases Sac I and Spe I, and then connected with T4 ligase and transformed into Escherichia coli TG1 competent cells. The next day, a single colony was picked for bacterial liquid PCR identification, and the library was successfully established.

[0013] The invention discloses use of a random combinatorial library in screening nano antibodies against H9 subtype avian influenza virus.

[0014] The beneficial effects of the present invention are as follows:

[0015] The present invention successfully establishes a random combinatorial library of nanoantibodies against H9 subtype avian influenza virus, fills the gap in random combinatorial libraries of nanoantibodies against H9 subtype avian influenza virus, and provides a new approach and strategy for establishing random combinatorial libraries of nanoantibodies against H9 subtype avian influenza virus.

[0016] Compared with the positive rate of 70.8% (17 / 24) of the common library, the present invention improves the positive rate and diversity of the random combination library of nano antibodies against H9 subtype avian influenza virus.

[0017] Compared with the normal library capacity of 9.6×10 8 Compared with the above, the present invention increases the library capacity of the random combination library of nano antibodies against H9 subtype avian influenza virus.

[0018] Compared with the positive rate of 40% (20 / 50) of the common library, the present invention improves the positive rate of nano antibodies capable of binding to H9 subtype avian influenza virus in the random combination library of nano antibodies against H9 subtype avian influenza virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a schematic diagram of the VHH region composed of the conserved framework region FR and the highly variable complementarity determining region CDR in an interspersed arrangement of FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.

[0020] Figure 2 It is the identification result of the random combination library of nano antibodies against H9 subtype avian influenza virus established by the present invention and the common library.

[0021] Figure 3 It is the library capacity result of the random combination library of nano antibodies against H9 subtype avian influenza virus established by the present invention and the common library.

[0022] Figure 4 It is the identification result of the specific nano-antibodies of the random combination library of nano-antibodies against H9 subtype avian influenza virus and the common library established by the present invention. DETAILED DESCRIPTION

[0023] The following will be combined with the specific implementation of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the specific implementation described is only a part of the specific implementation of the present invention, not all of the specific implementation. Based on the specific implementation of the present invention, all other specific implementations obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] 1. Test Materials

[0025] The H9 subtype avian influenza inactivated vaccine HP strain was purchased from Sinopharm Yangzhou Weike Bioengineering Co., Ltd.;

[0026] 2-year-old male alpacas were purchased from Jiangsu Dengyuanhe Biotechnology Co., Ltd.;

[0027] Camel peripheral blood lymphocyte separation medium was purchased from Beijing Solebow Technology Co., Ltd.;

[0028] RNA extraction kit and reverse transcription kit were purchased from Nanjing Novozyme Biotechnology Co., Ltd.;

[0029] pComb3Xss plasmid was purchased from Nanjing Yifeixue Biotechnology Co., Ltd.;

[0030] Restriction endonucleases Sac I and Spe I were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.;

[0031] T4 ligase was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.;

[0032] Escherichia coli TG1 competent bacteria were purchased from Shanghai Weidi Biotechnology Co., Ltd.;

[0033] Homologous recombinase was purchased from Novozymes;

[0034] The phage display plasmid pComb3XSS was purchased from Nanjing Yifeixue Biotechnology Co., Ltd.

[0035] 2. Establishment of a VHH phage library for immunizing alpacas

[0036] 1. Inject the H9 subtype avian influenza inactivated vaccine HP strain into 2-year-old male alpacas by subcutaneous injection in the neck, with an injection volume of 2 mL / alpaca. Reinforce the immunization once on the 14th, 28th, 42nd and 56th days after immunization. Collect the peripheral blood of the alpacas on the 63rd day, separate the lymphocytes with camel peripheral blood lymphocyte separation solution, extract the RNA with RNA extraction kit and reverse transcription kit, and reverse transcribe it into cDNA. Amplify the heavy chain antibody variable region VHH sequence of the alpaca antibody through two rounds of nested PCR.

[0037] The primer sequences for the two-round nested PCR amplification are as follows:

[0038] The primers for the first round of PCR amplification are as follows:

[0039] CALL-1:GTCCTGGCTGCTCTTCTACAAGG;

[0040] CALL-2:GGTACGTGCTGTTGAACTGTTCC;

[0041] The second round of PCR primers are as follows

[0042] VHH-F: GAGCTCATGGATGTGCAGCTGGT;

[0043] VHH-R:ACTAGTTGAGGAGACGGTGACCT.

[0044] The above two rounds of nested PCR amplification primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0045] 2. The obtained VHH sequence and pComb3Xss plasmid were digested with restriction endonucleases Sac I and Spe I, and then ligated with T4 ligase and transformed into 10 competent E. coli TG1 strains. The next day, 20 single colonies were picked for bacterial liquid PCR. The results showed that 20 single colonies were positive, and after sequencing identification, the sequences of these 20 single colonies were different, which showed that the positive rate of the VHH phage library of the immune alpaca was 100% (20 / 20) and the diversity was rich (20 / 20). The VHH phage library of the immune alpaca was successfully established. According to the plate count and dilution ratio, it can be inferred that the library capacity of the VHH phage library of the immune alpaca is 4.8×10 8 indivual.

[0046] 3. Design of PCR primers for complementary determining regions (CDRs) in nanoantibodies targeting H9 subtype avian influenza virus

[0047] Twenty VHH sequences were randomly selected from the VHH phage library of the immune alpaca established above, and three pairs of PCR amplification primers were designed based on the 20 VHH sequence information. These three pairs of PCR amplification primers are primers for the complementary determining region (CDR) in the H9 subtype avian influenza virus nanoantibody (Table 1).

[0048] Table 1 Three pairs of PCR amplification primers

[0049] name sequence Primer 1 gagctcatgatgtgcagctgca Primer 2 tcacgctccttccctgg Primer 3 gggaaggagcgtgagt Primer 4 tgtctctggagatggtgaa Primer 5 ctccagagacaacgccaag Primer 6 actagtgatgaggagacggtgacct

[0050] 4. PCR amplification of the complementary determining region (CDR) in the H9 subtype avian influenza virus nanobody

[0051] Among the above three pairs of PCR amplification primers, primer 1 and primer 2 are used to amplify a fragment containing the CDR1 region, and the sequence of primer 1 contains Sac I and Spe I restriction sites; primer 3 and primer 4 are used to amplify a fragment containing the CDR2 region; primer 5 and primer 6 are used to amplify a fragment containing the CDR3 region, and the sequence of primer 6 contains Sac I and Spe I restriction sites.

[0052] Using the cDNA shown in SEQ ID NO:7 as a template, the above three pairs of PCR amplification primers were used to amplify a fragment containing the CDR1 region, a fragment containing the CDR2 region, and a fragment containing the CDR3 region, respectively. Each of the recovered fragments was not a single band or a single sequence, but was composed of a combination of multiple sequences. The length of each fragment was about 120bp to 160bp. Three representative fragment sequences were selected, namely SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10.

[0053] See also Figure 1 , 4 FRs (FR1, FR2, FR3, FR4) and 3 CDRs (CDR1, CDR2, CDR3) are arranged in an interspersed manner of FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 to form the VHH region.

[0054] 5. Establishment of a random combinatorial library of nanoantibodies against H9 subtype avian influenza virus

[0055] The fragments recovered above were connected by homologous recombination enzyme, and then digested with the phage display plasmid pComb3XSS by restriction endonucleases Sac I and Spe I, and then connected by T4 ligase and transformed into Escherichia coli TG1 competent cells. The next day, 24 single colonies were picked for bacterial liquid PCR identification. Figure 2 , all 24 single colonies picked were positive, and sequencing showed that the sequences of these 24 single colonies were different, indicating that the positive rate of the random combination library was about 95.8% (23 / 24), and the diversity was rich (23 / 23), and a random combination library of nanoantibodies against H9 subtype avian influenza virus was successfully established. Figure 3 According to the plate count and dilution ratio, the library capacity of the random combination library of nanoantibodies against H9 subtype avian influenza virus can be inferred to be 2.7×10 9 indivual.

[0056] Compared with the positive rate of 70.8% (17 / 24) of the common library, the present invention improves the positive rate and diversity of the random combination library of nano antibodies against H9 subtype avian influenza virus.

[0057] Compared with the normal library capacity of 9.6×10 8 Compared with the above, the present invention increases the library capacity of the random combination library of nano antibodies against H9 subtype avian influenza virus.

[0058] VI. Screening and identification process of H9 subtype avian influenza virus nanoantibodies

[0059] After the H9 subtype avian influenza inactivated vaccine HP strain was coated on the ELISA plate, the antibody library solid phase screening technology was used to screen out the VHH sequence that could bind to the H9 subtype avian influenza virus from the random combination library of nanoantibodies against the H9 subtype avian influenza virus.

[0060] ELISA test results can be found in Figure 4 The results show that the positive rate of nanoantibodies that can bind to H9 subtype avian influenza virus in the random combination library of nanoantibodies against H9 subtype avian influenza virus is 60% (30 / 50). Compared with the positive rate of 40% (20 / 50) of the common library, the present invention improves the positive rate of nanoantibodies that can bind to H9 subtype avian influenza virus in the random combination library of nanoantibodies against H9 subtype avian influenza virus.

[0061] From the above experiments and results, it can be seen that the present invention has successfully established a random combinatorial library of nanoantibodies against H9 subtype avian influenza virus, the positive rate of which is 95.8% (23 / 24) and the library capacity is 2.7×10 9 Compared with the common library, the positive rate and library capacity of this random combination library are higher.

[0062] In the random combination library of nano antibodies against H9 subtype avian influenza virus established by the present invention, the positive rate of nano antibodies capable of binding to H9 subtype avian influenza virus is 60% (30 / 50). Compared with ordinary libraries, the random combination library has more specific nano antibodies.

[0063] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned specific implementation methods, those skilled in the art should understand that they can still modify the technical solutions recorded in the aforementioned specific implementation methods, or make equivalent replacements for some of the technical features therein, but these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the specific implementation methods of the present invention.

Claims

1. A random combinatorial library, characterized in that The library is obtained by connecting a fragment containing the CDR1 region, a fragment containing the CDR2 region and a fragment containing the CDR3 region respectively amplified by three pairs of PCR amplification primers, and the sequences of the three pairs of PCR amplification primers are SEQ ID NO: 1-SEQ ID NO: 6 respectively.

2. A random combinatorial library according to claim 1, characterized in that The positive rate of the library was 95.8%.

3. A random combinatorial library according to claim 1, characterized in that The library capacity is 2.7×10 9 indivual.

4. A random combinatorial library according to claim 1, characterized in that In the library, the positive rate of nano antibodies that can bind to H9 subtype avian influenza virus is 60%.

5. The method for establishing a random combinatorial library according to claim 1, characterized in that: The following steps are involved: Using the cDNA shown in SEQ ID NO:7 as a template, three pairs of PCR amplification primers were used to amplify a fragment containing the CDR1 region, a fragment containing the CDR2 region, and a fragment containing the CDR3 region, respectively. Each of the recovered fragments was not a single band or a single sequence, but was formed by merging multiple sequences. The length of each fragment was 120 bp to 160 bp. The recovered fragments were connected by homologous recombinase, and then digested with the phage display plasmid pComb3XSS by restriction endonucleases Sac I and Spe I, and then connected with T4 ligase and transformed into Escherichia coli TG1 competent cells. The next day, a single colony was picked for bacterial liquid PCR identification, and the library was successfully established.

6. Use of a random combinatorial library as claimed in claim 1 in screening nanobodies against H9 subtype avian influenza virus.

Images