A simple, efficient and tissue culture-free induction method for obtaining root olive composite plants

Abstract

The present invention relates to the field of crop genetic transformation, and in particular to a simple, efficient and tissue culture-free induction method for obtaining root olive composite plants. The method uses olive seedlings as explants, uses rhizogenes carrying reporter genes and target genes to inject and infect the explants, and then transfers the infected explants to a culture matrix for cultivation; the olive seedlings are olive seedlings with radicle lengths ≥1 cm and <1.5 cm. The method solves the problems of long cycles, low conversion rates, complex operations, and long-term occupation of experimental equipment consumables and human resources in the original olive genetic transformation system, and can achieve the technical effect of obtaining transgenic materials quickly, efficiently, simply and at low cost, providing a more convenient and efficient way for olive genetic transformation.

Description

Technical Field

[0001] The invention relates to the field of crop genetic transformation, and in particular to a simple, efficient and tissue culture-free induction method for obtaining root olive composite plants. Background Art

[0002] Olive (Canarium album L.) is a specialty agricultural product with great development potential in Guangdong. Olives are mostly grown in mountainous and hilly areas with relatively poor soil. Their yield and quality are significantly limited by environmental stress. There is an urgent need to establish olive germplasm with broad-spectrum resistance. The olive genetic transformation system is not only the most important tool for the study of the function of resistance-related genes, but also an important prerequisite for the precise molecular breeding of resistant rootstocks. It is of great significance to the establishment of olive germplasm with broad-spectrum resistance. At present, the mainstream idea of ​​establishing the olive genetic transformation system is to obtain transgenic plants through co-cultivation of Agrobacterium under tissue culture conditions. Although there is a genetic system in the prior art that uses young olive tissues for tissue culture to obtain transgenic materials, the genetic system mainly has the following bottlenecks and defects, which make it extremely difficult to obtain transgenic materials:

[0003] 1. Long cycle and low conversion rate: Due to the long germination time of olive seeds and the inhibitory effect of polyphenol oxides in olive tissue on Agrobacterium, the germination rate under tissue culture conditions is low, which ultimately leads to a prolonged conversion cycle, increased risks of infection and necrosis, and a low conversion rate;

[0004] 2. The operation is complex and the experimental requirements are strict, which occupies a lot of human resources: Under tissue culture conditions, the process of obtaining transgenic plants through co-cultivation with Agrobacterium is very complex and requires strict control of various parameters of the growth environment during the transformation process, including oxygen content, hormone concentration, mineral nutrient concentration and pH value. These operations require high technical proficiency of full-time technicians, and this process occupies a lot of human resources;

[0005] 3. Long-term occupation of experimental equipment and consumables: In the process of culturing cells, some important instruments and equipment need to be occupied for a long time, such as incubators and clean benches; at the same time, a large number of consumables are also needed to support the experiment, such as culture dishes, culture media, centrifuge tubes and pipette tips.

[0006] Therefore, it is necessary to establish a simple, low-cost and efficient olive genetic transformation system. Summary of the invention

[0007] The purpose of the present invention is to provide a simple, efficient and tissue culture-free induction method for obtaining rooted olive composite plants, so as to solve the problems existing in the above-mentioned prior art. The present invention improves the three defects existing in the existing olive genetic transformation technology, and successfully realizes the technical solution of obtaining transgenic composite plants (composite plants containing transgenic hairy roots) without relying on tissue culture. By using olive seedlings germinated in sand culture as materials, under open experimental conditions, high-temperature sterilized quartz sand mixed with vermiculite is used as the culture matrix, and a sterile syringe needle is used to dip the recombinant Agrobacterium rhizogenes K599 and inject the seedling hypocotyls, and the transgenic hairy roots are obtained by multiple infection of the hypocotyl wounds, a simple, low-cost and efficient Agrobacterium rhizogenes K599-mediated olive genetic transformation system is established.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a simple, efficient and tissue culture-free induction method for obtaining root olive composite plants, comprising the following steps:

[0010] Olive seedlings are used as explants, and the explants are infected by injection using Agrobacterium rhizogenes carrying a reporter gene and a target gene, and then the infected explants are transferred to a culture medium for culture;

[0011] The olive seedlings are olive seedlings with a radicle length of ≥1 cm and <1.5 cm.

[0012] Preferably, the activation method of the Agrobacterium rhizogenes carrying the reporter gene and the target gene is to spread the Agrobacterium rhizogenes carrying the reporter gene and the target gene on a YEP solid culture medium containing 50 mg / L spectinomycin, and culture at 28° C. for 24 hours.

[0013] Preferably, the Agrobacterium rhizogenes is Agrobacterium rhizogenes K599.

[0014] Preferably, the injection infection is performed three times.

[0015] Preferably, the culture matrix includes quartz sand and vermiculite; the volume ratio of the quartz sand to the vermiculite is 1:1.

[0016] Preferably, the culture matrix covers the wound site of the pre-treated olive seedlings.

[0017] Preferably, after the infected explants are transferred to the culture matrix, a film-covering step is also included.

[0018] Preferably, the culturing includes dark culturing and re-culturing; the dark culturing time is 2 days at a temperature of 25°C; the re-culturing time is 15-25 days at a temperature of 25°C.

[0019] The present invention discloses the following technical effects:

[0020] The present invention establishes an olive genetic transformation system without tissue culture. The present invention uses olive seedlings with a radicle length of 1-1.5 cm as experimental materials, and high-temperature sterilized quartz sand mixed with vermiculite as a culture matrix. A sterile syringe needle is used to dip recombinant rhizogenes Agrobacterium K599 for injection and infection of the seedling hypocotyl. After injection and infection, the infected seedling wound is directly covered with the bacteria, and the recombinant rhizogenes Agrobacterium K599 carrying the GUS reporter gene is used to infect the seedling wound to induce the generation of hairy roots, which solves the problems of long cycle, low conversion rate, complex operation, long-term occupation of experimental equipment consumables and human resources in the original olive genetic transformation system, and achieves the technical effect of obtaining transgenic materials quickly, efficiently, simply and with low consumption, and provides a more convenient and efficient way for olive genetic transformation. The present invention mainly includes the following key points and technical effects:

[0021] (1) Sterilized quartz sand was used to germinate olive seeds, and olive seedlings with a radicle length of 1-1.5 cm were selected as experimental materials, which ensured the vitality of the materials and reduced the mortality of seedlings during the treatment process, increased the incidence and positive rate of hairy roots, and reduced the contamination rate of the materials. Within 15-25 days, composite olive plants containing hairy roots can be obtained, and the positive rate of hairy roots exceeds 70%; (2) Recombinant root-generating Agrobacterium K599 was used to induce olive seedlings to generate hairy roots under relatively open environmental conditions, avoiding the complex process of tissue culture steps and strict experimental conditions in the Agrobacterium tumefaciens transformation system, and providing a simple and efficient way to obtain transgenic olive materials; (3) Solid YEP culture medium was used to activate recombinant root-generating Agrobacterium, which simplified the steps of vacuum infection of liquid bacteria, prolonged the time for bacterial infection of seedling wounds, and increased the incidence and positive rate of hairy roots; (4) The activation time of recombinant root-generating Agrobacterium K599 was 24h Under these conditions, the incidence and positive rate of hairy roots in olive seedlings were both high; (5) Recombinant root-inducing Agrobacterium K599 was dipped into a sterile syringe needle and injected into the hypocotyl of the seedling. After injection, the infected wound of the seedling was directly covered with the bacteria. The infection step was repeated one week after a single infection, and a total of 3 infections were performed, which increased the incidence and positive rate of hairy roots; (6) By using the bar marker gene and GUS marker protein, rapid and high-throughput detection of positive hairy roots was achieved; (7) High-temperature sterilized quartz sand mixed with vermiculite was used as the culture medium, and sterile water was sprayed for moisturizing, which effectively ensured the air permeability and water retention of the matrix and reduced the contamination rate and mortality rate of the experimental materials.

[0022] It can be seen that the present invention establishes a simple, low-consumption, low-cost, high-efficiency olive genetic transformation system mediated by Agrobacterium rhizogenes K599 that can achieve high-throughput processing. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 The effects of different olive seedling materials on olive transformation efficiency; A is the incidence of hairy roots; B is the root hair positive rate;

[0025] Figure 2 The effect of different activation time of Agrobacterium rhizogenes K599 on the transformation efficiency of olives; A is the incidence of hairy roots; B is the root hair positive rate;

[0026] Figure 3 The figure is an experimental flow chart; A is the activation of recombinant Agrobacterium rhizogenes K599 (abbreviated as Agrobacterium); B is the germination of olive seeds by sand culture; C is the treatment and infection of olive seedlings with recombinant Agrobacterium rhizogenes K599 (K599); D is the wound covering with recombinant Agrobacterium rhizogenes K599; E is dark culture; F is artificial incubator culture; G is the positive transgenic olive composite plant;

[0027] Figure 4 This is the electrophoresis diagram of Bar gene PCR detection; the first band is the marker, the second and third bands are positive plants, and the fourth band is the control, i.e., the wild-type olive plant;

[0028] Figure 5 It is a positive hairy root GUS staining detection picture; A is the control (wild-type olive seedlings), B is the positive (transgenic olive plants);

[0029] Figure 6 These are the effects of infection with the recombinant Agrobacterium rhizogenes K599 activated by liquid; A is the wound infected with the liquid culture medium containing the recombinant Agrobacterium rhizogenes K599, B is the death of the seedlings after multiple infections, and the picture on the right is an enlarged picture of the red box in the picture on the left. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] Example 1 Effect of different olive seedling materials on olive transformation efficiency

[0036] In order to study whether there are differences in genetic transformation efficiency among different olive seedling materials, we selected olive seedlings with radicle lengths ranging from 1 cm ≤ radicle length < 1.5 cm (1-1.5 cm), 1.5 cm ≤ radicle length < 2 cm (1.5-2 cm), and 2 cm ≤ radicle length < 2.5 cm (2-2.5 cm) for experiments. The specific experimental steps are as follows:

[0037] (1) Agrobacterium rhizogenes transformation

[0038] The Agrobacterium rhizogenes used in the experiment was Agrobacterium rhizogenes K599, and the vector was pTF102 containing the GUS reporter gene. The competent cells of Agrobacterium rhizogenes K599 were transformed by freeze-thaw method, and then added to 0.5mL YEP liquid culture medium, cultured at 28℃ for 1h, and then about 50μL of bacteria were pipetted with a pipette and spread on a YEP solid plate containing 50mg / L spectinomycin, and cultured at 28℃ for 2d. A single colony was picked, and after sequencing and verification, it was stored at -80℃ for standby use, which was the recombinant Agrobacterium rhizogenes K599.

[0039] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0040] Recombinant Agrobacterium rhizogenes K599 was taken out from the -80℃ refrigerator and inoculated on YEP solid medium containing 50mg / L spectinomycin. It was cultured at 28℃ for 24h. The effective viable count of the culture was 10 9 CFU / mL.

[0041] (3) Olive germination in sand culture and further multiple infection with recombinant Agrobacterium rhizogenes K599

[0042] Olive seeds treated in a 55°C water bath for 10 min were transferred to sterilized quartz sand for germination. After germination, olive seedlings with different radicle lengths and good growth conditions were selected, including seedlings with different radicle lengths. Then, the recombinant Agrobacterium K599 was injected into the hypocotyl of the seedling using a sterile syringe needle. After the injection infection, the infected seedling wound was directly covered with the bacteria. After a single infection, the olive seedlings were transferred to a culture matrix composed of sterilized quartz sand and sterilized vermiculite in a volume ratio of 1:1. The wound site was covered with a matrix, and then the seedlings were covered with a layer of plastic wrap. Water was sprayed several times a day to keep the matrix moist, and the dark treatment was cultured for 2 days. After a single infection, the infection steps were repeated (each infection process first shaved the matrix of the wound site, and then covered with the matrix to keep it moist after the infection), and the infection was carried out 3 times in total. After infection for three times, the seedlings were moved to an artificial climate chamber for cultivation. The cultivation parameters were as follows: light duration of 12 h / d, light intensity of 800 μmol / m - 2 s -1 , temperature was 25°C, culture time was 15 days, inducing the formation of hairy roots and obtaining transgenic olive composite plants.

[0043] Afterwards, the positive identification of transgenic plants was carried out, and the DNA in the hairy roots was extracted by the CTAB method. Specifically, after the hairy roots of the transgenic olive composite plants were formed, about 0.05 g of hairy roots were taken into a 1.5 mL centrifuge tube, and 1000 μL CTAB (CTAB contains: 12.114 g / L Tris, 7.44 g / L EDTA-Na2, 81.9 g / L NaCl, 20 g / L CTAB, 10 g / L PVP-40), after adding steel beads to the centrifuge tube, the sample was completely broken, heated in a water bath at 65°C for 30 minutes, allowed to stand and cool, an equal volume of chloroform: isoamyl alcohol mixture (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1) was added, mixed and allowed to stand for 5 minutes, centrifuged at 12000rpm for 8 minutes, the supernatant was aspirated into a new 1.5mL centrifuge tube, 2 / 3 volume ratio of isopropanol was added, mixed and allowed to stand for 10 minutes, centrifuged at 12000rpm for 5 minutes, the supernatant was discarded, the DNA was washed twice with 70% (volume percentage) ethanol, air-dried on a clean bench, 10μL ddH2O was added to dissolve the DNA and the concentration was determined.

[0044] Then, Bar gene PCR detection was performed, specifically: PCR identification was performed using Bar gene primers (F: CAACCACTACATCGAGACAAGCA, SEQ ID NO.1; R: TCATCAGATCTCGGTGACGGG, SEQ ID NO.2), and the PCR program was set to: 94°C 3min, 30 repeated cycles (specifically including: 94°C 30s, 60°C 30s, 72°C 1min), 72°C 10min, and the hairy roots that could amplify a Bar gene band of about 50bp were positive.

[0045] The results are as follows Figure 1 As shown in the figure, the transformation effect of olive seedlings with radicle length ≥1cm and <1.5cm was the best, with the hairy root incidence rate reaching 70% and the hairy root positive rate reaching 74%. Therefore, in the subsequent transformation experiments, we chose to use olive seedlings with radicle length ≥1cm and <1.5cm as the material for genetic transformation.

[0046] Example 2 Analysis of the effect of different activation times of recombinant Agrobacterium rhizogenes K599 on olive transformation efficiency

[0047] In order to determine the activation time of the recombinant Agrobacterium rhizogenes K599 with the highest genetic transformation efficiency, the present invention uses the recombinant Agrobacterium rhizogenes K599 activated for 24h, 48h and 72h to genetically transform olive seedlings.

[0048] (1) Agrobacterium rhizogenes transformation

[0049] Same as Example 1.

[0050] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0051] Recombinant Agrobacterium rhizogenes K599 was taken out from the -80℃ refrigerator and inoculated on YEP solid medium containing 50 mg / L spectinomycin. It was cultured at 28℃ for 24 h (1d), 48 h (2d) and 72 h (3d). The effective viable counts of the cultures were 10 9 CFU / mL, 10 11 CFU / mL and 10 15 CFU / mL.

[0052] (3) Olive germination in sand culture and further multiple infection with recombinant Agrobacterium rhizogenes K599

[0053] The olive seeds treated in a 55°C water bath for 10 minutes were transferred to sterilized quartz sand for germination. After germination, olive seedlings with radicle length ≥1 cm and <1.5 cm and good growth status were selected. Then, a sterile syringe needle was used to dip the recombinant Agrobacterium K599 with different activation times and injected to infect the hypocotyls of the seedlings respectively. The remaining steps were the same as in Example 1 to obtain transgenic olive composite plants.

[0054] Then, positive identification of transgenic plants and PCR detection of Bar gene were performed, and the steps were the same as those in Example 1.

[0055] The results are as follows Figure 2 As shown in the figure, the recombinant Agrobacterium rhizogenes K599 activated for 24 hours had the highest genetic transformation efficiency, with a hairy root incidence rate of 71% and a hairy root positive rate of 75%. Therefore, in subsequent transformation experiments, we uniformly used recombinant Agrobacterium rhizogenes K599 activated for 24 hours for genetic transformation to improve transformation efficiency.

[0056] Example 3 Analysis of olive transformation efficiency with different explants

[0057] In order to study whether there are differences in the genetic transformation efficiency of different olive explants, we selected olive stem tips, new shoots with buds from strong olive plants, olive petioles, and olive seedlings with radicle lengths ranging from 1 cm ≤ radicle length to < 1.5 cm and in good growth condition for the experiment. The specific experimental steps are as follows:

[0058] (1) Agrobacterium rhizogenes transformation

[0059] Same as Example 1.

[0060] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0061] Example 1.

[0062] (3)Explant

[0063] The length of olive stem tip, new shoots with buds from healthy olive plants, olive petioles and radicles should be 1 cm ≤ the length of radicles.

[0064] Olive seedlings within the range of <1.5cm and in good growth condition.

[0065] (4) Inducing the formation of transgenic hairy roots

[0066] Afterwards, a sterile needle was used to pick up the recombinant Agrobacterium rhizogenes K599 and then injected to infect different explants. The subsequent steps were the same as in Example 1 to obtain transgenic olive composite plants.

[0067] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The results are shown in Table 1. As shown in Table 1, transgenic hairy roots could not be obtained within 15 days from olive stem tips, new shoots with buds grown from healthy olive plants in the same year, and olive petioles. This shows that different explants have a great influence on the transformation efficiency of olives.

[0068] Table 1 Analysis of transformation efficiency of olive with different explants

[0069] Olive seedlings Olive stem tip The new shoots with buds that grow from healthy olive plants in the current year Olive petiole Hair root incidence (%) 70 0 0 0 Hair root positive rate (%) 72 0 0 0

[0070] Example 4 Analysis of olive transformation efficiency with different Agrobacterium rhizogenes

[0071] In order to study whether there are differences in the genetic transformation efficiency of olives by different rhizogenes, we selected different rhizogenes for experiments. The specific experimental steps are as follows:

[0072] (1) Agrobacterium rhizogenes transformation

[0073] The Agrobacterium rhizogenes used in the experiment were Agrobacterium rhizogenes K599, MSU440 and ATCC15834, and the vector was pTF102 containing the GUS reporter gene. The competent Agrobacterium rhizogenes was transformed by the freeze-thaw method, and then added to 0.5 mL of YEP liquid culture medium, shaken and cultured at 28°C for 1 hour, and then about 50 μL of the bacteria were pipetted with a pipette and spread on a YEP solid plate containing 50 mg / L spectinomycin, and cultured at 28°C for 2 days. A single colony was picked, and after sequencing and verification, it was stored at -80°C for standby use, which was the recombinant Agrobacterium rhizogenes.

[0074] (2) Activation of recombinant Agrobacterium rhizogenes

[0075] Same as Example 1.

[0076] (3) Olive germination in sand culture and further multiple infection with recombinant Agrobacterium rhizogenes

[0077] Olive seeds treated in a 55°C water bath for 10 min were transferred to sterilized quartz sand for germination. After germination, olive seedlings with radicle length ≥1 cm and <1.5 cm and good growth status were selected. Then, different recombinant Agrobacterium were injected into the hypocotyls of the seedlings using a sterile syringe needle. After the injection infection, the infected seedling wounds were directly covered with the bacteria. After a single infection, the olive seedlings were transferred to a culture matrix composed of sterilized quartz sand and sterilized vermiculite in a volume ratio of 1:1. The wound site was covered with a matrix, and then the seedlings were covered with a layer of plastic wrap. Water was sprayed several times a day to keep the matrix moist, and the dark treatment was cultured for 2 days. After a single infection, the infection steps were repeated (each infection process was to first open the matrix of the wound site, and then cover the matrix to keep it moist after the infection), and the infection was carried out 3 times in total. After infection for three times, the seedlings were moved to an artificial climate chamber for cultivation. The cultivation parameters were as follows: light duration of 12 h / d, light intensity of 800 μmol / m -2 s -1 , temperature was 25°C, culture time was 20 days, inducing the formation of hairy roots and obtaining transgenic olive composite plants.

[0078] Afterwards, positive identification of transgenic plants and Bar gene PCR detection were performed. The survey results are shown in Table 2. As shown in Table 2, the hairy root incidence and hairy root positive rate of Agrobacterium rhizogenes K599 were both above 70%, while the hairy root incidence and hairy root positive rate of Agrobacterium rhizogenes MSU440 and Agrobacterium rhizogenes ATCC 15834 were both below 63%. Therefore, we chose Agrobacterium rhizogenes K599.

[0079] Table 2 Analysis of transformation efficiency of olives by different Agrobacterium rhizogenes

[0080] Recombinant Agrobacterium rhizogenes K599 Recombinant Agrobacterium rhizogenes MSU440 Recombinant Agrobacterium rhizogenes ATCC15834 Hair root incidence (%) 71 61 63 Hair root positive rate (%) 73 62 63

[0081] Example 5 Effects of different activation methods of recombinant Agrobacterium rhizogenes K599 on olive transformation efficiency

[0082] In order to study whether different activation methods of different recombinant Agrobacterium rhizogenes K599 have different effects on the genetic transformation efficiency of olives, we selected two methods, solid activation and liquid activation, for experiments. The specific experimental steps are as follows:

[0083] (1) Agrobacterium rhizogenes transformation

[0084] Same as Example 1.

[0085] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0086] Solid activation: Take out the recombinant Agrobacterium rhizogenes K599 from the -80℃ refrigerator, inoculate it on the YEP solid medium containing 50mg / L spectinomycin, and culture it at 28℃ for 24h. The effective viable count of the culture is 10 9 CFU / mL;

[0087] Liquid activation: Take out the recombinant Agrobacterium rhizogenes K599 from the -80℃ refrigerator, inoculate it in YEP liquid medium containing 50mg / L spectinomycin, and culture it at 28℃ for 24h. The effective viable count of the culture is 10 9 CFU / mL.

[0088] (3) Olive germination in sand culture and further multiple infection with recombinant Agrobacterium rhizogenes K599

[0089] Olive seeds treated in a 55°C water bath for 10 min were transferred to sterilized quartz sand for germination. After germination, olive seedlings with radicle length ≥1 cm and <1.5 cm and good growth status were selected. Then, the recombinant Agrobacterium obtained by different activation methods was injected into the hypocotyls of the seedlings using a sterile syringe needle. After injection infection, the wound of the seedlings was directly covered with solid activated bacteria, while the wound of the seedlings was infected by liquid activated Agrobacterium in the form of watering. After a single infection, the olive seedlings were transferred to a culture matrix composed of sterilized quartz sand and sterilized vermiculite in a volume ratio of 1:1. The wound site was infected with bacteria, and then the seedlings were covered with a layer of plastic wrap, and water was sprayed several times a day to keep the matrix moist, and the dark treatment was cultured for 2 days. After a single infection, the infection steps were repeated (each infection process first shaved the matrix of the wound site, and then covered with the matrix to keep it moist after infection), and a total of 3 infections were carried out. After infection for three times, the seedlings were moved to an artificial climate chamber for cultivation. The cultivation parameters were as follows: light duration of 12 h / d, light intensity of 800 μmol / m -2 s -1 , the temperature was 25℃, the culture time was 25 days, hairy roots were induced, and transgenic olive composite plants were obtained.

[0090] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The test results are shown in Table 3 and Figure 6 From Table 3 and Figure 6 It is known from the records that the root hair incidence and root hair positive rate of Agrobacterium K599 obtained by solid activation reached about 73%, while the root hair growth rate of Agrobacterium K599 obtained by liquid activation did not promote the generation of root hairs in the wound on the 25th day after multiple infection of the wound, and caused the death of many seedlings. The reason may be that the liquid bacterial solution stayed in the wound for a short time, and a large amount of liquid YEP entered the soil and bred harmful microorganisms, which led to the death of some seedlings. Therefore, we chose the solid method to activate the recombinant Agrobacterium K599.

[0091] Table 3 Analysis of transformation efficiency of olive by Agrobacterium rhizogenes K599 obtained by different activation methods

[0092] Solid Activation Liquid Activation Hair root incidence (%) 73 0 Hair root positive rate (%) 75 0

[0093] Example 6 Effect of infection times of recombinant Agrobacterium rhizogenes K599 on olive transformation efficiency

[0094] In order to study whether the infection times of recombinant Agrobacterium rhizogenes K599 have any difference on the genetic transformation efficiency of olive, we selected 1 infection, 3 infections and 4 infections for experiments. The specific experimental steps are as follows:

[0095] (1) Agrobacterium rhizogenes transformation

[0096] Same as Example 1.

[0097] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0098] Same as Example 1.

[0099] (3) Olive germination in sand culture and further multiple infection with recombinant Agrobacterium rhizogenes K599

[0100] The olive seeds treated in a 55°C water bath for 10 minutes were transferred to sterilized quartz sand for germination. After germination, olive seedlings with radicle length ≥1 cm and <1.5 cm and good growth status were selected. Then, different recombinant Agrobacterium were injected and infected into the hypocotyls of the seedlings using a sterile syringe needle. The infection times were 1, 3 and 4 respectively. The remaining steps were the same as in Example 1 to obtain transgenic olive composite plants.

[0101] Afterwards, positive identification of transgenic plants and Bar gene PCR detection were performed. The test results are shown in Table 4. As shown in Table 4, the root hair incidence and root hair positive rate were the highest when the recombinant rhizogenes Agrobacterium K599 was infected three times, followed by one infection, and finally four infections. The reason for the low root incidence and root hair positive rate after one infection may be that the number of recombinant rhizogenes Agrobacterium K599 on the surface of the receptor cells is insufficient, resulting in low root incidence and root hair positive rate; the reason for the low root incidence and root hair positive rate after four infections may be that too many infections will increase the mortality rate of seedlings and reduce the overall root hair incidence rate, competitive inhibition will occur between recombinant rhizogenes Agrobacterium K599, and excessive proliferation of recombinant rhizogenes Agrobacterium K599 will inhibit the respiration of receptor cells, thereby resulting in low root incidence and root hair positive rate.

[0102] Table 4 Analysis of transformation efficiency of olives at different infection times

[0103] 1 time 3 times 4 times Hair root incidence (%) 50 74 42 Hair root positive rate (%) 13 75 45

[0104] Example 7

[0105] 1. Obtaining transgenic olive composite plants

[0106] The experimental process is detailed in Figure 3 , specifically:

[0107] (1) Agrobacterium transformation

[0108] The Agrobacterium rhizogenes used in the experiment was Agrobacterium rhizogenes K599, and the vector was pTF102 containing the GUS reporter gene. The competent cells of Agrobacterium rhizogenes K599 were transformed by freeze-thaw method, added to 0.5 mL of YEP liquid medium, cultured at 28 ° C for 1 h, and then 50 μL of the bacteria were pipetted and spread on a YEP solid plate containing 50 mg / L spectinomycin, and cultured at 28 ° C for 2 days. A single colony was picked, and after sequencing and verification, it was stored at -80 ° C for standby use, which was the recombinant Agrobacterium rhizogenes K599.

[0109] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0110] Recombinant Agrobacterium rhizogenes K599 was taken out from the -80℃ refrigerator, inoculated on YEP solid medium containing 50 mg / L spectinomycin, and cultured at 28℃ for 24 h ( Figure 3 A), the effective viable count of the culture is 10 9 CFU / mL.

[0111] (3) The olive seeds that had been treated in a 55°C water bath for 10 min were transferred to sterilized quartz sand for germination. Figure 3 B). After germination, select olive seedlings with radicle length ≥1 cm and <1.5 cm and good growth status. Then, use a sterile syringe needle to dip the recombinant Agrobacterium K599 and inject it into the hypocotyl of the seedling ( Figure 3 C), after injection infection, the infected seedling wound is directly covered with bacteria ( Figure 3 D in the figure). After a single infection, the olive seedlings were transferred to a culture medium composed of sterilized quartz sand and sterilized vermiculite in a volume ratio of 1:1. The wound site was covered with the medium, and then the seedlings were covered with a layer of plastic wrap. The medium was sprayed with water several times a day to keep it moist, and the culture was kept in the dark for 2 days ( Figure 3 E). After a single infection, the infection steps were repeated (each time the wound matrix was first shaved open and then covered with matrix to keep moisture), for a total of 3 times. After 3 infections, the seedlings were moved to an artificial climate chamber for cultivation. The cultivation parameters were: light duration of 12 h / d, light intensity of 800 μmol / m -2 s -1 , temperature is 25℃, and the incubation time is 15 days ( Figure 3 F in the , induced the generation of hairy roots, and obtained transgenic olive composite plants ( Figure 3 G in.

[0112] 2. Positive identification of transgenic plants

[0113] (1) Bar gene PCR detection

[0114] DNA extraction from hairy roots using CTAB method

[0115] After the hairy roots of the transgenic olive composite plants were formed, about 0.05 g of hairy roots were taken into a 1.5 mL centrifuge tube and 1000 μL of CTAB (CTAB contains: 12.114 g / L Tris, 7.44 g / L EDTA-Na2, 81.9 g / L NaCl, 20 g / L CTAB, 10g / LPVP-40), after adding steel beads to the centrifuge tube, the sample was completely crushed, heated in a water bath at 65°C for 30min, allowed to stand and cool, an equal volume of chloroform: isoamyl alcohol mixture (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1) was added, mixed and allowed to stand for 5min, centrifuged at 12000rpm for 8min, the supernatant was aspirated into a new 1.5mL centrifuge tube, 2 / 3 volume ratio of isopropanol was added, mixed and allowed to stand for 10min, centrifuged at 12000rpm for 5min, the supernatant was discarded, the DNA was washed twice with 70% (volume percentage) ethanol, air-dried on a clean bench, 10μL ddH2O was added to dissolve the DNA and the concentration was determined.

[0116] Bar gene PCR detection

[0117] PCR identification was performed using Bar gene primers, and the PCR program was set as: 94°C for 3 min, 30 repeated cycles (specifically including: 94°C for 30 s, 60°C for 30 s, 72°C for 1 min), 72°C for 10 min. The roots that could amplify a Bar gene band of about 50 bp were positive roots, and the positive roots were retained for subsequent GUS staining experiments. At the same time, some negative roots were retained as controls for subsequent experiments.

[0118] (2) GUS staining verification

[0119] Rinse the hair roots twice with secondary water, and then transfer them to GUS staining solution (the formula of GUS staining solution: 1mM X-Gluc and 0.1M Na2HPO4 / NaH2PO4, pH 7.2). Then, vacuum the sample for 40 minutes and transfer it to 37°C to stain overnight in the dark. The stained hair roots are positive hair roots, which are transferred to 75% (volume percentage) ethanol for storage, and their staining is observed and photographed using a stereo microscope.

[0120] (3) Results:

[0121] DNA from olive hairy roots was extracted and conventional PCR was performed using Bar gene primers. The hairy roots that could amplify a Bar gene band of about 500 bp were positive, while the DNA from the roots of wild-type olive seedlings could not extend the Bar gene band ( Figure 4 ).

[0122] Further GUS staining of the hairy roots showed good GUS activity staining effect in the positive hairy roots, while the roots of wild-type olive seedlings could not be stained. Through stereomicroscope observation, it can be observed that the GUS tag protein can be stably expressed in the hairy roots and has strong expression in all parts of the root system ( Figure 5 )

[0123] The above experimental results show that the technical path of using recombinant Agrobacterium rhizogenes K599 to transform olive seedling materials under tissue culture-free conditions to obtain transgenic composite plants is feasible, simple and efficient. The present invention uses olive seedlings germinated in sand culture as materials, and high-temperature sterilized quartz sand mixed with vermiculite as the culture matrix. Under relatively open experimental conditions, through multiple injections and covering infections, recombinant Agrobacterium rhizogenes K59 is used to induce seedling wounds to form transgenic hairy roots, and then the Bar gene and GUS tag protein stably expressed in the positive hairy roots are used to quickly and efficiently identify the positive hairy roots. Compared with previous olive genetic transformation methods, this method does not require tissue culture, shortens the transformation cycle, improves the transformation efficiency, and also reduces the consumption of experimental equipment, consumables and manpower.

[0124] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for inducing root olive composite plants without tissue culture, It is characterized in that The following steps are involved: Olive seedlings are used as explants, and the explants are infected by injection using Agrobacterium rhizogenes carrying a reporter gene and a target gene, and then the infected explants are transferred to a culture medium for culture; The olive seedlings are olive seedlings with a radicle length of ≥1 cm and <1.5 cm; The activation method of the Agrobacterium rhizogenes carrying the reporter gene and the target gene is to spread the Agrobacterium rhizogenes carrying the reporter gene and the target gene on a YEP solid culture medium containing 50 mg / L spectinomycin, and culture at 28° C. for 24 hours; The Agrobacterium rhizogenes is Agrobacterium rhizogenes K599; The number of injections and infections was 3 times; The culture matrix includes quartz sand and vermiculite; the volume ratio of the quartz sand to the vermiculite is 1:1; The culture matrix covers the wound site of the olive seedling; After the infected explant is transferred to the culture matrix, the step of covering with a film is also included; The culture includes dark culture and re-culture; the dark culture time is 2 days, the temperature is 25°C; the re-culture time is 15-25 days, the temperature is 25°C.

Images