Primer probe combination and kit for detecting five TORCH pathogens and application of primer probe combination and kit
A technology of primer probes and kits, applied in primer probe combinations and its application fields, can solve the problems of false negative test results, long operation time, and low sensitivity, and achieve good clinical application value, simple operation, and specificity Good results
Patent Information
- Authority / Receiving Office
- CN · China
- Current Assignee / Owner
- Publication Date
- 2022-03-25
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The invention relates to a combination of primers and probes and its application, in particular to a combination of primers and probes for detecting TORCH five pathogens, a kit and its application. Background technique
[0002] TORCH is a group of pathogens that can cause congenital intrauterine infection and perinatal infection, including toxoplasma gondii (TOX), rubella virus (RV), human cytomegalovirus (CMV), herpes simplex virus type 1 (HSV1) and simplex Herpes virus type II (HSV2).
[0003] After women of childbearing age are infected with one or more pathogens in TORCH, the pathogens will be transmitted vertically to the fetus through the placenta, leading to miscarriage, premature birth, stillbirth and deformed children. Toxoplasma infection can also cause fetal malformations including hydrocephalus, cerebellar malformation, chorioretinitis and brain calcification. Rubella virus infection can cause fetal congenital cataract, congenital heart di...
Examples
Embodiment 1
[0045] The design and screening of embodiment 1 primer-probe combination
[0046] 1) Design of primer-probe combination
[0047] 1) Primer-probe combination design
[0048] By looking up the specific genes of the five pathogens of TORCH from Chinese and English literature, and downloading the complete genes / partial fragments of the five target pathogens through NCBI query. After the download is complete, use DNAMAN software to compare multiple sequences to determine specific fragments and the most conserved region fragments (regions where multiple sequences overlap)
[0049] The specific fragments are:
[0050] Toxoplasma gondii (TOX):
[0051]CCACAGGCGAGCTCGCCTGTGCTTGGAGCCACAGAAGGGACAAAAGTCGAGGGGGACTACAGACGCGATGCCGCTCCTCCCACCGTCTTGGAGGAGAGATTCAGGACTGTAGATGAAGGCGAGGGTGAGGATGAGGGGGTGGCGTGGTTGGGAAGCGACGAGAGTCGGAGAGGAAGAAGATGTTTCCGGTCTGGCTGCTTTTCCTGGAGGGTGAAAAAGAGACACCGGAATGCGATCTAGACGAGACGACGCTTTCCTCGTGGTGATGGCGGAGAGAATTGAAGAGTGGAGAAGAGGGCGAGGGAGACAGAGTCGGAGGTCTGGACGAAGGGAGGA...
Embodiment 2
[0109] The accuracy experiment of embodiment 2 kit
[0110] Randomly select 10 cases of each of the five TORCH pathogen samples, use the prepared kit and detection method in Example 1 to detect, and simultaneously sequence the amplified samples, and compare the obtained sequences with Blast. The obtained sequencing results are shown in the table below :
[0111] Table 5 List of sequencing results detected by the kit of the present invention
[0112]
[0113]
[0114] It can be seen from Table 4 that the coincidence rate between the virus detection result of the kit of the present invention and the sequencing result is 100%.
Embodiment 3
[0115] The sensitivity experiment of embodiment 3 primer probe combination
[0116] The five kinds of pathogen-positive plasmids were grouped and mixed according to the pathogen grouping method obtained by the establishment of the multiple PRC system in Example 1, and then diluted ten times respectively, and each group was diluted to a concentration of 10 2 ~10 6 copies / mL to obtain 5 concentrations of pathogen-positive plasmid solutions (concentrations were 10 2 copies / mL, 10 3 copies / mL, 10 4 copies / mL, 10 5 copies / mL and 10 6 copies / mL), using the preparation and application of the kit in Example 1 to amplify the pathogen-positive plasmid solutions of 5 concentrations of different groups respectively, and obtain the corresponding detection sensitivity of the five pathogens, the specific results are shown in Figure 8-12 , as can be seen from the figure, the standard curve and R for the detection of five pathogens 2 See Table 5 for the values:
[0117] Standard curve ...