A method and application of ribozyme-based targeted inhibition of target RNA

Abstract

The present invention relates to the field of molecular biotechnology, and in particular to a method and application of ribozyme-based targeted inhibition of target RNA. The method is based on a novel generalized acid-base catalytic mechanism consisting of conservative nucleotide sites and structures of pistol ribozymes, and can design ribozyme molecules for any target RNA molecules with specific sequences. The ribozyme molecules designed by the method can target and cleave target RNA inside and outside cells, thereby reducing the expression levels of the target RNA itself and downstream protein molecules. The present invention is of great significance for designing novel nucleic acid drugs based on pistol ribozymes and developing novel RNA silencing technologies based on pistol ribozymes, and has broad application prospects.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and in particular relates to a method and application of targeted inhibition of target RNA based on pistol ribozyme. Background Art

[0002] Ribozymes are a special class of non-coding RNA molecules with biocatalytic activity. Ribozymes have been found in highly diverse genomic environments throughout nature, from viroids to vertebrates. Some ribozymes with smaller molecular weights can undergo self-cleavage reactions and cut specific sites of target RNA sequences. Such ribozymes include hammerhead ribozymes, hepatitis D virus ribozymes, hairpin ribozymes, VS ribozymes, Glms ribozymes, etc. The biological effects of these ribozymes include self-cleavage during the rolling circle replication of RNA genomes, co-transcriptional processing of retrotransposons, and metabolite-dependent gene expression regulation in bacteria. As an RNA molecule with enzymatic activity, ribozymes can continuously, efficiently, and specifically cleave the mRNA of target genes to regulate gene expression, and are therefore a potential gene therapy tool.

[0003] At present, ribozymes have been used for functional research and therapeutic purposes, including application research in antiviral and anti-tumor aspects. The ribozymes that are widely used in biomedical research are mainly various types of self-cleaving ribozymes and RNase P. For example, Lu and colleagues designed a hammerhead ribozyme targeting p185 mRNA, and observed that HER-2 mRNA and the oncogene k-ras produced at the end of the HER-2 pathway were downregulated in cells transfected with this ribozyme, and caused a significant decrease in carcinogenicity in nude mice, indicating that the use of anti-HER-2 ribozymes is helpful for gene therapy of breast cancer; in another study, four hammerhead ribozyme adenoviruses were developed to target the single-stranded region of the anti-apoptotic factor survivin mRNA, and the results showed that the co-expression of the three ribozymes was sufficient to significantly reduce the expression of survivin and produce the most effective anti-cancer effect. Nazari et al. used the multimeric hammerhead ribozyme RZ1-7 to cleave CCR5 mRNA, resulting in almost complete inhibition of CCR5-tropic HIV-1 replication, and therefore is a promising tool for HIV-1 gene therapy. The use of ribozymes seems to be a promising alternative to RNAi technology because off-target effects have not been observed. Therefore, ribozymes are a promising gene therapy tool and will play a huge role in clinical applications such as anti-tumor and anti-infection in the future. However, the ribozyme drug molecules currently developed based on deoxyribozymes and hammerhead ribozymes have defects such as poor in vivo stability, insufficient enzyme activity, serious off-target effects, high toxicity, and insufficient target selection sites. New ribozyme design methods are urgently needed to improve them.

[0004] Pistol ribozymes are a newly discovered class of small ribozymes, commonly found in Firmicutes, usually located near phage-related genes, and also found in the genomes of vertebrates such as fish. There are 10 highly conserved nucleotides and many other moderately conserved nucleotides in the pistol ribozyme sequence. Conserved nucleotides play a key role in nucleolytic activity, and variable nucleotides are related to slight differences in its structure and biochemical properties. The ribozyme has a new generalized acid-base catalytic mechanism, using G40 site N1 as a generalized base to attack the adjacent phosphate group, causing an ester transfer reaction, and then a hydrated magnesium ion group as a generalized acid provides a proton to the leaving group to complete the catalysis. Pistol ribozymes may be transformed into targeted recognition and inhibition of target RNA containing specific sequences, making it possible to design targeted drugs and develop gene silencing technologies based on pistol ribozymes. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a method and application of ribozyme-based targeted inhibition of target RNA.

[0006] The technical solution adopted by the present invention is: a ribozyme, the primary structure of which is shown in Formula 1, wherein a RNA sequence is formed by regularly connecting ribonucleotide monomers in series, and the sequence has the function of targeted cutting of target RNA;

[0007] 5'-P1-P2-P3-P4-P5-P6-P7-P8-P9-3'Formula 1;

[0008] Preferably, the 5' end of the ribozyme is connected with a label, and the label is a combination of one or more of a nucleic acid sequence, a peptide segment, a fluorescent small molecule and a nanoparticle;

[0009] Preferably, P1 and P3 contain 5 nt, and P1 and P3 can be reverse complementary; P2 and P7 contain 6 nt, and P2 and P7 can be reverse complementary; P5 and P9 are substrate recognition regions, and P9 contains 7-30 nt;

[0010] Preferably, P1=NNNNN; P2=NNNNNN; P3=NNNNN; P4=NNAAANNN; P5=NNNN; P6=NARG; P7=NNNNNN; P8=GCG; P9=[NNNNNNN] n , n is 7-30; R is A or G; N is A, G, C or U.

[0011] A method for ribozyme targeted inhibition of target RNA, wherein the target RNA contains one or more GU sites, and one or more ribozymes bind to the target RNA and cleave the target RNA at the GU site.

[0012] Preferably, the substrate RNA targeted and recognized by the ribozyme comprises the sequence shown in Formula 2;

[0013] 5′-S1-GU-S2-3′ formula 2;

[0014] Among them, S2 and P5 can be reverse complementary, and S1 and P9 can be reverse complementary.

[0015] Preferably, 0-100% of the bases of S2 and P5 can be reverse complementary; the reverse complementary base pairing rate of S1 and P9 is greater than 0 and less than or equal to 100%, and preferably 80-100% of the bases can be reverse complementary.

[0016] Preferably, in the ribozyme P8 sequence, the first G at the 5' end attacks and captures the proton of the 2'-hydroxyl group of G in the enzyme cleavage site "GU" sequence on the substrate, inducing the 2' oxygen to perform a nucleophilic attack on the adjacent 3'-phosphate to form the self-cleavage of the ribozyme;

[0017] A hexahydrated magnesium ion provides a proton to the 5-position oxygen atom of U in the "GU" sequence of the enzyme cleavage site on the substrate, completing the catalytic reaction.

[0018] The method of ribozyme targeted inhibition of target RNA is applied in inhibiting or silencing target RNA molecules in vivo and in vitro.

[0019] Preferably, the ribozyme is prepared by in vitro transcription, or chemically synthesized.

[0020] The advantages and positive effects of the present invention are: pistol ribozymes are designed for all target RNA molecules with GU sites, and the target RNA is specifically targeted and cleaved in vivo and in vitro to form silencing of the target RNA molecules, thereby reducing the expression level of the target RNA molecules themselves and the protein molecules encoded by them; the pistol ribozymes can be used as a new type of knockdown tool for studying target genes, and can also be used as a method for designing new nucleic acid drugs that target and silence target genes; at the same time, the stability of the designed pistol ribozymes can be improved by chemically synthesizing and modifying the pistol ribozyme molecules. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a schematic diagram of the design structure of the pistol ribozyme of the present invention;

[0022] Figure 2 It is a schematic diagram of the target RNA sequence structure of the present invention;

[0023] Figure 3 It is a schematic diagram of the enzymatic cleavage mechanism of the pistol ribozyme of the present invention on the substrate;

[0024] Figure 4 is the electrophoresis diagram of the pistol ribozyme in Example 2;

[0025] Figure 5 is the target RNA electrophoresis diagram in Example 4;

[0026] Figure 6 This is the electrophoresis diagram after the pistol ribozyme cleaves the target RNA in Example 5;

[0027] Figure 7 This is a set of fluorescence quantitative PCR results of a group of pistol ribozymes targeting c-Myc gene in Example 6;

[0028] Figure 8 This is the Western Blot result of P1120 pistol ribozyme targeting c-Myc protein in Example 6. DETAILED DESCRIPTION

[0029] The embodiments of the present invention are described below with reference to the accompanying drawings.

[0030] In order to overcome the defects of ribozymes developed based on deoxyribozymes and hammerhead ribozymes, such as poor in vivo stability, insufficient enzyme activity, and insufficient target selection sites, a ribozyme molecular design method with catalytic activity was developed using the new generalized acid-base catalytic mechanism of pistol ribozymes. A ribozyme targeting target RNA was designed, and all consecutive guanine and uracil (GU) dinucleotide sites were searched in the full-length sequence of the target RNA. After the ribozyme and the upstream and downstream sequences of the GU site were complementary and paired, a structure homologous to the pistol ribozyme was formed, which met the catalytic mechanism of the pistol ribozyme and achieved the cleavage of the target RNA in the presence of magnesium ions.

[0031] In naturally occurring RNA sequences, there are an average of 10-20 GU sites per 1000 nucleotides. When extracting information, the upstream and downstream sequences of each GU site are determined separately.

[0032] The target RNA sequence contains one or more GU sites, and the sequence at each GU site conforms to the characteristics of formula 2:

[0033] 5′-S1-GU-S2-3′ formula 2;

[0034] The specific structure is shown in Formula 2. According to the upstream and downstream sequences of GU and the principle of base complementary pairing, the sequence of the pistol ribozyme that recognizes the site is designed. Among them, the S1 sequence preferably includes 7-30 nt.

[0035] The designed ribozyme primary structure is shown in Formula 1;

[0036] 5'-P1-P2-P3-P4-P5-P6-P7-P8-P9-3'Formula 1;

[0037] As shown in Formula 1, A / G / C / U / R / N etc. in the sequence are all natural ribonucleotide monomers (nt, abbreviation of nucleotide nucleotide) that make up RNA, or these nucleotides contain chemically modified derivative monomers, which can also refer to the base part in each monomer. Ribozymes are divided into a conserved catalytic region (P1-P8) and a substrate binding region (P9). Among them, P1 and P3 can be reverse complementary, preferably containing 5 nt, P2 and P7 can be reverse complementary, preferably containing 6 nt; P4 includes a conserved AAA sequence, P6 includes a conserved ARG sequence, R is A or G; P8 includes a conserved GCG sequence; P5 and P9 are substrate binding regions, P9 contains 7-30 nt, and P5 contains 3-6 nt.

[0038] As shown in the structure of Formula 3, the 5' end of the ribozyme may also be connected to a label M, where M is a combination of one or more of a nucleic acid sequence, a peptide segment, a fluorescent small molecule, and a nanoparticle;

[0039] M-5'-P1-P2-P3-P4-P5-P6-P7-P8-P9-3' Formula 3.

[0040] The substrate binding region P9 and the 5' upstream S1 sequence of the pre-selected GU site of the RNA substrate are reversely bound by base complementary pairing, and the sequence of the substrate binding region P9 undergoes corresponding changes in base complementarity according to the sequence of different substrates. After the ribozyme binds to the target RNA, it forms a dense three-dimensional structure containing pseudo-nodes, which maintains the conservative site framework related to its catalytic activity. It is mainly composed of a stem-like structure composed of four double helices, P1-P3, P2-P7, P5-S2, P9-S1, and the overall conformation is a pseudo-node embedded in three stem-like structures. Such a structure still maintains a high enzymatic activity under low magnesium ion concentration conditions, and is suitable for the physiological environment of low magnesium ion concentration in human cells.

[0041] The local structure of the ribozyme molecule pairs itself or pairs with the target RNA in a classical base pair or a non-classical base pair, preferably the base pair is AU or UA or GC or CG or GU, specifically, it can be a natural ribonucleotide or a nucleotide derivative.

[0042] The number of nucleotides in the substrate binding region P9 is preferably 7-30, so as to keep the sequence Tm value (annealing temperature) of complementary pairing with the substrate at 40-50°C. After the ribozyme targets and recognizes the substrate and cuts it, the binding force between the ribozyme and the substrate is reduced because the substrate is broken into two segments, and the Tm value also drops to about 37°C or below, which is convenient for the ribozyme to dissociate from the substrate after completing the cut of one substrate and then carry out the recognition and cut of the next substrate, so that each ribozyme molecule can cut multiple substrates in sequence, thereby improving the efficiency of the ribozyme. The selection of the number of bases beyond the preferred range also belongs to the protection scope of the present invention. S1 has the same number of bases as P9, and the base pairing rate in S1 and P9 can be greater than 0 and less than or equal to 100%, preferably 80-100% of the bases can be complementary paired, the more bases that can be complementary paired, the better the ribozyme's ability to recognize the substrate, and when 100% of the bases can be complementary paired, the recognition effect is best. Mutations, deletions or insertions at individual sites may also exist in the base pair sequence formed by S1-P9, which will affect the recognition and catalytic ability of the ribozyme to the target RNA. The recognition and catalytic degree of the ribozyme to the target RNA can also be designed based on this point. The types of substrate target RNA recognized by the ribozyme include but are not limited to mRNA, lncRNA, miRNA, etc.

[0043] In addition, the pistol ribozyme P5 can preferably be complementary to the S2 region downstream of the corresponding substrate GU site. The complementary pairing of this region can further improve the specificity of the pistol ribozyme for target recognition.

[0044] The pistol ribozyme designed by the present method can be prepared by in vitro transcription or by chemical synthesis. In certain embodiments of the present invention, one or more nucleotides in the ribozyme sequence can be modified or unmodified monomers. Since chemically modified nucleotide monomers are not easily degraded by RNA nucleases that are distributed throughout the body (RNA nucleases are different from ribozymes, which are proteases composed of amino acids and can attack and degrade various RNAs, including ribozymes, to protect the body from interference from foreign RNA), modification of ribozyme nucleotides is beneficial to improving the stability and duration of ribozyme molecules. The structure of each modified nucleotide unit that constitutes the ribozyme structure, its ribose and main chain skeleton part may include but is not limited to the following general formulas I-VII:

[0045]

[0046]

[0047] In the formula,

[0048] R 1 is hydrogen, hydroxy, methyl, allyl, amino, sulfur, fluorine, chlorine, bromine, or iodine;

[0049] R 2is methyl, methoxyethyl, ethoxy, propynyl, propionaldehyde;

[0050] R 3 It is oxygen, sulfur, methyl, ethyl, propyl, isopropyl and other alkyl groups;

[0051] R 4 , R 6 , R 7 is hydrogen, optionally substituted C 1-6 Alkyl, alkoxy, optionally substituted C 2-6 Alkenyl, optionally substituted C 2-6 Alkynyl, carboxyl, amino, imidazolyl and various aromatic groups as well as fluorine, chlorine, bromine and iodine;

[0052] R 5 is hydrogen, methyl;

[0053] Base represents one selected from the group consisting of optionally substituted heterocyclic bases A, U, C, and G.

[0054] The stability of the designed pistol ribozyme can be improved by chemically synthesizing and modifying the pistol ribozyme molecule.

[0055] like Figure 3 As shown in the figure, in the "GCG" sequence of ribozyme P8, the first G at the 5' end attacks and captures the proton of the 2'-hydroxyl group of G in the cleavage site "GU" on the substrate, inducing the 2' oxygen to perform a nucleophilic attack on the adjacent 3'-phosphate to form the self-cleavage of the ribozyme. Afterwards, a hexahydrated magnesium ion provides a proton to the 5-position oxygen atom of U in the cleavage site "GU" on the substrate, completing the catalytic reaction.

[0056] In certain embodiments of the present invention, a corresponding pistol ribozyme can be prepared for each GU site or a portion of the GU sites in the target RNA sequence according to its characteristics, and one or more pistol ribozymes bind to the target RNA and cleave the target RNA at the GU site to achieve the knockout or inhibition of the target RNA. For each GU site, the specificity of the target RNA recognition and the enzyme cleavage efficiency are changed by changing the optimization process of the length of the sequence in the corresponding pistol ribozyme substrate recognition region P9, thereby screening the pistol ribozyme with the best specificity for the target RNA and the best knockdown effect.

[0057] This design method can be used to design a pistol ribozyme for any target RNA molecule with a GU site, specifically cleaving the target RNA molecule that is complementary to the P9 sequence of its substrate recognition region, while having no effect on non-target RNA molecules or non-target sites. The pistol ribozyme designed by this method can target and cleave the target RNA inside and outside the cell, resulting in silencing of the target RNA molecule, thereby reducing the expression level of the target RNA molecule itself and the protein molecule it encodes, thereby achieving inhibition or silencing of the target RNA. The cleavage of the target RNA molecule by the pistol ribozyme can reduce the expression level of the target RNA molecule, thereby playing a therapeutic role in diseases caused by the presence or overexpression of the target RNA molecule.

[0058] The pistol ribozyme designed by this method can be proved through enzyme activity assay, RT-QPCR, Western Blot and other experiments that it can specifically recognize and inhibit target RNA molecules outside and inside cells to achieve downregulation of the expression of selected genes.

[0059] Based on this characteristic, the pistol ribozyme design can be used as a new knockdown tool for studying target genes, and can also be used as a method for designing new nucleic acid drugs that silence target genes. It is also of great significance for designing new nucleic acid drugs and developing new RNA silencing technologies based on pistol ribozymes, and its application prospects are broad.

[0060] The present invention is described below in conjunction with the accompanying drawings, wherein the experimental method of the operating steps is not specifically described, all according to the corresponding product specifications, and the instruments, reagents, and consumables used in the embodiments can be purchased from commercial companies unless otherwise specified. The endpoints and any values ​​of the disclosed ranges are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. The present invention is described in detail below with reference to the accompanying drawings, and the purpose of the examples is to explain the present invention more clearly, rather than to limit the present invention.

[0061] Example 1: Searching for target RNA sequences and designing ribozyme sequences

[0062] Search the sequences of target RNAs such as c-Myc, HOTAIR, and miR-143 in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and use sequence analysis software such as Snapshot to locate multiple appropriate GU sites, all of which may be recognized and cleaved by the corresponding designed pistol ribozyme molecules. Determine the upstream and downstream sequences of each GU site, retain the upstream 10 nucleotides to form the sequence S1, and the downstream 4 nucleotides to form the sequence S2, forming a 5`-S1-GU-S2-3` (i.e., 5`-NNNNNNNNNNGUNNNN-3`) sequence, where N is any ribonucleotide.

[0063] For each target restriction site 5'-S1-GU-S2-3', according to the principle of base complementary pairing, based on the S1 sequence, the P9 sequence with its reverse complementary pairing is designed to form the S1-P9 double helix; the P5 sequence with the S2 sequence is designed to form the S2-P5 double helix, and the other parts of the ribozyme sequence are designed according to the conservative sequence information and non-conservative sequence information of the ribozyme design scheme to obtain a complete ribozyme sequence. Repeat this process for each GU site to complete the ribozyme molecule design for the restriction site on the target RNA molecule sequence.

[0064] Sequence search and ribozyme design were performed for three target RNAs, c-Myc, HOTAIR, and miR-143, respectively. The c-Myc gene sequence is shown in SEQ ID NO.30, and the designed ribozyme sequences are shown in SEQ ID NO.1-13, respectively; the HOTAIR gene sequence is shown in SEQ ID NO.31, and the designed ribozyme sequences are shown in SEQ ID NO.14-22; the miR-143-3p gene sequence is shown in SEQ ID NO.32, and the designed ribozyme sequences are shown in SEQ ID NO.23-29; the specific sequence information is as follows:

[0065] SEQ ID NO.1 c-Myc P437:

[0066] CGUGGUUAAGGGCCACGUUAAAUAGACAUUUAAGCCCUAAGCGAGUCCUGGAU

[0067] SEQ ID NO.2 c-Myc P1027:

[0068] CGUGGUUAAGGGCCACGUUAAAUAGUCUGUUAAGCCCUAAGCGACUGUCCAAC

[0069] SEQ ID NO.3 c-Myc P1034:

[0070] CGUGGUUAAGGGCCACGUUAAAUAGCAGGUUAAGCCCUAAGCGUCUGACACU

[0071] SEQ ID NO.4 c-Myc P1120:

[0072] CGUGGUUAAGGGCCACGUUAAAUAGCAAGUUAAGCCCUAAGCGGUUGUGUGUU

[0073] SEQ ID NO.5 c-Myc P1190:

[0074] CGUGGUUAGGGCCACGUUAAAUAGUCCAUUAAGCCCUAAGCGUCCGGGAU

[0075] SEQ ID NO.6 c-Myc P1219:

[0076] CGUGGUUAGGGCCACGUUAAAUAGGAUAUUAAGCCCUAAGCGUACCUUGGGG

[0077] SEQ ID NO.7 c-Myc P1027-12:

[0078] CGUGGUUAGGGCCACGUUAAAUAGUCUGUUAAGCCCUAAGCGACUGUCCAACUU

[0079] SEQ ID NO.8 c-Myc P1034-12:

[0080] CGUGGUUAGGGCCACGUUAAAUAGCAGGUUAAGCCCUAAGCGUCUGACACUGUC

[0081] SEQ ID NO.9 c-Myc P1120-13:

[0082] CGUGGUUAGGGCCACGUUAAAUAGCAAGUUAAGCCCUAAGCGGUUGUGUGUUCGC

[0083] SEQ ID NO.10 c-Myc P1190-11:

[0084] CGUGGUUAGGGCCACGUUAAAUAGUCCAUUAAGCCCUAAGCGUCCGGGAUCUG

[0085] SEQ ID NO.11 c-Myc P1219-13:

[0086] CGUGGUUAGGGCCACGUUAAAUAGGAUAUUAAGCCCUAAGCGUACCUUGGGGGCC

[0087] SEQ ID NO.12 c-Myc P1034-12-P2:

[0088] CGUGGUUAGGGCCACGUUAAAAUAGAGGUUAAGCCCUAAGCGUCUGACACUGUC

[0089] SEQ ID NO.13 c-Myc P1120-13-P2:

[0090] CGUGGUUAGGGCCACGUUAAAAUAGAAGUUAAGCCCUAAGCGGUUGUGUGUUCGC

[0091] SEQ ID NO.14 HOTAIR P11:

[0092] CGUGGUUAGGGCCACGUUAAAAUAGUUUCUUAAGCCCUAAGCGCUUCGUCUGG

[0093] SEQ ID NO.15 HOTAIR P59:

[0094] CGUGGUUAGGGCCACGUUAAAAUAGGGGAUUAAGCCCUAAGCGUGCGC

[0095] SEQ ID NO.16 HOTAIR P74:

[0096] CGUGGUUAGGGCCACGUUAAAAUAGUGCCUUAAGCCCUAAGCGGUUUGUUCCGGG

[0097] SEQ ID NO.17 HOTAIR P109:

[0098] CGUGGUUAGGGCCACGUUAAAAUAGAUAAUUAAGCCCUAAGCGCUCUGUCUGUGAGUG

[0099] SEQ ID NO.18 HOTAIR P181:

[0100] CGUGGUUAGGGCCACGUUAAAAUAGCUGUUUAAGCCCUAAGCGUCCGUUCCCCUAG

[0101] SEQ ID NO.19 HOTAIR P201:

[0102] CGUGGUUAGGGCCACGUUAAAAUAUGUAGGUUAAGCCCUAAGCGCGGAUUAUUCUC

[0103] SEQ ID NO.20 HOTAIR P252:

[0104] CGUGGUUAGGGCCACCUAAAUAGCGGCUUAAGCCCUAAGCGCCGCUC

[0105] SEQ ID NO.21 HOTAIR P276:

[0106] CGUGGUUAGGGCCACGUUAAAUAGGCUUAAGCCCUAAGCGCCGAGCC

[0107] SEQ ID NO.22 HOTAIR P375:

[0108] CGUGGUUAGGGCCACGUUAAAUAGGUUAUUAAGCCCUAAGCGAAGCCAAGCCUCAUC

[0109] SEQ ID NO.23 miR-143-3P Q4:

[0110] CGUGGUUAGGGCCACGUUAAAUAGGGAGUUAAGCCCUAAGCGAGGGGCCUG

[0111] SEQ ID NO.24 miR-143-3P P38:

[0112] CGUGGUUAGGGCCACGUUAAAUAGACUGUAAGCCCUAAGCGCAGAGAUGC

[0113] SEQ ID NO.25 miR-143-3P P40:

[0114] CGUGGUUAGGGCCACGUUAAAUAGCCAUUAAGCCCUAACCGUGACCAGAU

[0115] SEQ ID NO.26 miR-143-3P P48:

[0116] CGUGGUUAGGGCCACGUUAAAUAGUCAGUAAGCCWAGCCGUACUGA

[0117] SEQ ID NO.27 miR-143-3P P65:

[0118] CGUGGUUAGGGCCACGUUAAAUAGAGCUUAAGCCCUAAGCGAGUGCUUCAU

[0119] SEQ ID NO.28 miR-143-3P P82:

[0120] CGUGGUUAGGGCCACGUUAAAUAGAACAUAAGCCWACCCUACCUT

[0121] SEQ ID NO.29 miR-143-3P P85:

[0122] CGUGGUUAGGGCCACGUUAAAUAGCAUUAAGCCWAACGACUCUCUUU

[0123] SEQ ID NO.30c-Myc:

[0124]

[0125] SEQ ID NO.31HOTAIR:

[0126]

[0127] SEQ ID NO.32miR-143-3P:

[0128] GCGCAGCGCCCTGTCTCCAGCCTGAGGTGCAGTGCTGCATCTCTGGTCAGTTGGGAGTCTGAGATGAAGCACTGTAGCTCAGGAAGAGAGAAGTTGTTCTGCAGC

[0129] Example 2: Obtaining Ribozyme Molecules by In Vitro Transcription

[0130] The designed ribozyme molecules are amplified and transcribed by PCR.

[0131] The RNA sequence of each designed ribozyme is converted into a corresponding DNA sequence, and a T7 RNA polymerase recognition site is added upstream of each DNA sequence, and the sequence is shown in SEQ ID NO. 29 to form a DNA forward primer sequence required for transcribing each ribozyme molecule. The corresponding reverse complementary sequence is obtained using sequence analysis software such as Snopshot, and the primers are synthesized by a primer synthesis company.

[0132] SEQ ID NO.33GGTAATACGACTCACTATAGCG

[0133] The synthesized DNA primers were purified and recovered using 10% polyacrylamide gel, resuspended in Hepes (pH 7.0, 5 mM NaCl) buffer and the sample concentration was adjusted to 5 μM. Then, equal volumes of two complementary DNA primers were mixed and heated in a 95°C dry bath for 10 minutes, and cooled on ice for annealing and hybridization. The double-stranded DNA molecules after hybridization were used as templates for RNA in vitro transcription, and each ribozyme sequence was obtained by T7 RNA polymerase transcription.

[0134] The in vitro transcription reaction system and transcription conditions are as follows:

[0135] 5× transcription buffer 10 μL (components include Tris HCl, MgCl2, DTT, spermine, and distilled water);

[0136] 80 mM NTP 5 μL;

[0137] 5 μL of double-stranded DNA template;

[0138] T7 RNA polymerase 2 μL;

[0139] Fill the system to 50 μL with ultrapure water;

[0140] In vitro transcription conditions: Incubate in a 37°C water bath or constant temperature incubator for 3 h.

[0141] After the transcription is completed, add loading buffer to terminate the reaction and purify by electrophoresis using 10% polyacrylamide gel. The electrophoresis results are as follows: Figure 4 As shown, the ribozyme sample is recovered by an electroelution instrument, and then an equal volume of pre-cooled isopropanol is added for precipitation. The precipitated ribozyme sample is subjected to high-speed centrifugation, and the supernatant after centrifugation is removed. The white precipitate is the obtained ribozyme, which is placed in a vacuum dryer and evaporated for later use.

[0142] Example 3: Chemical synthesis of ribozyme molecules

[0143] The designed pistol ribozyme molecules can be obtained by chemical synthesis.

[0144] Through the solid phase phosphoramidite triester method, the nucleoside monomers are connected in sequence from 3' to 5'. Each cycle is divided into five steps: deprotection, activation, coupling, capping, and oxidation to obtain the full-length DNA / RNA crude product. The whole process is completed automatically by the instrument. Then, aminolysis, deprotection, purification and other operations are carried out to finally obtain the pure DNA / RNA product.

[0145] In order to generate a ribozyme that cleaves RNA with higher cleavage efficiency, chemically modified nucleotides can be inserted into the sequence, and the modification sites include the phosphate backbone, ribose and base parts. The chemically modified nucleotides can be at any position in the ribozyme sequence. As long as the ribozyme molecule designed by this method shows efficient specific recognition and cleavage activity for the GU restriction site in the target RNA molecule, the derivatives of the pistol ribozyme formed by the chemical modification of any one or more nucleotides in the ribozyme composition belong to the description scope of this specification. The chemically synthesized ribozyme in this embodiment replaces the nucleotides at both ends of the ribozyme with the following derivatives to increase the stability of the ribozyme and reduce cleavage by nucleases.

[0146]

[0147] Example 4: In vitro amplification and transcription of target RNA molecules c-Myc, HOTAIR, miR-143-3p

[0148] Plasmid DNA and primers were used to perform PCR amplification of the target RNA transcription template, and T7 RNA polymerase was used to perform in vitro transcription to obtain the target RNA molecule. Specifically, the plasmid carrying the target gene was used as a template, and the forward and reverse primers of the gene were designed. At the same time, a T7 RNA polymerase recognition sequence was added upstream of the forward primer. The sequence was shown in SEQ ID NO.29. The target gene fragment was amplified in large quantities by the PCR method. The PCR reaction system and PCR conditions were as follows:

[0149] Forward primer (100 μM) 1 μL;

[0150] Reverse primer (100 μM) 1 μL;

[0151] DNA template 2 μL;

[0152] 10×Pfu buffer 5 μL;

[0153] dNTPs (10 mM) 5 μL;

[0154] Pfu enzyme 0.5 μL;

[0155] Fill the system to 50 μL with ultrapure water;

[0156] PCR conditions: preheating at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 1.5 min, final extension at 72°C for 15 min. The second to fourth steps were a cyclic process, which was set to 29 cycles.

[0157] The amplified PCR product was purified using a DNA purification recovery kit and the concentration was calibrated to 1uM for subsequent RNA transcription. The transcription and RNA product purification methods can all be done using existing common methods. Figure 5 shown.

[0158] Example 5: In vitro enzyme activity test of ribozyme molecules

[0159] The catalytically active pistol ribozyme was reacted with the target gene substrates c-Myc, HOTAIR, and miR-143-3p at pH = 7 and 10 mM and 1 mM magnesium ions, respectively, at 37°C for 3 hours. The products were separated by 10% PAGE gel and stained with DNA dye, and the enzyme cleavage bands were observed by ultraviolet light. Figure 6 As shown, c-Myc, HOTAIR, and miR-143-3pmRNA molecules can be cleaved into short RNA fragments by the corresponding pistol ribozyme molecules, and the positions of the cut RNA fragments are shown by the arrows in the figure.

[0160] Example 6: Exploration of the Cellular Level of Target Genes Targeted by Screened Ribozymes

[0161] Taking c-Myc as an example, the selected pistol ribozymes (including p1027-12, p1034-12, p1120-13, p1190-11, p1219-13, p1034-12p2, p1120-13-p2) were transfected into MCF-7 cell lines, and the cells were treated for 2h, 6h, and 24h, respectively. Cell RNA was extracted for reverse transcription and qPCR experiments; pistol ribozyme p1120-13-p2 was transfected into MCF-7 cell lines, and the cells were treated for 24h and 48h, respectively, and then cell proteins were extracted for Western Blot experiments.

[0162] like Figure 7 In the RT-QPCR results shown, all ribozymes can knock down c-Myc target mRNA in MCF-7 cell lines to a certain extent, and the knockdown level ranges from 25% to 65% compared with the control group, among which p1120-13-p2 has the best knockdown effect on c-Myc target mRNA. Figure 8 In the Western Blot results shown, the pistol ribozyme p1120-13-p2 can target and inhibit the expression of the c-Myc gene at the protein level, and the inhibition level reaches about 50% after 48 hours of administration, achieving targeted inhibition of the target gene c-Myc at the transcriptome level and protein level.

[0163] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and cannot be considered to limit the scope of implementation of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention. Sequence Listing <110> Nankai University <120> A method and application of ribozyme-based targeted inhibition of target RNA <130> 2022 <160> 33 <170> SIPOSequenceListing 1.0 <210> 1 <211> 52 <212> RNA <213> Artificial Sequence <400> 1 cgugguuagg gccacguuaa auagacauuu aagcccuaag cgaguccugg au 52 <210> 2 <211> 52 <212> RNA <213> Artificial Sequence <400> 2 cgugguuagg gccacguuaa auagucuguu aagcccuaag cgacugucca ac 52 <210> 3 <211> 51 <212> RNA <213> Artificial Sequence <400> 3 cgugguuagg gccacguuaa auagcagguu aagcccuaag cgucugacac u 51 <210> 4 <211> 52 <212> RNA <213> Artificial Sequence <400> 4 cgugguuagg gccacguuaa auagcaaguu aagcccuaag cgguugugug uu 52 <210> 5 <211> 50 <212> RNA <213> Artificial Sequence <400> 5 cgugguuagg gccacguuaa auaguccauu aagcccuaag cguccgggau 50 <210> 6 <211> 52 <212> RNA <213> Artificial Sequence <400> 6 cgugguuagg gccacguuaa auaggauauu aagcccuaag cguaccuugg gg 52 <210> 7 <211> 54 <212> RNA <213> Artificial Sequence <400> 7 cguguuagg gccacguuaa auagucuguu aagcccuaag cgacugucca acuu 54 <210> 8 <211> 54 <212> RNA <213> Artificial Sequence <400> 8 cgugguuagg gccacguuaa auagcagguu aagcccuaag cgucugacac uguc 54 <210> 9 <211> 55 <212> RNA <213> Artificial Sequence <400> 9 cguguuagg gccacguuaa auagcaaguu aagcccuaag cgguugug uucgc 55 <210> 10 <211> 53 <212> RNA <213> Artificial Sequence <400> 10 cgugguuagg gccacguuaa auaguccauu aagcccuaag cguccgggau cug 53 <210> 11 <211> 55 <212> RNA <213> Artificial Sequence <400> 11 cgugguuagg gccacguuaa auaggauauu aagcccuaag cguaccuugg gggcc 55 <210> 12 <211> 53 <212> RNA <213> Artificial Sequence <400> 12 cgugguuagg gccacguuaa auagagguua agcccuaagc gucugacacu guc 53 <210> 13 <211> 54 <212> RNA <213> Artificial Sequence <400> 13 cgugguuagg gccacguuaa auagaaguua agcccuaagc gguugugu ucgc 54 <210> 14 <211> 52 <212> RNA <213> Artificial Sequence <400> 14 cgugguuagg gccacguuaa auaguuucuu aagcccuaag cgcuucgucu gg 52 <210> 15 <211> 48 <212> RNA <213> Artificial Sequence <400> 15 cgugguuagg gccacguuaa auaggggauu aagcccuaag cgugccgc 48 <210> 16 <211> 54 <212> RNA <213> Artificial Sequence <400> 16 cgguuagg gccacguuaa auagugccuu aagcccuaag cgguuuguuc cggg 54 <210> 17 <211> 57 <212> RNA <213> Artificial Sequence <400> 17 cgugguuagg gccacguuaa auagauaauu aagcccuaag cgcucugucu gugagug 57 <210> 18 <211> 55 <212> RNA <213> Artificial Sequence <400> 18 cgugguuagg gccacguuaa auagcuguuu aagcccuaag cgucccguuc ccuag 55 <210> 19 <211> 55 <212> RNA <213> Artificial Sequence <400> 19 cggguuagg gccacguuaa auaguagguu aagcccuaag cgccggauua uucuc 55 <210> 20 <211> 48 <212> RNA <213> Artificial Sequence <400> 20 cgguuagg gccacguuaa auagcggcuu aagcccuaag cgccgcuc 48 <210> twenty one <211> 49 <212> RNA <213> Artificial Sequence <400> twenty one cgugguuagg gccacguuaa auaggcuguu aagcccuaag cgccgagcc 49 <210> twenty two <211> 57 <212> RNA <213> Artificial Sequence <400> twenty two cgugguuagg gccacguuaa auagguuauu aagcccuaag cgaagccaag ccucauc 57 <210> twenty three <211> 51 <212> RNA <213> Artificial Sequence <400> twenty three cgugguuagg gccacguuaa auagggaguu aagcccuaag cgagggcgcu g 51 <210> twenty four <211> 51 <212> RNA <213> Artificial Sequence <400> twenty four cgugguuagg gccacguuaa auagacuguu aagcccuaag cgcagagaug c 51 <210> 25 <211> 53 <212> RNA <213> Artificial Sequence <400> 25 cgugguuagg gccacguuaa auagcccauu aagcccuaag cgugaccaga gau 53 <210> 26 <211> 52 <212> RNA <213> Artificial Sequence <400> 26 cgugguuagg gccacguuaa auagucaguu aagcccuaag cgucccaacu ga 52 <210> 27 <211> 52 <212> RNA <213> Artificial Sequence <400> 27 cgugguuagg gccacguuaa auagagcuuu aagcccuaag cgagugcuuc au 52 <210> 28 <211> 54 <212> RNA <213> Artificial Sequence <400> 28 cgugguuagg gccacguuaa auagaacauu aagcccuaag cguucucucu uccu 54 <210> 29 <211> 54 <212> RNA <213> Artificial Sequence <400> 29 cgugguuagg gccacguuaa auagcagauu aagcccuaag cgaacuucuc ucuu 54 <210> 30 <211> 1365 <212> DNA <213> Artificial Sequence <400> 30 cgccctggat ttttttcggg tagtggaaaa ccagcagcct cccgcgacga tgcccctcaa 60 cgttagcttc accaacagga actatgacct cgactacgac tcggtgcagc cgtatttcta 120 ctgcgacgag gaggagaact tctaccagca gcagcagcag agcgagctgc agcccccggc 180 gcccagcgag gatatctgga agaaattcga gctgctgccc accccgcccc tgtcccctag 240 ccgccgctcc gggctctgct cgccctccta cgttgcggtc acacccttct cccttcgggg 300 agacaacgac ggcggtggcg ggagcttctc cacggccgac cagctggaga tggtgaccga 360 gctgctggga ggagacatgg tgaaccagag tttcatctgc gacccggacg acgagacctt 420 catcaaaaac atcatcatcc aggactgtat gtggagcggc ttctcggccg ccgccaagct 480 cgtctcagag aagctggcct cctaccaggc tgcgcgcaaa gacagcggca gcccgaaccc 540 cgcccgcggc cacagcgtct gctccacctc cagcttgtac ctgcaggatc tgagcgccgc 600 cgcctcagag tgcatcgacc cctcggtggt cttcccctac cctctcaacg acagcagctc 660 gcccaagtcc tgcgcctcgc aagactccag cgccttctct ccgtcctcgg attctctgct 720 ctcctcgacg gagtcctccc cgcagggcag ccccgagccc ctggtgctcc atgaggagac 780 accgcccacc accagcagcg actctgagga ggaacaagaa gatgaggaag aaatcgatgt 840 tgtttctgtg gaaaagaggc aggctcctgg caaaaggtca gagtctggat caccttctgc 900 tggaggccac agcaaacctc ctcacagccc actggtcctc aagaggtgcc acgtctccac 960 acatcagcac aactacgcag cgcctccctc cactcggaag gactatcctg ctgccaagag 1020 ggtcaagttg gacagtgtca gagtcctgag acagatcagc aacaaccgaa aatgcaccag 1080 ccccaggtcc tcggacaccg aggagaatgt caagaggcga acacacaacg tcttggagcg 1140 ccagaggagg aacgagctaa aacggagctt ttttgccctg cgtgaccaga tcccggagtt 1200 ggaaaacaat gaaaaggccc ccaaggtagt tatccttaaa aaagccacag catacatcct 1260 gtccgtccaa gcagaggagc aaaagctcat ttctgaagag gacttgttgc ggaaacgacg 1320 agaacagttg aaacacaaac ttgaacagct acggaactct tgtgc 1365 <210> 31 <211> 2370 <212> DNA <213> Artificial Sequence <400> 31 ccagttctca ggcgagagcc gcggctgaca gggtctggga cagaaggaaa gccctccagc 60 ctccaggccc tgccttctgc ctgcacattc tgccctgatt tccggaacct ggaagcctag 120 gcaggcagtg gggaactctg actcgcctgt gctctggagc ttgatccgaa agcttccaca 180 gtgaggactg ctccgtgggg gtaagagagc accaggcact gaggcctggg agttccacag 240 accaacaccc ctgctcctgg cggctcccac ccgggactta gaccctcagg tccctatat 300 cccggaggtg ctctcaatca gaaaggtcct gctccgcttc gcagtggaat ggaacggatt 360 tagaagcctg cagatggggga gtggggagtg gagagaggga gcccagagtt acagacggcg 420 gcgagaggaa ggaggggcgt ctttattttt ttaaggcccc aaagagtctg atgtttacaa 480 gaccagaaat gccacggccg cgtcctggca gagaaaaggc tgaaatggag gaccggcgcc 540 ttccttataa gctcgttggg gcctaagcca gtaccgacct ggtagaaaaa gcaaccacga 600 agctagagag agagccagag gagggagaag agcgccagac gaaggtgaaa gcgaaccacg 660 cagagaaatg caggcaaggg agcaaggcgg cagttcccgg aacaaacgtg gcagagggca 720 agacgggcac tcacagacag aggtttatgt atttttatt tttaaaatct gatttggtgt 780 tccatgagga aaagggaaaa tctagggaac gggagtacag agaataat ccgggtccta 840 gctcgccaca tgaacgccca gagaacgctg gaaaaacctg agcgggtgcc ggggcagcac 900 ccggctcggg tcagccactg ccccacaccg ggcccaccaa gccccgcccc tcgcggccac 960 cggggcttcc ttgctcttct tatcatctcc atctttatga tgaggcttgt taacaagacc 1020 agagagctgg ccaagcacct ctatctcagc cgcgcccgct cagccgagca gcggtcggtg 1080 gggggactgg gaggcgctaa ttaattgatt cctttggact gtaaaatatg gcggcgtcta 1140 cacggaaccc atggactcat aaaatata tctgttgggc gtgagtgcac tgtctctcaa 1200 ataatttttc cataggcaaa tgtcagaggg ttctggattt ttagttgcta aggaaagatc 1260 caaatgggac caattttagg aggcccaaac agagtccgtt cagtgtcaga aaatgcttcc 1320 ccaaaaggggt tgggagtgtg ttttgttgga aaaaagcttg ggttatagga aagcctttcc 1380 ctgctacttg tgtagaccca gcccaattta agaattacaa ggaagcgaag gggttgtgta 1440 ggccggaagc ctctctgtcc cggctggatg caggggactt gaggctctcc ggaatttgag 1500 aggacatag aagcaaggt ccagccttg cttcgtgctg attcctagac ttaagattca 1560 aaaacaatt tttaaaagtg aaaccagccc tagctttgg aagctcttga aggttcagca 1620 cccacccagg aatccacctg cctgttacac gccctccacA ccacagtgg caccgctttt 1680 ctaactggca gcacagagca actctataat atgcttatat taggtctaga agaatgcatc 1740 ttgagacaca tgggtaacct aattatataa tgctgttcc atacaggagt gattatgcag 1800 tgggaccctg ctgcaacgg gacttgcac tctaatata gacccagct tggcacaaaa 1860 gttgcagtag aaaatagac atggagaac acttaata gtgatgcatg tagacacaga 1920 aggggtattt aaagacagaaaatagaa gtacagaga acagaaaaaaaaaaaaaaaacaga 1980 tggagattac cattcccaat gcctgaactt cctcctgcta ttaagattgc tagagaattg 2040 tgtcttaaac agttcatgaa cccagaagaa tgcaatttca atgtatttag tacacaca 2100 gtatgtatat aaacacaact cacagaatat attttccata cattgggtag gtatgcactt 2160 tgtgtatatata taataatgta ttttccatgc agttttaaaa tgtagatata ttaatatctg 2220 gatgcatttt ctgtgcactg gttttatatg ccttatggag tatatactca catgtagcta 2280 aatagactca ggactgcaca ttccttgtgt aggttgtgtg tgtgtggtgg ttttatgcat 2340 aaataaagtt ttacatgtgg tgaatataaa 2370 <210> 32 <211> 106 <212> DNA <213> Artificial Sequence <400> 32 gcgcagcgcc ctgtctccca gcctgaggtg cagtgctgca tctctggtca gttgggagtc 60 tgagatgaag cactgtagct caggaagaga gaagttgttc tgcagc 106 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <400> 33 ggtaatacga ctcactatag cg 22

Claims

1. A ribozyme, characterized in that: The primary structure is shown in Formula 1, which is a regularly connected series of ribonucleotide monomers to form an RNA sequence, which has the function of targeted cutting of target RNA; 5'-P1-P2-P3-P4-P5-P6-P7-P8-P9-3' Formula 1; The target c-Myc gene sequence is shown in SEQ ID NO. 30, and the ribozyme sequence capable of inhibiting or silencing the target c-Myc gene is shown in any one of SEQ ID NOs. 1, 2, 4 and 5; Or, the target HOTAIR gene sequence is shown in SEQ ID NO.31, and the ribozyme sequence capable of inhibiting or silencing it is shown in any one of SEQ ID NOs. 14, 16, 17, 18 and 19; Alternatively, the target miR-143-3p gene sequence is shown as SEQ ID NO. 32, and the ribozyme sequence capable of inhibiting or silencing it is shown as any one of SEQ ID NOs. 23, 24, 25, 27, 28 and 29.

2. The ribozyme according to claim 1, characterized in that: Chemically modified nucleotides are inserted into the sequence, with modification sites including one or more of the phosphate backbone, ribose and base moieties.

3. The method for ribozyme targeted inhibition of target RNA according to claim 1 or 2, characterized in that: The target RNA contains one or more GU sites, and one or more ribozymes bind to the target RNA and cleave the target RNA at the GU site.

4. The method for ribozyme targeted inhibition of target RNA according to claim 3, characterized in that: The substrate RNA targeted and recognized by the ribozyme comprises the sequence shown in Formula 2; 5′-S1-GU-S2-3′ formula 2; Among them, S2 and P5 can be reverse complementary, and S1 and P9 can be reverse complementary.

5. The method for ribozyme targeted inhibition of target RNA according to claim 3 or 4, characterized in that: In the ribozyme P8 sequence, the first G at the 5' end attacks and captures the proton of the 2'-hydroxyl group of G in the "GU" sequence of the cleavage site on the substrate, inducing the 2' oxygen to perform a nucleophilic attack on the adjacent 3'-phosphate to form the self-cleavage of the ribozyme; a hexahydrated magnesium ion provides a proton to the 5-position oxygen atom above U in the "GU" sequence of the cleavage site on the substrate, completing the catalytic reaction.

6. Use of the method for targeted inhibition of target RNA by ribozymes as claimed in any one of claims 3 to 5 in in vitro inhibition or silencing of target RNA molecules for purposes other than disease diagnosis and treatment.

7. The use of the method for targeted inhibition of target RNA by ribozymes according to claim 6 in the inhibition or silencing of target RNA molecules in vivo or in vitro for non-disease diagnosis and treatment purposes, characterized in that: The ribozymes are prepared by in vitro transcription or chemical synthesis.

Images