A rice spikelet loosening gene spr9, its protein and application

Abstract

The purpose of the present invention is to separate and clone a gene spr9 that mediates rice false smut and its encoded protein. After the gene is knocked out by genetic engineering technology, the loosening of rice and other crops can be regulated and the resistance to rice false smut can be affected; the application of the gene in rice molecular marker-assisted selection breeding is proposed.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering technology, and specifically relates to the cloning and application of a loose panicle gene spr9 related to rice false smut. After the gene is knocked out by genetic engineering technology, the panicle shape of crops such as rice can be regulated and the resistance to rice false smut can be affected. Background Art

[0002] Rice is one of the most important food crops in the world. The rice panicle is composed of the rachis, primary stalks, secondary stalks, spikelet stalks, and spikelets. The panicle type is determined by the morphology and number of the rachis, stalks, and spikelets. The panicle development begins with the apical meristem (SAM) extending upward and transforming into the inflorescence meristem (IM). Subsequently, the inflorescence meristem differentiates into the branch meristem (BM), forming the first and second stalks and higher stalks. This stage determines the number of branches in the panicle. Then, the spikelet meristem (SM) differentiates on the stalks to form spikelets, and the floral meristem (FM) is formed on the spikelets and develops into floral organs. Finally, the rachis and stalks further elongate and form the final panicle type.

[0003] The spreading panicle trait of rice is a typical agronomic trait, characterized by an increase in the angle between the primary branch and the main panicle axis, which extends outward obliquely. In severe cases, the primary branch grows almost vertically to the panicle axis. Most Asian cultivated rice (Oryza sativa) has an upright dense panicle type, while the spreading panicle type is more common in African cultivated rice (Oryza glaberrima) and wild rice (Oryza rufipogon). Currently, many spreading panicle mutants have been reported, but only a few related genes have been cloned, so people still know little about the molecular regulatory mechanism of the formation of the spreading panicle trait. Many wild rices have typical spreading panicle traits, because spreading panicles are conducive to improving the cross-pollination rate and reproductive ability of wild rice in the wild, so as to better adapt to the environment. However, the spreading panicle trait is often linked to some undesirable agronomic traits, such as shorter plant height, fewer tillers, fewer branches, lower yields, and stronger grain shattering. Therefore, the spreading panicle type has been gradually eliminated during human domestication and selection.

[0004] In recent years, some studies have shown that ear traits are closely related to rice quality. Compared with loose ear varieties, dense ear varieties tend to have compact plant shapes, more grains per ear, and higher overall yields, but their quality is not as good as loose ear varieties. Dense ear varieties (also known as upright ear varieties) have thicker and shorter ear necks and higher grain density, which leads to large differences in maturity and quality between grains. In particular, the ratio of immature grains in the lower part of the ear is high in dense ear varieties, which makes the appearance quality of the ears of dense ear varieties poor. Appropriately lengthening the ear length and reducing the grain density can improve the filling quality of weak grains and improve the overall ear quality. Lv Wenyan et al. (1997) measured the processing quality and cooking quality of dense ear and loose ear rice and found that the amylose content, gel consistency, brown rice rate, whole polished rice rate, chalky grain rate and chalkiness of loose ear varieties were better than those of dense ear varieties. Bao Genliang et al. (2007) believed that the loose panicle morphology increases the space between the primary branches and stalks, which is more conducive to the filling and setting of grains at the bottom of the panicle, and is of great significance for improving rice quality. Therefore, using genetics and morphology-related knowledge to identify more loose panicle mutants and further isolate the gene will help reveal the molecular regulatory mechanism of the formation of loose panicle traits in rice, provide theoretical guidance for the genetic improvement of rice panicle shape, and deepen the understanding of the formation of angiosperm inflorescence structure.

[0005] Rice false smut is a panicle disease of rice, which occurs in more than 40 countries in Asia, Africa and America, with the most serious cases in India, Japan, the Philippines and China. The sexual state of the pathogen of rice false smut is Clavicepsoryzae-sativaeHashioka, belonging to the genus Clavicepsoryzae-sativaeHashioka of the subphylum Ascomycota, and the asexual state is Ustilaginoideavirens (Cooke) Takahashi, belonging to the genus Chloropsora of the subphylum Deuteromycota. In recent years, with the replacement of rice varieties, the promotion of high-yield hybrid rice planting and the improvement of fertilization level, the occurrence area of ​​rice false smut and the losses caused by it have been increasing day by day. Rice false smut not only affects rice yield and rice quality, but also the toxins produced by the pathogen are toxic to humans and animals.

[0006] The discovery of rice false smut resistance genes and the development of resistant varieties are still ongoing. Currently, very few genes related to rice false smut resistance have been identified and isolated. However, studies have shown that loose panicle varieties and early-maturing varieties generally have milder disease, while dense panicle varieties and late-maturing varieties have more severe disease. It is still unclear whether rice false smut resistance is related to loose panicle type of rice. Summary of the invention

[0007] Based on this, in order to overcome the defects of the above-mentioned prior art, one of the objects of the present invention is to provide a rice panicle type gene Spr9 and a protein encoded by it. Through gene cloning and biological function verification research, it is found that the above-mentioned gene Spr9 can regulate the panicle type of crops such as rice and affect the resistance to rice false smut; and the application of this gene in rice molecular marker-assisted selection breeding is proposed.

[0008] The object of the present invention is to provide a rice false smut disease scattered panicle gene spr9, the rice false smut disease scattered panicle gene spr9 is LOC_Os05g38520 gene, located on chromosome 5, the nucleotide sequence of LOC_Os05g38520 gene is shown in SEQ ID NO:1, and a gene sequence with more than 90% homology to the DNA sequence shown in SEQ ID NO:1, and also includes mutant alleles or derivatives produced by insertion, substitution or deletion of one or more bases.

[0009] The purpose of the present invention is to apply the rice false smut scattered panicle gene spr9 in rice molecular marker-assisted selection breeding, mainly for changing the panicle type of rice varieties and improving the disease resistance of rice.

[0010] The present invention also aims to provide a protein for use in changing the panicle type of rice varieties and improving the disease resistance of rice. The protein is encoded by the above-mentioned rice false smut scattered panicle gene spr9, and the amino acid sequence of the protein is shown in SEQ ID NO:2, as well as amino acid sequences with more than 90% homology to the amino acid sequence shown in SEQ ID NO:2, and also include proteins or protein analogs with functional changes caused by insertion, substitution or deletion of one or more amino acids.

[0011] Furthermore, the spr9 gene causing loose panicle of rice smut is knocked out by CRISPR / Cas9 genome editing technology to mutate the rice, thereby changing the panicle shape of the rice variety and improving the disease resistance of the rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The phenotypes of the wild type Hui 1586 and the scattered ear mutant spr9 of the present invention are shown in the figure, wherein the difference in ear type between the wild type (Hui 1586, the same below) and the scattered ear mutant spr9 is compared: the left is the wild type, and the right is the mutant spr9;

[0013] Figure 2The present invention is a map-based clone of the rice panicle loosening gene spr9, wherein A is that the panicle loosening gene spr9 is located on the fifth chromosome of rice, between the molecular markers RM8211 and RM5970, and the genetic distance is 16.5 cM; B is that the panicle loosening gene spr9 is located on the fifth chromosome of rice, between the molecular markers RM1090 and RM1187, and the genetic distance is 5.9 cM; C shows that the panicle loosening gene spr9 is located on rice chromosome 5, between molecular markers Indle5-5 and Indle5-6, with a genetic distance of 477 kb; D shows that the panicle loosening gene spr9 is located on rice chromosome 5, between molecular markers Indle5-18 and Indle5-23, with a genetic distance of 43 kb; E shows that according to the prediction of the annotation website, there are 4 candidate genes in the 43 kb interval, namely LOC_Os05g38500, LOC_Os05g38510, LOC_Os05g38520 and LOC_Os05g38530;

[0014] Figure 3 The structure of the Spr9 gene cloned by the present invention and the spr9 mutation site analysis diagram;

[0015] The start codon (ATG) and the stop codon (TGA) are marked, the grey boxes represent the exons of the Spr9 gene, the lines between the boxes represent the introns, and spr9 lacks 1 bp T at the 81 bp position starting from ATG.

[0016] Figure 4 This is a schematic diagram of the structure of the knockout vector Cas9-Spr9 of the present invention;

[0017] Figure 5 This is a diagram showing the result of the Spr9 gene function knockout verification of the present invention.

[0018] The wild type and two homozygous knockout lines at different loci (Spr9 KO-line1 and Spr9 KO-line2) (Table 1) were used to investigate the ear traits. Figure 5 The results showed that the two homozygous knockout lines both showed scattered ear phenotype compared with the wild type. DETAILED DESCRIPTION

[0019] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments for understanding the present invention, but the present invention is not limited thereto.

[0020] Example 1

[0021] The rice false smut scattered panicle gene spr9 is the LOC_Os05g38520 gene, whose nucleotide sequence is shown in SEQ ID NO:1, and a gene sequence having more than 90% homology with the DNA sequence shown in SEQ ID NO:1, and also includes mutant alleles or derivatives generated by insertion, substitution or deletion of one or more bases; In this embodiment, the rice false smut scattered panicle gene spr9 is located on the fifth chromosome of rice by using the map-based cloning method, and is located between markers Indel5-18 and Indel5-20, with a physical distance of 43kb; the rice false smut scattered panicle gene spr9 is used in rice molecular marker-assisted selection breeding, mainly for changing the panicle type of rice varieties and improving the disease resistance of rice;

[0022] The amino acid sequence of the protein encoded by the rice false smut scattered panicle gene spr9 is shown in SEQ ID NO:2, as well as amino acid sequences with more than 90% homology to the amino acid sequence shown in SEQ ID NO:2, and also includes proteins or protein analogs with functional changes caused by insertion, substitution or deletion of one or more amino acids; the protein is used to change the panicle shape of rice varieties and improve the disease resistance of rice;

[0023] The map-based cloning of the rice false smut scattered panicle gene Spr9 is as follows:

[0024] 1. Obtaining the scattered ear mutant spr9

[0025] The test material is Hui 1586, 60 After irradiation with Co-γ rays (dose of 350 Gy), the loose ear mutant spr9 with a chicken claw-like ear shape was obtained. After three consecutive years of field trait observation, it was stably inherited. Under natural growth conditions, the phenotypes of wild-type Hui 1586 and spr9 in the field were compared. Spr9 mainly showed a loose ear shape, such as Figure 1 As shown;

[0026] 2. Fine localization of the spr9 gene in the scattered ear mutant

[0027] In order to locate the spr9 gene that causes loose panicle in rice smut, we used 296 pairs of polymorphic primers and 624 existing SSR markers distributed on 12 rice chromosomes with a genetic distance of about 10 to 30 cM to analyze the polymorphism between spr9 mutants and Taijing 9. A total of 136 polymorphic SSR markers were detected, with a polymorphism rate of 21.8%. DNA was extracted from 20 mutant strains randomly selected from the segregating population, and then equal amounts of DNA were mixed to construct a mutant pool.

[0028] Using the mutant pool as template, DNA from both parents and F as controls, 136 polymorphic molecular markers were detected for amplification. The results showed that the PCR products of the mutant pool DNA of SSR markers RM8211 and RM5970 on chromosome 5 tended to be similar to the spr9 mutant. Further analysis of 186 mutant individual plants in the F2 population showed that RM8211 and RM5970 were closely linked to the spr9 gene, with a genetic distance of about 16.5 cM. Figure 2 As shown in A;

[0029] To further locate the spr9 gene, we screened common primers between markers RM8211 and RM5970 and found that markers RM1090 and RM1187 were polymorphic between the spr9 mutant and 02428. We used 186 mutant individuals in the F2 population to locate the spr9 gene between RM1090 and RM1187, with a genetic distance of approximately 5.9 cM, as shown in Figure 2B;

[0030] In order to locate the spr9 gene in a smaller interval, we developed 10 pairs of Indel primers between markers RM1090 and RM1187. We found that 4 pairs of primers were polymorphic in both parents, namely Indel5-3, Indel5-5, Indel5-6 and Indel5-10. These 4 pairs of primers were used to locate the spr9 gene between markers Indel5-5 and Indel5-6, with a physical distance of about 477 kb. Figure 2 As shown in C;

[0031] In order to further precisely locate the spr9 gene, we developed 36 pairs of Indel primers between markers Indel5-5 and Indel5-6, and found that 10 pairs of primers were polymorphic in both parents, namely Indel5-12, Indel5-15, Indel5-16, Indel5-18, Indel5-20, Indel5-22, Indel5-25, Indel5-26, Indel5-29 and Indel5-31. With the help of 1452 recessive plants in the constructed F2 large population and using these 10 pairs of primers, the spr9 gene was finally located between markers Indel5-18 and Indel5-20, with a physical distance of about 43kb, as shown in Figure 2. Figure 2 As shown in D;

[0032] 3. Analysis of candidate genes for the scattered ear gene spr9

[0033] According to the available sequence annotation databases ( http: / / rice.plantbiology.msu.edu / ; http: / / www.tigr.org / ), there are 4 annotated candidate genes in the located 43 kb region, e.g. Figure 2 E, and all have corresponding full-length cDNAs; among them, LOC_Os05g38500 encodes arabinogalactan protein, LOC_Os05g38510 encodes a hypothetical protein, LOC_Os05g38520 encodes a ribosomal protein, and LOC_Os05g38530 encodes a DnaK family protein;

[0034] 4. Gene sequence analysis of the scattered ear gene spr9

[0035] In order to analyze which gene is the candidate gene, we sequenced the four genes in the hui1586 and spr9 mutants respectively; the results showed that LOC_Os05g38520 was missing only 1bp (81:T), such as Figure 3 As shown in the figure, while LOC_Os05g38500, LOC_Os05g38510 and LOC_Os05g38530 had no difference. Therefore, it was speculated that LOC_Os05g38520 was its candidate gene, and the gene of scattered ears in spr9 mutant was named spr9, and the allele (LOC_Os05g38520) in wild-type Hui 1586 was named Spr9; according to the sequencing results and gene structure open reading frame (ORF) analysis (http: / / rice.uga.edu / cgi-bin / ORF_infopage.cgi?orf=LOC_Os05g38520), the full length of Spr9 is 2068bp, Spr9 has 3 exons, and the total length of CDs is 342 bp (CDs sequencing forward primer: ATGGCGCCGTCGCAGCCGAAGT, reverse sequencing primer: CTATTTCTTCTTCTCGGTGTGAGCG). The spr9 mutant has a 1 bp deletion in the 81st base of the first exon, which affects the function of Spr9. The spr9 mutant exhibits a scattered ear phenotype;

[0036] Conventional PCR amplification was followed by agarose electrophoresis detection;

[0037] Among them, the PCR amplification reaction system is as follows:

[0038] 2x Reaction Mix: 16 μL;

[0039] Primer SEQ ID NO.1 (F1) (10 μM): 1 μL;

[0040] Primer SEQ ID NO.1 (F1) (10 μM): 1 μL;

[0041] DNA template (20-50 ng / μL): 2 μL;

[0042] ddH2O: make up to 25 μL;

[0043] The PCR temperature cycle conditions were as follows: 94°C for 5 minutes; 94°C for 30 seconds; 55°C for 30 seconds; 72°C for 30 seconds; 35 cycles; 72°C for 7 minutes; 10°C storage;

[0044] After the PCR reaction was completed, an appropriate amount of sample was taken for electrophoresis on 3% agarose at 110 V for 40 minutes.

[0045] Example 2

[0046] In order to further verify whether the rice false smut scattered panicle gene Spr9 really affects the phenotype of rice panicle, a Spr9 knockout vector was constructed, such as Figure 4 As shown, the Spr9 gene in Hui 1586 (wild type) was knocked out by using CRISPR / Cas9 gene editing technology or molecular assisted selection technology (gRNAs-Spr9 target sequence: GGCCGTCGCAGCCGAAGTCC), and finally two different allelic mutants (Spr9 KO-line1 and Spr9 KO-line2) were obtained. Molecular marker detection (forward primer: CCAAGCCCACAACAAAGG, reverse primer: AAACACGGACAAGCATCACC) showed that the two mutants had two different mutation types, Spr9 KO-line1 had an insertion of 1 bp, and Spr9 KO-line2 had a deletion of 2 bp, see Table 1;

[0047] Table 1. Knockout mutation sites of 2 knockout lines

[0048]

[0049] The panicle trait analysis of the two allelic mutants Spr9 KO-line1 and Spr9 KO-line2 showed that their phenotypes were consistent with the mutant spr9, further indicating that the mutation of the Spr9 gene led to loss of function, thus affecting the phenotype of loose panicles in rice. Figure 5 shown.

[0050] Example 3

[0051] The wild type Hui 1586 and the scattered panicle mutant spr9 were artificially inoculated with rice false smut, and the experiment was repeated three times. The rice false smut disease was divided into 5 levels according to Deng Gensheng et al. for statistical analysis (level 0, no disease; extreme I, 1 fungus ball; level II, 2-5 fungus balls; level III, 6-10 fungus balls; level IV, 11-15 fungus balls; level V, more than 16 fungus balls); the results showed that Hui 1586 had level III disease, and the scattered panicle mutant spr9 had level II disease. Compared with the wild type Hui 1586, the scattered panicle mutant spr9 was more resistant to rice false smut.

[0052] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention. Sequence Listing <110> Rice Research Institute, Fujian Academy of Agricultural Sciences <120> A rice spikelet loosening gene spr9, its protein and application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2068 <212> DNA <213> Artificial Sequence <400> 1 ggtttcctcc ctagccgccg ccgcttcatt tctcccaggt aaggtaagcc agccgccgcc 60 gccaccacct ccgcctccga tctgaaaccc tagcctctct cctccctcgg cgccgctcac 120 gtagatcttc tcccgctgct tgttcgtgca ggaaaaaggg ctccccgatg gcgccgtcgc 180 agccgaagtc cgggctcttc gtgggcatca acaagggcca cgtcgtcacc aagcgcgagc 240 tgccgcctcg cccgtccgac cgcaaggggg taagcgcctc tgatcccgta gcacgagctg 300 tttcagcccg acgagctggg cggtgatgct tgtccgtgtt tgatctgtgt ggatttagtg 360 cgtagcttcg tttctctccg tagattcgtg ttgtaggtcg agatttttgc atggatccta 420 tgtatgctgc agagggcgtg atgcctgcta gtattgactg atatagttga cccctcaacc 480 ttctcaatcc tagtatgcat ttcatttctg tctttttttc cagtttgtat ttagaaatgg 540 cggtggtact gtattttttc cccttgtact attcttgctt tgcctttgta tttgtggggg 600 agcaagtttt tttttatttc agcaattagt ctacatgtgt atgcctagat attcattaaa 660 atgatgggaa tagtggtttt agttcgttat tcttacagct gacaagatat tgtttgccat 720 gtttctgtgt gtgaagtcat gcttctgtat caacagaatt tcctctctga ggtatccaag 780 gtgcacttgt gttatttttt ttgtttgcat tacataaaac ctagggttgc tatttttcta 840 ttatatgttg tttggttcaa tgatttgatc ctgctttata ttatctgctt tgcagtttac 900 tggccattat ttcctattgc atttgcactt accttgttgg catgttaatt tgcagaaatc 960 caccaagagg gtgacctttg tcaggaactt gatcagggag gttgctggat ttgctcccta 1020 tgagaagcgt atcactgagc ttctcaaagt tggcaaggac aagcgtgcac tgaaggtggc 1080 aaagagaaag cttggcaccc acaagagggc caagaagaag agagaggaga tggctggtgt 1140 cctcaggaag atgaggtgtg taatcttcca gccttgataa aaacacctgt tattattcta 1200 ttggttacct tgtcttccgt tgcaattgaa tttgtgccta ttaatattgt ttgaactagt 1260 ttgttgtaa ttgttagttt gtagtttatt atcagaactg tgctaccatt tgttttattt 1320 attctatatt gttagtgtc tttgtatgtg tgttttttcg aaaggtagtg ttcatttgtg 1380 attataagta caaatttctt gtattgcgca ggaaataata aatcatatgt aacataattg 1440 gacctgtcgt gtgtcttaaa caaagaatga atgttaaggc acagtgcaga ttgttgctta 1500 gatatactat atgttttagg aaggatcact tttgtatgtg tacagttcat tgttatcat 1560 tttataatgg tattataaag ttgacaaact taaattcatg aaaatgaaac attcgggatg 1620 agttttaata gtattggtac aattatattt tctttagcct tgtgctttgt tttcaattta 1680 aactaacttt cttttgtgat atgcaggtct ggtggcggtc acgctcacac cgagaagaag 1740 aaatagagta tctccaagtt catgaagtcc atggcaatat tgtcttgttg agtttactct 1800 tgtagaaccc tactactaga attgcactct attatccagc taaacatcat ggtgttagtt 1860 ctgtgttaaa aacctcctgt cttgtgtttt tgatcctttc aatgcatggt ttgccacctt 1920 aaatttgctt gattagttac ttttgccgct ggtactgatg cgctgagggc gacatgcttg 1980 gggactatac tccccagtct ttattttgta gcttagggtg tatttcgctt gcagcgtcgt 2040 gctggatcca atctttattt tcgcgatt 2068 <210> 2 <211> 113 <212> PRT <213> Artificial Sequence <400> 2 Met Ala Pro Ser Gln Pro Lys Ser Gly Leu Phe Val Gly Ile Asn Lys 1 5 10 15 Gly His Val Val Thr Lys Arg Glu Leu Pro Pro Arg Pro Ser Asp Arg 20 25 30 Lys Gly Lys Ser Thr Lys Arg Val Thr Phe Val Arg Asn Leu Ile Arg 35 40 45 Glu Val Ala Gly Phe Ala Pro Tyr Glu Lys Arg Ile Thr Glu Leu Leu 50 55 60 Lys Val Gly Lys Asp Lys Arg Ala Leu Lys Val Ala Lys Arg Lys Leu 65 70 75 80 Gly Thr His Lys Arg Ala Lys Lys Lys Arg Glu Glu Met Ala Gly Val 85 90 95 Leu Arg Lys Met Arg Ser Gly Gly Gly His Ala His Thr Glu Lys Lys 100 105 110 Light

Claims

1. Application of rice false smut scattered panicle gene spr9 in rice molecular marker assisted selection breeding, characterized in that: The rice false smut scattered panicle gene spr9 is the LOC_Os05g38520 gene, and its nucleotide sequence is shown in SEQ ID NO: 1; the rice false smut scattered panicle gene spr9 is used to change the panicle type of rice varieties and improve the rice false smut resistance.

2. Use of a protein in changing the panicle shape of rice varieties and improving the disease resistance of rice, characterized in that: The protein is encoded by the rice false smut scattered panicle gene spr9 as claimed in claim 1, and the amino acid sequence of the protein is shown in SEQ ID NO:

2.

3. The use according to claim 2, characterized in that: The rice false smut disease scattered panicle gene spr9 is subjected to gene knockout treatment by CRISPR / Cas9 genome editing technology to cause rice mutation; the rice false smut disease scattered panicle gene spr9 is the LOC_Os05g38520 gene, and its nucleotide sequence is shown in SEQ ID NO:1.

Images