Method and kit for detecting rice osnramp5 gene
By using an enzyme-free OsNramp5 biosensor, and leveraging DNAzyme catalysis and CHA technology, the problems of high cost and false positives in existing OsNramp5 gene detection have been solved, enabling rapid and low-cost identification and breeding of cadmium-low absorption rice germplasm resources.
Patent Information
- Application Number
- CN202210359991.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-10-14
- Filing Date
- 2022-04-07
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2042-04-07
AI Technical Summary
Existing methods for detecting the OsNramp5 gene require DNA polymerase, which is costly and prone to false positives, making it difficult to achieve rapid and low-cost identification and breeding of cadmium-low-absorption rice germplasm resources.
An enzyme-free OsNramp5 biosensor was used to establish a fluorescence identification method using DNAzyme catalysis and catalytic hairpin self-assembly (CHA) technology. The OsNramp5 gene was detected using four nucleic acid hairpin structures and a buffer solution.
It enables rapid, low-cost, and sensitive OsNramp5 gene detection, suitable for large-scale deployment, and exhibits good stability and flexibility, supporting the identification and breeding of low-cadmium rice.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure HDA0003584641140000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of analytical detection technology, specifically relating to a method and kit for detecting the OsNramp5 gene in rice. Background Technology
[0002] Cadmium is a highly toxic heavy metal that can cause cadmium-related diseases. Rice, a staple food in my country, has a high absorption rate of cadmium, and high concentrations of cadmium in paddy fields can negatively impact the normal growth and development of rice. Therefore, there is an urgent need to breed rice varieties with low cadmium absorption to reduce potential health risks and ensure food safety.
[0003] In recent years, increasing research has shown that the OsNramp5 gene (OsN) is a key gene in rice controlling the absorption of heavy metals such as cadmium. The deletion of this gene can significantly reduce root absorption of cadmium, thus lowering the cadmium content in rice. Currently, reported methods for detecting the OsNramp5 gene, such as an SNP locus associated with the rice cadmium-low absorption gene OsNramp5 and its application (application number 202011615990.1) and specific InDel molecular marker primers for detecting the rice OsNRAMP5 gene and their application (application number 202010239340.5), all employ PCR amplification, requiring DNA polymerase, which is time-consuming, costly, and prone to false positives. This invention utilizes this gene as a reverse molecular biomarker to establish an enzyme-free OsNramp5 biosensor and develop a simple, rapid, and low-cost cadmium-low absorption gene identification and kit. This has significant implications for the identification of cadmium-low absorption rice germplasm resources, variety breeding, ensuring rice quality and safety, and the deployment of breeding platforms. Summary of the Invention
[0004] The technical problem to be solved by this invention is to overcome the shortcomings and defects mentioned in the background art above, and to provide a method and detection kit for fluorescent identification of the rice cadmium-low absorption gene OsNramp5. Based on DNAzyme catalysis and catalytic hairpin self-assembly (CHA) amplification technology, an enzyme-free OsNramp5 biosensor is established. The method has unique advantages such as good stability, simple and flexible design, and high sensitivity, making it easy to promote and use on a large scale.
[0005] The technical solution adopted in this invention is:
[0006] A fluorescence detection kit for identifying the rice cadmium-low absorption gene OsNramp5, the kit comprising H1, H2, H3, and H4 nucleic acid hairpin structures and a buffer solution.
[0007] Preferably, the H1 nucleic acid hairpin structure includes an OsNramp5 recognition region and a Cd... 2+ DNA-dependent enzyme chains.
[0008] Preferably, the nucleotide sequence of the H1 nucleic acid hairpin structure is shown in SEQ ID NO:1.
[0009] Preferably, the H2 nucleic acid hairpin structure contains Cd 2+ Dependent DNAzyme substrate chain.
[0010] Preferably, the nucleotide sequence of the H2 nucleic acid hairpin structure is shown in SEQ ID NO:2.
[0011] Preferably, the nucleotide sequence of the H3 nucleic acid hairpin structure is shown in SEQ ID NO:3.
[0012] Preferably, the H3 nucleic acid hairpin structure has fluorescent groups and fluorescence quenching groups attached to both sides.
[0013] Preferably, the fluorescent group is Cy5; the fluorescent quenching group is BHQ2.
[0014] Preferably, the base portion of the nucleic acid sequence of the H4 nucleic acid hairpin structure is complementary to that of the H3 nucleic acid hairpin structure, and the nucleotide sequence of the H4 nucleic acid hairpin structure is shown in SEQ ID NO:4.
[0015] Preferably, the buffer solution includes MES buffer.
[0016] Preferably, the MES buffer contains 25 mM NaCl and 1 μM Cd. 2+ pH = 6.0.
[0017] A method for identifying the rice cadmium-low absorption gene OsNramp5 using a detection kit includes the following steps:
[0018] (1) Formation of H1, H2, H3, and H4 nucleic acid hairpin structures: The H1, H2, H3, and H4 nucleic acid hairpin structures were heated to 95°C for 5 min in buffer solution and then cooled to room temperature;
[0019] (2) Detection of OsNramp5 gene: 200 nM H1 nucleic acid hairpin structures and 600 nM H2 nucleic acid hairpin structures were incubated with the test solution at 25°C in the presence of 1 μM Cd. 2+ The OsNramp5 gene was detected by incubating for 30 minutes under the specified conditions. Then, 600 nM H3 and 1200 nM H4 nucleic acid hairpin structures were added to the above solution and incubated at room temperature for 60 minutes. Fluorescence spectra were observed in the range of 590-750 nm, thereby achieving the purpose of detecting the OsNramp5 gene.
[0020] The reaction principle of this invention is as follows:
[0021] In the presence of OsNramp5, the H1 hairpin structure is opened, forming an OsNramp5 / H1 / H2 complex, releasing Cd. 2+ DNA-dependent enzyme chains are used to initiate the cleavage reaction. In Cd... 2+ In its presence, the unwound enzyme chain autonomously cleaves the Cd in the H2 hairpin structure. 2 + The trigger DNA is released based on a substrate-dependent chain. This trigger DNA can further initiate the CHA reaction via a sticky-end mediated strand displacement reaction (TMDSR). The trigger DNA interacts with the fulcrum of H3, then unfolds H3 via TMDSR, generating a Trigger DNA / H3 complex and forming a newly exposed single-stranded H3 structure. Subsequently, the exposed H3 domain can hybridize with H4, promoting the formation of an H3 / H4 double helix. The trigger DNA is further released through fulcrum binding and branching migration. The H3 / H4 double-stranded structure prevents the fluorescent dye Cy5 and the quencher BHQ2 from approaching each other, resulting in a high fluorescence signal. Furthermore, other release-initiating DNA can react with the ununwound H3 and H4 hairpin structures, cyclically initiating the CHA reaction and ultimately generating a large amount of double-stranded H3 / H4, leading to the separation of Cy5 and BHQ2, thereby releasing the OsNramp5 gene detection signal. In the absence of the OsNramp5 gene, H1, H2, H3, and H4 maintained a stable hairpin structure, preventing DNAzyme cleavage and CHA, and only a negligible background signal was observed by fluorescence resonance energy transfer (FRET). This enabled the identification of low-cadmium genes.
[0022] A method for fluorescent identification of the rice cadmium-low absorption gene OsNramp5 includes the following steps:
[0023] (1) Formation of hairpin structures of nucleic acids H1, H2, H3, and H4. The hairpin structures of nucleic acids H1, H2, H3, and H4 were prepared in 50 nm M MES buffer (25 mM NaCl, 1 μM Cd). 2+ Heat to 95°C for 5 minutes in a solution of pH 6.0 and cool to room temperature to form a nucleic acid hairpin structure.
[0024] (2) Detection of the OsNramp5 gene. 200 nM H1 and 600 nM H2 nucleic acid hairpin structures were incubated with different concentrations of OsNramp5 at 25 °C in the presence of 1 μM Cd. 2+The solution was incubated for 30 minutes under the specified conditions. Subsequently, 600 nM H3 and 1200 nM H4 nucleic acid hairpin structures were added to the above solution and incubated at room temperature for 60 minutes. Fluorescence spectra were observed in the range of 590-750 nm (Ex = 550 nm, Em = 605 nm), thereby achieving the purpose of detecting the OsNramp5 gene.
[0025] The OsNramp5 gene is a control gene for Cd. 2+ The key metal transporter gene for absorption is not present in low-cadmium rice. The identification and breeding of low-cadmium rice can be achieved by detecting the OsNramp5 gene.
[0026] Each experimental condition has a significant impact on the experimental results. The optimal condition for each reaction is when the signal-to-noise ratio is maximized. Thus, under the optimal conditions, the experimental results are achieved to their best.
[0027] Among them, the four nucleic acid hairpin structures and buffer systems are as described in any of the above items.
[0028] In the absence of the OsNramp5 gene, H1, H2, H3, and H4 maintain stable nucleic acid hairpin structures, preventing DNAzyme cleavage and CHA; fluorescence resonance energy transfer (FRET) yields only negligible background signals. In the presence of OsNramp5, the H1 nucleic acid hairpin structure opens, forming the OsNramp5 / H1 complex, releasing Cd. 2+ A Cd-dependent enzyme chain initiates the amplification cycle. 2+ In its presence, the unwound enzyme strand autonomously cleaves Cd in the hairpin structure of H2 nucleic acid. 2+ The trigger DNA is released through a substrate-dependent reaction, leading to controlled signal transduction and amplification. The trigger DNA can further initiate CHA via sticky-end mediated strand displacement reaction (TMDSR). The trigger DNA interacts with the fulcrum of H3, then unfolds H3 via TMDSR, generating a TriggerDNA / H3 complex that exposes a new single-stranded H3 structure. Subsequently, the exposed H3 domain hybridizes with H4, promoting the formation of an H3 / H4 double helix, which further releases the trigger DNA through fulcrum binding and branching migration. The H3 / H4 double helix structure prevents the fluorescent dye Cy5 and the quencher BHQ2 from approaching sufficiently closely, resulting in a high fluorescence signal. In addition, other released initiating DNA can react with ununwound H3 and H4 hairpin structures to restart the CHA cycle, ultimately resulting in a large number of H3 / H4 double strands, leading to the separation of Cy5 and BHQ2 and producing a significantly enhanced fluorescence signal. Fluorescence spectra were observed in the 590-750 nm range (Ex = 550 nm, Em = 605 nm), thereby achieving the purpose of detecting the OsNramp5 gene and further realizing the identification and breeding of low-cadmium rice.
[0029] The beneficial effects of this invention are:
[0030] This invention uses the OsNramp5 gene as a reverse molecular biomarker and establishes an enzyme-free tetrahedral detection biosensor based on DNAzyme catalysis and catalytic hairpin self-assembly (CHA) amplification mechanism to achieve quantitative detection of OsNramp5, thereby enabling the identification and breeding of low-cadmium rice. This method possesses unique advantages such as good stability, simple and flexible design, and high sensitivity. The entire detection process is rapid, and the operation procedure can be mastered without professional training, facilitating rapid promotion and use.
[0031] The detection method and detection kit described in this invention are of great significance for the rapid identification of low-cadmium rice and the deployment of breeding platforms. Attached Figure Description
[0032] Figure 1 This is a schematic diagram of the identification and breeding method described in this invention.
[0033] Figure 2 The image shows the results of a specific experiment. Detailed Implementation
[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0035] Example 1
[0036] A method and detection kit for fluorescent identification of the rice cadmium-low absorption gene OsNramp5 are disclosed. The method uses the rice OsNramp5 gene as a reverse molecular biomarker and constructs an identification system based on nucleic acid signal amplification. The system includes four nucleic acid hairpin structures (H1, H2, H3, H4) and MES buffer (25 mM NaCl, 1 μM Cd). 2+ (pH=6.0). The nucleic acid hairpin structure sequence is as follows:
[0037] (1) H1:
[0038] 5AAGGAAGATGAGAGGTTGGCGGAGGAGATCTTCCTTCGATGATTAAAATAGTGACTCG T-3 (SEQ ID NO: 1).
[0039] (2) H2:
[0040] 5-ACACCCATACGAGTCACTATrA*GGAAGATGGCTGGGATTGATGGGTG-3 (SEQ ID NO: 2).
[0041] (3) H3:
[0042] 5-ACACCCATCAAT(BHQ2)CCCAGCCATCTTATGGGTGTAAGGTAGCAAGATGGCTGGGAT(Cy5)TG-3 (SEQ ID NO: 3).
[0043] (4) H4:
[0044] 5-GCCATCTTGCTACCTTACACCCATAAGATGGCTGGGATTGATGGGTGTAAGGTAGC-3 (SEQ ID NO: 4).
[0045] Where rA is the cleavage site, T(Cy5) represents the T-base labeled fluorescent group Cy5; T(BHQ2) represents the T-base labeled quencher group BHQ2.
[0046] A method for fluorescent identification of the rice cadmium-low absorption gene OsNramp5 is performed according to the following steps:
[0047] (1) Formation of hairpin structures of nucleic acids H1, H2, H3, and H4. The hairpin structures of nucleic acids H1, H2, H3, and H4 were prepared in 50 nm M MES buffer (25 mM NaCl, 1 μM Cd). 2+ Heat to 95°C for 5 minutes in a solution of pH 6.0 and cool to room temperature to form nucleic acid hairpin structures;
[0048] (2) Detection of the OsNramp5 gene. 200 nM H1 and 400 nM H nucleic acid hairpin structures 2 were incubated with different concentrations of OsNramp5 at 25 °C in the presence of 1 μM Cd. 2+ The solution was incubated for 30 minutes under the specified conditions. Subsequently, 600 nM H3 and 800 nM H4 were added to the above solution, and the mixture was incubated at room temperature for 60 minutes. Fluorescence spectra (E) were observed in the 590-750 nm range. x =550nm,E m = 605nm), thereby achieving the purpose of detecting the OsNramp5 gene;
[0049] (3) Identification and breeding of low-cadmium rice. OsNramp5 is a Cd-controlling... 2+ The key metal transporter gene for absorption is not present in low-cadmium rice. The identification and breeding of low-cadmium rice can be achieved by detecting the OsNramp5 gene.
[0050] Example 2
[0051] Specificity test:
[0052] Single-base mismatched OsNramp5 (SM), double-base mismatched OsNramp5 (DM), triple-base mismatched OsNramp5 (TM), and non-complementary OsNramp5 (NC) were designed as controls and added to the reaction system described in Example 1. After the reaction was complete, the fluorescence intensity was observed. The fluorescence intensity induced by SM was approximately 37% of the fluorescence intensity induced by targeting OsNramp5, indicating that SM has good single-base recognition ability. No obvious signal was observed in the reactions of other mutants. Figure 2 This further demonstrates the ideal sequence recognition capability. The above results verify that the tetrahedral-based biosensor has good specificity for recognizing the target OsNramp5 and its mutants.
[0053] The underlined letters represent mismatched bases:
[0054] SM 5-CTCCTCCGC G AACCTCTC-3(SEQ ID NO:5)
[0055] DM 5-CTCCT G CGC G AACCTCTC-3(SEQ ID NO:6)
[0056] TM 5-CTCCT G CGC G AACC A CTC-3 (SEQ ID NO:7)
[0057] NC 5- GAGGAGGCGGTTGGAGAG -3(SEQ ID NO:8)
[0058] Example 3
[0059] Identification and breeding verification of actual rice samples:
[0060] For low-cadmium rice samples, standard recovery analysis was performed by adding different concentrations of OsNramp5 standard solution to the rice samples. The results are shown in Table 1, with recoveries ranging from 97% to 105.6% and relative standard deviations (RSDs) of 5.3% to 6.7%. Furthermore, the detection results were confirmed by real-time quantitative PCR (qPCR) as the standard method, verifying the accuracy of this method.
[0061] Table 1
[0062]
[0063]
[0064] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention. sequence list <110> Hunan Agricultural University <120> A method and kit for detecting the OsNramp5 gene in rice <141> 2021-10-14 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 59 <212> DNA <213> Artificial sequence <400> 1 aaggaagatg agaggttggc ggaggagatc ttccttcgat gattaaaata gtgactcgt 59 <210> 2 <211> 46 <212> DNA <213> Artificial sequence <400> 2 acacccatac gagtcactat aggaagatgg ctgggattga tgggtg 46 <210> 3 <211> 56 <212> DNA <213> Artificial sequence <400> 3 acacccatca atcccagcca tctttatgggt gtaaggtagc aagatggctg ggattg 56 <210> 4 <211> 56 <212> DNA <213> Artificial sequence <400> 4 gccatcttgc taccttacac ccataagatg gctgggattg atgggtgtaa ggtagc 56 <210> 5 <211> 18 <212> DNA <213> Artificial sequence <400> 5 ctcctccgcg aacctctc 18 <210> 6 <211> 18 <212> DNA <213> Artificial sequence <400> 6 ctcctgcgcg aacctctc 18 <210> 7 <211> 18 <212> DNA <213> Artificial sequence <400> 7 ctcctgcgcg aaccactc 18 <210> 8 <211> 18 <212> DNA <213> Artificial sequence <400> 8 gaggaggcgg ttggagag 18
Claims
1. A detection kit for fluorescent identification of the rice cadmium-low absorption gene OsNramp5, characterized in that, The detection kit includes H1 nucleic acid hairpin structure, H2 nucleic acid hairpin structure, H3 nucleic acid hairpin structure, H4 nucleic acid hairpin structure and buffer solution; The H1 nucleic acid hairpin structure includes an OsNramp5 recognition region and a Cd... 2+ DNA-dependent enzyme chain; The nucleotide sequence of the H1 nucleic acid hairpin structure is shown in SEQ ID NO:1; The H2 nucleic acid hairpin structure contains Cd 2+ DNA-dependent substrate chains; The nucleotide sequence of the H2 nucleic acid hairpin structure is shown in SEQ ID NO:2; The nucleotide sequence of the H3 nucleic acid hairpin structure is shown in SEQ ID NO:3; The H3 nucleic acid hairpin structure has fluorescent groups and fluorescence quenching groups attached to both sides; The fluorescent group is Cy5; the fluorescence quenching group is BHQ2; The H4 nucleic acid hairpin structure is complementary to the base portion of the nucleic acid sequence of the H3 nucleic acid hairpin structure, and the nucleotide sequence of the H4 nucleic acid hairpin structure is shown in SEQ ID NO:
4.
2. The detection kit according to claim 1, characterized in that, The buffer solution includes MES buffer.
3. The detection kit according to claim 2, characterized in that, The MES buffer contains 25 mM NaCl and 1 μM Cd. 2+ pH=6.
0.
4. A method for identifying the rice cadmium-low absorption gene OsNramp5 using the detection kit according to any one of claims 1-3, characterized in that, Includes the following steps: (1) Formation of H1, H2, H3, and H4 nucleic acid hairpin structures: H1, H2, H3, and H4 nucleic acid hairpin structures were heated to 95°C for 5 min in buffer solution and then cooled to room temperature; (2) Detection of OsNramp5 gene: 200 nM H1 nucleic acid hairpin structure, 600 nM H2 nucleic acid hairpin structure and test solution were incubated at 25°C with 1 μM Cd 2+ The OsNramp5 gene was detected by incubating for 30 minutes under the specified conditions. Then, 600 nM H3 and 1200 nM H4 nucleic acid hairpin structures were added to the above solution and incubated at room temperature for 60 minutes. Fluorescence spectra were observed in the range of 590-750 nm, thereby achieving the purpose of detecting the OsNramp5 gene.
Citation Information
Patent Citations
Specific InDel molecular marker primers for detecting the rice OsNRAMP5 gene and their applications
CN111334603B
A SNP locus associated with the rice cadmium-low absorption gene OsNramp5 and its application
CN112626258B
Nucleic acid analyzing method based on cascade HCR (hybridization chain reaction)
CN107574227A
DNA logic-gated proximity assembly circuit for biochemical sensing
US20190292580A1