An African swine fever virus double antigen sandwich ELISA antibody detection kit and its preparation method and application

Abstract

The present invention relates to an African swine fever virus double antigen sandwich ELISA antibody detection kit and its preparation method and application. The kit comprises a support medium coated with African swine fever virus antigens and enzyme-labeled African swine fever virus antigens, wherein the coated African swine fever virus antigen is African swine fever virus Δp30 protein 1, and the DNA sequence of the African swine fever virus Δp30 protein 1 is shown in SEQ ID No. 1; the enzyme-labeled African swine fever virus antigen is African swine fever virus Δp30 protein 2, and the DNA sequence of the African swine fever virus Δp30 protein 2 is shown in SEQ ID No. 2. The kit has high sensitivity and accurate detection results, and can detect antibody positivity at an early stage at a low antibody level, providing a basis for clinical pig herd infection, and plays an important role in preventing and controlling African swine fever virus infection.

Description

Technical Field

[0001] The invention belongs to the field of immunoassays, and specifically relates to an African swine fever virus double antigen sandwich ELISA antibody detection kit and a preparation method thereof. Background Art

[0002] African swine fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by the African swine fever virus (ASFV). It is characterized by a short course of disease and a high mortality rate, which can be as high as 100%. The clinical symptoms and pathological changes are similar to those of acute swine fever, and it is very easy to misdiagnose during diagnosis, with symptoms such as high fever, skin congestion and cyanosis, abortion, edema, and organ bleeding.

[0003] The disease is classified as a Class I animal disease in my country and is a notifiable animal disease of the World Organization for Animal Health (OIE). Since the African swine fever was introduced into China in 2018, the epidemic has been effectively controlled. However, after 2021, new changes have occurred in the prevalence of ASF in my country, and "natural variants" have appeared clinically. These strains may cause atypical clinical symptoms after infection due to their weakened virulence, and they may be easily confused with other diseases. This means that simple etiological detection methods (such as fluorescent quantitative methods) may miss detection. Therefore, there is an urgent need to develop fast, accurate and effective ELISA antibody detection reagent products in clinical practice. Summary of the invention

[0004] To address the deficiencies in the prior art, the present invention provides an African swine fever virus double antigen sandwich ELISA antibody detection kit, as well as the preparation and application of the kit.

[0005] The first aspect of the present invention is an African swine fever virus double antigen sandwich ELISA antibody detection kit, wherein the kit comprises a supporting medium coated with an African swine fever virus antigen, and an enzyme-labeled African swine fever virus antigen, the coated African swine fever virus antigen is African swine fever virus Δp30 protein 1, and the enzyme-labeled African swine fever virus antigen is African swine fever virus Δp30 protein 2; or, the coated African swine fever virus antigen is African swine fever virus Δp30 protein 2, and the enzyme-labeled African swine fever virus antigen is African swine fever virus Δp30 protein 1; the nucleotide sequence of the African swine fever virus Δp30 protein 1 is shown in SEQ ID No.1, and the nucleotide sequence of the African swine fever virus Δp30 protein 2 is shown in SEQ ID No.2.

[0006] As one embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the coated African swine fever virus antigen is African swine fever virus Δp30 protein 1, and the enzyme-labeled African swine fever virus antigen is African swine fever virus Δp30 protein 2. According to another embodiment, the coated African swine fever virus antigen can be African swine fever virus Δp30 protein 2, and the enzyme-labeled African swine fever virus antigen can be African swine fever virus Δp30 protein 1. The amino acid sequences of Δp30 protein 2 and Δp30 protein 1 are the same, both of which are the amino acid sequences shown in SEQ ID No. 3, so the two proteins can be interregulated in the kit.

[0007] The kit of the present invention selects a specific African swine fever virus p30 protein fragment as an antigen, has high sensitivity, and accurate detection results. It can detect antibody positivity at an early stage at a lower antibody level, providing a basis for clinical pig herd infection conditions, and plays an important role in preventing and controlling African swine fever virus infection.

[0008] As an embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the supporting medium is a 96-well ELISA plate. The African swine fever virus double antigen sandwich ELISA antibody detection kit also includes ASFV positive serum, ASFV negative serum, sample diluent, 20× washing solution, blocking solution, color developing solution and stop solution.

[0009] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the sample diluent contains 8g of sodium chloride, 2.9g of disodium hydrogen phosphate, 0.24g of potassium dihydrogen phosphate, 0.2g of potassium chloride, 1mL of Proclin300, 200mL of newborn calf serum, 0.028g of PUR dye per 1L, and the balance is purified water; the 20× washing solution contains 160g of sodium chloride, 58g of disodium hydrogen phosphate, 4.8g of potassium dihydrogen phosphate, 4g of potassium chloride, 10mL of Tween 20 per 1L, and the balance is purified water; the blocking solution contains 5% W / V sucrose, 20% V / V newborn calf serum, 0.1% V / V Proclin300 PBS (0.01mol / L, pH 7.4) solution; the color developing solution includes color developing agent A solution and color developing agent B solution, the color developing agent A solution contains 14.7g of disodium hydrogen phosphate, 9.3g of citric acid, 0.3g of urea peroxide per 1L, and the balance is purified water; the color developing solution B contains 0.2g of tetramethylbenzidine (TMB) and 10ml of anhydrous ethanol per 1L, and the balance is purified water; the stop solution is 2M H2SO4.

[0010] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the coating concentration of the coated African swine fever virus antigen is 200-250 μg / L, and the coating amount is 100 μL / well.

[0011] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the coating concentration of the coated African swine fever virus antigen is 200 μg / L, and the coating volume is 100 μL / well.

[0012] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the coating concentration of the coated African swine fever virus antigen is 250 μg / L, and the coating volume is 100 μL / well.

[0013] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the African swine fever virus Δp30 protein 1 and Δp30 protein 2 are recombinant proteins expressed by a eukaryotic expression system.

[0014] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the African swine fever virus Δp30 protein 1 is a recombinant protein expressed by a baculovirus expression system; the African swine fever virus Δp30 protein 2 is a recombinant protein expressed by a CHO cell expression system.

[0015] Another aspect of the present invention is a method for preparing the African swine fever virus double antigen sandwich ELISA antibody detection kit, the preparation method comprising the following steps: (1) cloning and expressing the African swine fever virus antigenic protein Δp30 protein 1, and using the Δp30 protein 1 to coat a supporting medium such as an ELISA plate; (2) cloning and expressing the African swine fever virus antigenic protein Δp30 protein 2, and enzyme-labeling the Δp30 protein 2; (3) preparing a sample diluent, a washing solution, a color developer A solution, a color developer B solution, a stop solution, a positive pig serum control, and a negative pig serum control; and (4) assembling the components obtained in steps (1), (2), and (3) into a kit

[0016] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the nucleotide sequence of Δp30 protein 1 cloned and expressed in step (1) is as shown in SEQ ID No. 1; the coating concentration of the Δp30 protein 1 is 200-250 μg / L, and the coating amount is 100 μL / well; preferably, the coating concentration of the Δp30 protein 1 is 250 μg / L, and the coating amount is 100 μL / well.

[0017] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the step (1) uses a eukaryotic expression system to express African swine fever virus Δp30 protein 1; preferably, the eukaryotic expression system is a baculovirus expression system.

[0018] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the nucleotide sequence of Δp30 protein 2 cloned and expressed in step (2) is shown as SEQ ID No.2.

[0019] As a preferred embodiment of the present invention, in the African swine fever virus double antigen sandwich ELISA antibody detection kit of the present invention, the step (2) uses a eukaryotic expression system to express African swine fever virus Δp30 protein 2; preferably, the eukaryotic expression system is a CHO cell expression system.

[0020] Another aspect of the present invention is to provide an African swine fever virus double antigen sandwich ELISA antibody detection kit for use in the prevention and control of African swine fever.

[0021] The outstanding advantages of the present invention are:

[0022] 1. The Δp30 protein of the present invention presents the dominant antigen epitope and is a high-quality antigen that can effectively reduce the background value of the detection and improve the accuracy of the detection;

[0023] 2. The present invention provides an African swine fever virus double antigen sandwich ELISA antibody detection kit, the coating antigen of the kit contains Δp30 protein, the detection rate and sensitivity of positive samples are high, and the early low antibody level can be effectively detected;

[0024] 3. The coated antigen and enzyme-labeled antigen of the kit of the present invention are recombinant proteins expressed by different expression systems, which not only has a higher detection sensitivity, but also greatly reduces the background value, and the detection result is more accurate. DETAILED DESCRIPTION

[0025] definition

[0026] The term "baculovirus expression system" refers to a vector system widely used for efficiently expressing foreign proteins. It uses baculovirus as a vector to efficiently express foreign genes and prepare proteins.

[0027] The term "CHO ​​cell expression system", CHO cells, namely Chinese Hamster Ovary cells (Chinese Hamster Ovary Cell), are the most representative animal cell expression system and are widely used in the field of biopharmaceuticals. CHO cells are the most important expression system for the production of protein biological products.

[0028] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0029] The carbonate buffer (pH 9.6, 0.05 mol / L) used in the embodiment of the present invention is prepared as follows: 1.59 g of sodium carbonate and 2.93 g of sodium bicarbonate are dissolved in purified water and fixed to 1 L; PBS (0.01 mol / L, pH 7.4) is prepared as follows: 8.0 g of sodium chloride, 0.2 g of potassium dihydrogen phosphate, 2.89 g of disodium hydrogen phosphate dodecahydrate, and 0.2 g of potassium chloride are dissolved in purified water and fixed to 1 L. However, this embodiment does not constitute a limitation of the present invention under any circumstances.

[0030] The chemical reagents used in the present invention are all analytically pure and purchased from Sinopharm Group. The experimental methods described in the present invention are all conventional methods unless otherwise specified; the biological materials described can be obtained from commercial channels unless otherwise specified.

[0031] Example 1 Preparation of African swine fever virus Δp30 protein 1

[0032] 1.1 Sequence optimization and gene synthesis of African swine fever virus Δp30 protein 1

[0033] Using the African swine fever virus p30 gene sequence published by Genbank (accession number: MH766894.1) as a reference, the codons of the 1-183 amino acids of the African swine fever virus P30 protein were optimized, and 6 histidines were added to the C-terminus to obtain the African swine fever Δp30 protein 1, as shown in SEQ ID No. 1, and the optimized sequence was inserted into the pFastBacI vector. This work was commissioned to be completed by GenScript Biotech Co., Ltd.

[0034] 1.2 Construction of recombinant bacmid

[0035] The synthesized 5 μL recombinant plasmid pFastBac-Δp30-1 was transformed into DH10Bac competent cells, ice bathed for 30 minutes, 42°C water bathed for 60 seconds, and then ice bathed for 2 minutes, and then 400 μL of SOC medium was added and cultured at 37°C, 200rpm for 4 hours, and 100 μL of bacterial solution was spread on a plate containing IPTG / X-gal / Kana / Tetracycline / Qingda three-antibody, and cultured at 37°C for at least 48 hours. When the blue and white colonies were obvious, a single white colony was picked for secondary streaking on a plate containing IPTG / X-gal / Kana / Tetracycline / Qingda three-antibody, and cultured at 37°C for at least 12 hours. A single white colony was picked to a liquid LB medium containing kana / Tetracycline / Qingda three-antibody and shaken overnight. The next day, 1 μL was taken as a template, and the bacterial solution was identified by PCR using primers PHF and PHR primers (see Table 1) (see Table 2). The PCR reaction conditions are shown in Table 3. The PCR product was identified to be correct. The recombinant Bacmid was extracted using the reagents in the Tiangen Plasmid Extraction Kit and named Bac-Δp30-1.

[0036] Table 1: PHF and PHR primer sequences

[0037] Primer name Sequence (5'-3') PHF GGATTATTCATACCGTCCCA PHR CAAATGTGGTATGGCTGATT

[0038] Table 2: PCR system

[0039] 2× PrimeSTAR GC buffer 25μL template 1μL Primers (10pM) 1μL / 1μL dNTPs (2.5 mM) 4μL PrimeSTAR (2.5U / μL) 0.5μL <![CDATA[ddH2O]]> 17.5μL

[0040] Table 3: PCR reaction conditions

[0041]

[0042] 1.3 Obtaining and propagating recombinant baculovirus

[0043] Referring to the operating instructions of the CellfectinⅡReagent transfection kit, the recombinant Bacmid Bac-Δp30-1 was transfected into sf9 insect cells and cultured in a 27°C constant temperature incubator for about 72 hours. After the cytopathic effect was obvious, the cell supernatant was harvested and marked as rBac-Δp30-1 P1.

[0044] Add the P1 generation recombinant baculovirus to the cell culture dish with sf9 at a volume ratio of 1:20-1:40, and continue to culture at 27°C until the cell lesions are obvious around 72 hours. Harvest the supernatant and mark it as the P2 generation recombinant baculovirus, and store it in a 4°C refrigerator away from light. Repeat this step and inoculate at a ratio of 1:100-1:200 to obtain the P3 and P4 generation recombinant baculovirus.

[0045] 1.4 Expression and purification of Δp30 protein 1

[0046] The recombinant baculovirus transferred to P4 was inoculated into 1L volume of sf9 cells at a volume ratio of 1:10 to 1:100, and the cells were harvested for 48h-72h, and the infected cells were collected by centrifugation at 1000×g for 10min. The cell precipitate was lysed with cell lysis buffer (25mM NaHCO3, pH8.3), and the supernatant was obtained by centrifugation at 10000×g and 4°C for 10min. Western Blot was performed to confirm that the target protein was expressed. Affinity chromatography and molecular sieve purification were performed using a nickel column.

[0047] Example 2 Preparation of African swine fever virus Δp30 protein 2

[0048] 2.1 Sequence optimization and gene synthesis of African swine fever virus Δp30 protein 2

[0049] Using the African swine fever virus P30 gene sequence published by Genbank (accession number: MH766894.1) as a reference, the codons of the 1-183 amino acids of the African swine fever virus P30 protein were optimized, and 6 histidines were added to the C-terminus to obtain the nucleotide sequence of the African swine fever Δp30 protein 2, as shown in SEQ ID No. 2. A mouse IgG signal peptide was added to the N-terminus of the SEQ ID No. 2 sequence to obtain the synthetic gene sequence of the African swine fever Δp30 protein 2 with a signal peptide (for the construction of the following recombinant plasmid), as shown in SEQ ID No. 4. The work of gene synthesis was entrusted to GenScript Biotech Co., Ltd.

[0050] 2.2 Construction of recombinant plasmid

[0051] The gene synthesized in step 2.1 was double-digested with restriction endonucleases XbaI and HindIII (see Table 4 for the digestion system), incubated at 37°C for 2 hours, and connected to the Pcdna3.4 vector that was also double-digested (see Table 5 for the connection system), incubated at 22°C for 2 hours, and the connection product was transformed into E. coli Trans 5α competent cells, coated with ampicillin-selected resistance plates, picked monoclonal colonies, and extracted plasmids using a plasmid extraction kit. The positive recombinant plasmids were screened by enzyme digestion identification (see Table 6 for the double enzyme digestion identification system), and the positive plasmids were sent to a sequencing company for sequencing after enzyme digestion identification. The positive plasmids that were correctly identified were named pCDNA3.4-Δp30-2.

[0052] Table 4: PCR product and vector double restriction enzyme digestion system

[0053] <![CDATA[ddH2O]]> Make up to 50 μL 10×buffer 5μL DNA samples 2μg XbaI / HindIII 2.5μL / 2.5μL

[0054] Table 5: Connection system

[0055] 10×T4 connection buffer 1μL T4 Ligase 1μL Purpose fragment 6μL Carrier 2μL

[0056] Table 6: Double enzyme digestion identification system

[0057] <![CDATA[ddH2O]]> Make up to 20 μL 10×buffer 2μL Recombinant plasmid 1 μg XbaI / HindIII 1μL / 1μL

[0058] 2.3 Preparation of linearized recombinant plasmid for transfection

[0059] Take the stored bacterial solution of pCDNA3.4-Δp30-2 plasmid, inoculate it into 50 ml LB liquid medium containing kanamycin resistance, and culture it at 37°C and 220 r / min for 12 to 16 hours. Then use the OMEGA endotoxin-free plasmid extraction kit to extract the plasmid. Determine the plasmid concentration, which is not less than 1 μg / μL. Use BstZ17I endonuclease to linearize the extracted pCDNA3.4-Δp30-2 plasmid (see Table 7 for the linearization enzyme system), and the enzyme digestion conditions are 37°C for 1 to 2 hours.

[0060] Table 7: Linearization enzyme digestion system

[0061] <![CDATA[ddH2O]]> Make up to 500 μL 10×buffer 50μL pCDNA3.4-P30 50μg BZT 10μL

[0062] 2.4 Liposome-based plasmid transfection

[0063] 2.4.1 Cell preparation

[0064] 24 hours before transfection, 5×10 5 ~6×10 5 CHO-S cells were passaged at a cell density of 10 viable cells / ml. The culture flask was placed in a shaking incubator at 37°C, 8% CO2, 70-80% relative humidity, and the rotation speed was 130 rpm. On the day of transfection, viable cells were counted using Countstar. The cell viability should be greater than 95%. 6 Inoculate the cells at a density of 10 viable cells / ml into a new 125-ml culture flask, add medium to 30 ml, and place the flask on a shaking platform until transfection.

[0065] 2.4.2 Transfection

[0066] (1) In a 5 ml centrifuge tube, add 50 μg of the linearized plasmid to OptiPRO SFM medium to make the final volume 1.5 ml and mix gently to prepare the plasmid mixture.

[0067] (2) Invert the FreeStyle MAX transfection reagent tube upside down to mix, take 50 μl of the transfection reagent and add it to 1.45 ml of OptiPRO SFM to make the final volume 1.5 ml, and mix gently.

[0068] (3) Immediately add the FreeStyle MAX reagent solution diluted in step (2) to the plasmid mixture prepared in step (1), incubate the mixture at room temperature for 10 minutes, and gently mix to allow the transfection kit plasmid to form a DNA-FreeStyleMAX reagent complex.

[0069] (4) Add 3 ml of the DNA-FreeStyle MAX reagent complex obtained in step (3) dropwise into the 125-ml culture flask containing cells and shake the culture flask slowly.

[0070] (5) Place the culture flask in a shaking incubator at 37°C, 8% CO2, and 70-80% relative humidity at a rotation speed of 130 rpm.

[0071] 2.5 Pressurized screening

[0072] 48 hours after transfection, pressure screening began. The screening process was as follows:

[0073] (1) Centrifuge the cells, resuspend the cells in selection medium (CD FortiCHO medium containing 8 mM L-glutamine and 1% anti-agglomerating agent), and inoculate two T-150 culture flasks at a density of 5 × 10 5 Each T-150 flask contains 40 ml of culture medium.

[0074] (2) Add G418 to the first T-150 culture flask to a final concentration of 0.6 mg / ml. Add G418 to the second T-150 culture flask to a final concentration of 0.8 mg / ml. Then place the culture flask in an incubator at 37°C, 8% CO2, and 70-80% relative humidity.

[0075] (3) Count the cells in the culture flask on the 7th day after transfection. If the survival rate is not less than 30%, proceed directly to step (4). Otherwise, return the cells to the incubator and continue culturing. After 3 to 4 days, take samples and count the live cells. If the survival rate is still lower than the value on day 7, centrifuge the cells and resuspend them in fresh selection medium with G418 added to maintain the selection pressure. Take samples and count every 3 to 4 days, and replace the complete medium once a week until the cells show signs of recovery.

[0076] (4) When the cells showed signs of recovery, they were transferred to a 125-ml shake flask with an inoculation density of 3 × 10 5 The cells were cultured in a shaking incubator at 37°C, 8% CO2, 70-80% relative humidity, and a rotation speed of 130 rpm.

[0077] (5) The cells in the culture flask were subcultured every 3 to 4 days, and the seeding density for each subculture was 3×105 According to the volume of the culture medium, an appropriate amount of G418 was added to maintain the selection pressure.

[0078] (6) When the cell survival rate is greater than 85% and the viable cell density is greater than 1×10 6 When the concentration of viable cells / ml is reached, pressure screening is completed and the cells are frozen.

[0079] 2.6 Limited dilution cloning, screening and identification, and expansion culture

[0080] The cell pool obtained by pressure screening was limitedly diluted with a selection medium containing G418 resistance and inoculated into a 96-well plate, so that the number of cells per well was 0.5-1 / well, and cultured statically at 37°C and 5% CO2. After culturing for about 20 days, the positive cell lines with high expression levels were selected by dot hybridization detection for expansion culture. The selected single cell colonies were transferred from the 96-well plate to a 24-well plate containing clonal growth medium (CD FortiCHO complete medium and 1:100 dilution of anti-agglomeration agent). Transfer the clones to larger culture plates or vessels (i.e., 24-well plates to 6-well plates or T-25 culture flasks, and then to 125-ml culture flasks) every 2 to 5 days to expand the cell culture volume.

[0081] 2.7 Obtaining a CHO cell line stably expressing African swine fever virus Δp30 protein 2

[0082] The expression levels of different clones were identified by fed-batch culture, and the different cell clones obtained by screening were cultured by fed-batch culture using the combination of EfficientFeedTM C+AGTTM additives and Dynamis medium. The specific operations are as follows:

[0083] (1) Resuscitate each clone into a 125-mL culture flask containing Dynamis medium and culture the cells in a shaking incubator at 37°C, 8% CO2, and 70-80% relative humidity at a rotation speed of 150 rpm.

[0084] (2) Subculture cells every 2 to 3 days. After two subcultures, inoculate each clone into 60 mL of Dynamis TM 250-mL culture flasks of culture medium, 3 × 10 5 cells / ml.

[0085] (3) Starting from the third day of culture, samples were taken daily to measure glucose levels and count cells. When the glucose level was lower than 2 g / L, glucose was supplemented to 6 g / L.

[0086] (4) Feed the cells on the 3rd, 5th, 7th, and 10th days after culture. Take 2×EfficientFeedTM C+AGTTM each time and add it to 5% of the total cell culture volume.

[0087] (5) Cultivate until the cell viability reaches 80%, then terminate the cultivation, harvest the culture, centrifuge at 1000 g for 5 minutes, and collect the supernatant.

[0088] (6) Screening positive cell lines with high yield, i.e., successfully transfected cell lines, by SDS-PAGE and WB detection.

[0089] 2.8 Protein purification

[0090] Western Blot was performed on the collected supernatant of Δp30 protein 2 to confirm that the target protein was expressed, and affinity chromatography and molecular sieve purification were performed using a nickel column.

[0091] Example 3 Preparation and application of ASFV double antigen sandwich ELISA antibody detection kit

[0092] 3.1 Preparation of the kit

[0093] Antigen coated plate: The Δp30 protein 1 prepared in Example 1 was diluted to 200-300 μg / L with carbonate buffer (pH 9.6, 0.05 mol / L) for coating, 100 μL / well, and allowed to stand at 2-8°C for 16-24 hours. After washing with detergent, 150 μL / well of blocking solution (50 g of sucrose was weighed, 200 mL of newborn calf serum and 1 mL of Proclin300 were added, and the volume was fixed to 1000 mL with PBS (0.01 mol / L, pH 7.4)), and the plate was blocked at 2-8°C for 16-24 hours. The blocking solution was discarded and dried. The plate was sealed and stored at 2-8°C for later use.

[0094] Enzyme-labeled antigen: Dissolve 20 mg horseradish peroxidase (HRP) in 1 ml purified water, slowly add 1 ml NaIO4 solution, mix well, and keep it away from light at 2-8°C for 30 minutes; add 20 μl ethylene glycol to the above solution, and keep it away from light at 2-8°C for 30 minutes; add 100 μl of the above mixed solution according to the ratio of 1 mg Δp30 protein 2 prepared in Example 2, mix the two well, add to the dialysis bag, dialyze with carbonate buffer (0.05 mol / L, pH 9.6) at 2-8°C for 6 hours, then add 10 μl freshly prepared NaBH4 solution (10 mg NaBH4 dissolved in 1 ml ultrapure water), leave it at room temperature for 2 hours, and mix it every 30 minutes. The obtained product is chromatographed with molecular sieves (Hiload 16 / 600, Superdex 200pg) to remove free horseradish peroxidase. After balancing the chromatography column with deionized water and liquid C (20mmol / L NaH2PO4, 150mmol / L NaCl, pH 7.4) respectively, load the sample at a flow rate of 1ml / min. After loading, continue to separate the target protein with liquid C. Collect the protein when the peak volume is 70.5ml~73ml to obtain the enzyme-labeled antigen.

[0095] Enzyme labeling reagent: Use enzyme labeling diluent (measure 200mL newborn calf serum, 1mL Proclin 300, 0.5mL Tween 20, 0.04g AM dye, add PBS (0.01mol / L, pH 7.4) to make up to 1000mL) to dilute horseradish peroxidase-labeled Δp30 protein 2 (30000 times) as enzyme labeling reagent and store at 2-8℃.

[0096] Positive control: Take 2.5mL of recombinant African swine fever virus p30 protein positive serum, 200mL of newborn calf serum, and 1mL of Proclin 300, add PBS (0.01mol / L, pH 7.4) to make up to 1000mL, mix well and filter with a 0.22μm filter, aseptically divide into quantitative packages as a positive control, and store at 2-8℃.

[0097] Negative control: Measure 200 mL of newborn calf serum and 1 mL of Proclin300, add PBS buffer (0.01 mol / L, pH 7.4) to make up to 1000 mL, mix well and filter with a 0.22 μm filter, aseptically divide into quantitative portions as negative control, and store at 2-8°C.

[0098] Sample diluent: Take 8g sodium chloride, 2.9g disodium hydrogen phosphate, 0.24g potassium dihydrogen phosphate, 0.2g potassium chloride, 600mL purified water, 1mL Proclin300, 200mL newborn calf serum, and 0.028g PUR dye. After complete dissolution, make up to 1000mL with purified water. After mixing, filter through 0.22μm and package aseptically. Store at 2-8℃.

[0099] 20× concentrated washing solution: Take 160g sodium chloride, 58g disodium hydrogen phosphate, 4.8g potassium dihydrogen phosphate, 4g potassium chloride, 800mL ultrapure water, and 10mL Tween 20. After complete dissolution, add purified water to 1000mL, filter with a 0.22μm filter membrane, and dispense aseptically. Dilute 20 times with distilled water before use.

[0100] Color developing solution: Disodium hydrogen phosphate 14.7g, citric acid 9.3g, urea peroxide 0.3g, dissolved in purified water, dilute to 1000mL, mix, filter, and aseptically package to obtain color developing agent A. Tetramethylbenzyl diamine (TMB) 0.2g, anhydrous ethanol 10mL, dissolved in purified water, dilute to 1000mL, mix, filter, and aseptically package to obtain color developing agent B.

[0101] Stop solution: 2M H2SO4 solution.

[0102] The above components were assembled into a kit, and were labeled as kit A (coating concentration 200 μg / L), kit B (coating concentration 250 μg / L), and kit C (coating concentration 300 μg / L) according to the size of the coating concentration.

[0103] 3.2 Establishment of detection method

[0104] The detection steps are as follows:

[0105] (1) Numbering: Number the microwells corresponding to the samples in sequence. Each plate should have 2 negative control (NC) wells, 2 positive control (PC) wells, and 1 blank control well (blank control well is not required when dual-wavelength detection is used).

[0106] (2) Add 90 μl of sample diluent to each well, except for the blank and negative and positive control wells.

[0107] (3) Add 10 μl of the sample to be tested and 100 μl of the negative and positive controls to the corresponding wells, excluding the blank control wells. Gently shake to mix, seal the plate and incubate at 37°C for 30 minutes.

[0108] (4) Washing: Wash 5 times with detergent and dry for the last time.

[0109] (5) Add enzyme-labeled reagent: Add 100 μL of enzyme-labeled reagent to each well except the blank control well. Seal the plate and incubate at 37°C for 30 min.

[0110] (6) Washing: Wash 5 times with detergent and dry for the last time.

[0111] (7) Color development: Add 50 μl of color development solution A and 50 μl of color development solution B to each well, mix well, and develop color at 37°C in the dark for 15 min.

[0112] (8) Stop and detect: Add 50 μl of stop solution to each well, measure the OD450nm value of each well with an ELISA reader within 10 minutes, and make judgments based on the following result judgment criteria.

[0113] When dual wavelength measurement is used, the dual wavelengths must be set to 450nm / 600-650nm to measure the A value of each well. When single wavelength measurement is used, the wavelength of the microplate reader is set to 450nm, and the blank control well is used to adjust the zero value before measuring the A value of each well.

[0114] The test is valid when the A value of the negative control well is less than 0.1 and the A value of the positive control well is between 0.8 and 1.2, otherwise it is invalid.

[0115] Calculation method: S / P value = sample A value / average A value of positive control.

[0116] Result judgment:

[0117] Those with S / P value ≥ 0.5 are positive for African swine fever virus antibodies.

[0118] Those with an S / P value of less than 0.4 are negative for African swine fever virus antibodies.

[0119] If the S / P value is 0.4≤<0.5, the African swine fever virus antibody is suspected.

[0120] 3.3 Evaluation of the kit

[0121] 3.3.1 Specificity

[0122] The kits A, B and C prepared in Example 3.1 were used to detect 4 positive sera for common pig viruses (including positive sera for porcine circovirus type 2, positive sera for porcine reproductive and respiratory syndrome, positive sera for classical swine fever, and positive sera for pseudorabies), 1 positive sera for baculovirus, 20 sera from newborn pigs that did not eat colostrum, 30 sera from pigs immunized with routine immunization procedures that were negative for ASFV antigen, 20 sera from clinical pigs in 2016, and 20 sera from clinical pigs in 2017. The results showed that the S / P values ​​of all sera of kits A and B were <0.4, all of which were negative. When kit C detected clinical sera in 2016, 4 sera had S / P values ​​>0.5, which were judged as positive, and the rest were detected as negative. There was no African swine fever in China before 2018, indicating that the results of clinical sera in 2016 detected by the kit were actually false positives. The above results show that the kit has no cross-reaction with other major pig diseases and has good specificity; kits A and B are more specific than kit C.

[0123] 3.3.2 Sensitivity

[0124] Kit A, Kit B, and Kit C prepared in Example 3.1 were used to detect gradient dilutions (2-1024 times dilution) of recombinant ASFV P30 protein immune pig serum. The results showed that when the positive pig serum was diluted to above 1:128, although the results were difficult to judge by naked eye after the ELISA detection of each kit, they could still be read on the microplate reader and the detection results were positive. The detection limits of Kit A, Kit B, and Kit C were 256 times dilution, 512 times dilution, and 512 times dilution, respectively; the sensitivity of Kit B and Kit C was better than that of Kit A.

[0125] 3.3.3 Sensitivity

[0126] One positive serum for African swine fever (CD2v deletion) purchased from the China Veterinary Drug Administration was tested using Kit A and Kit B prepared in Example 3.1, and the results were both positive.

[0127] 3.3.4 Clinical application of the kit

[0128] According to the above results, Kit A and Kit B prepared in Example 3.1 were used for clinical application to detect 20 ASFV-positive pig sera identified by indirect immunofluorescence test and 1000 negative pig sera collected before 2018. The results showed that the S / P values ​​of the 20 ASFV-positive pig sera were ≥0.5, all of which were positive; the S / P values ​​of the 1000 negative pig sera collected before 2018 were <0.4, all of which were negative.

[0129] The above results indicate that the positive detection rate of the kit of the present invention is completely consistent with the identification result of the indirect immunofluorescence test, and the kit of the present invention has a good application prospect.

[0130] 3.3.5 Antibody growth and decline test kit

[0131] Serum was collected from 50 pigs immunized with the recombinant African swine fever virus P30 protein every day before and after immunization, and was identified by indirect immunofluorescence test, and was verified by the kit A and kit B prepared in Example 3.1 and the indirect ELISA P30 antibody detection kit disclosed in Chinese patent CN111929433A. The results are shown in Table 8.

[0132] Table 8 Antibody growth and decline test results

[0133]

[0134]

[0135] The results showed that all pigs were negative before immunization; identification was carried out through indirect immunofluorescence test, and they began to turn positive on the 5th day, and all turned positive on the 7th day; the results of the kit A and kit B of the present invention were consistent with the indirect immunofluorescence test, and the positive detection rate of the kit B was slightly higher than that of the kit A; the commercial indirect ELISA kit did not begin to detect positive until the 11th day, and all turned positive on the 15th day.

[0136] The above results indicate that the kit of the present invention can detect antibody positivity at an early stage at a lower antibody level, provide a basis for the clinical pig herd infection situation, and play an important role in preventing and controlling African swine fever virus infection.

[0137] In the above embodiment, the coated African swine fever virus antigen is African swine fever virus Δp30 protein 1, and the enzyme-labeled African swine fever virus antigen is African swine fever virus Δp30 protein 2. However, it can be understood that the coated African swine fever virus antigen can be African swine fever virus Δp30 protein 2, and the enzyme-labeled African swine fever virus antigen is African swine fever virus Δp30 protein 1, that is, the coated antigen and the enzyme-labeled antigen can be intermodulated, because Δp30 protein 1 and Δp30 protein 2 have the same amino acid sequence and are essentially the same. On the other hand, by using recombinant proteins expressed by different expression systems for the coated antigen and the enzyme-labeled antigen, the kit not only has a higher detection sensitivity, but also greatly reduces the background value, and the detection results are more accurate.

[0138] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modify the technical contents disclosed above into equivalent embodiments without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention. SEQUENCE LISTING <110> Luoyang Putai Biotechnology Co., Ltd. <120> An African swine fever virus double antigen sandwich ELISA antibody detection kit and its preparation method and application <130> 21NAP0087C <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 567 <212> DNA <213> Synthesis <400> 1 atggacttca tcctgaacat cagcatgaag atggaagtga tcttcaagac cgacctgcgt 60 agcagcagcc aggtggtgtt ccacgctggt agcctgtaca actggttcag cgtggagatc 120 atcaacagcg gtcgcatcgt gaccaccgct atcaagaccc tgctgagcac cgtgaagtac 180 gacatcgtga agtccgctcg tatctacgcc ggccagggtt acaccgagca ccaggcccag 240 gaagaatgga acatgatcct gcacgtgctg ttcgaagaag aaaccgagag ctccgcttcc 300 tccgaaaaca tccacgagaa gaacgacaac gaaaccaacg agtgtaccag ctccttcgaa 360 accctgttcg aacaggagcc ttcctccgag gtgcctaagg acagcaagct gtacatgctg 420 gcccagaaga ccgtgcagca catcgaacag tacggcaagg ctcctgactt caacaaggtt 480 atccgcgctc acaacttcat ccagaccatc tacggtaccc ctctgaagga agaggaaaag 540 gaagtggtgc accatcacca ccaccac 567 <210> 2 <211> 567 <212> DNA <213> Synthetic <400> 2 atggatttca tcctgaacat cagcatgaaa atggaagtga tcttcaagac cgacctgaga 60 agctcttccc aggtggtttt ccacgccgga tctctgtaca actggttcag cgtggaaatc 120 atcaacagcg gcagaatcgt gaccacagcc atcaagaccc tgctgagcac cgtgaagtac 180 gacatcgtca aaagcgctag aatctacgcc ggccagggct acaccgagca ccaggcccag 240 gaggaatgga atatgatcct gcacgtgctg ttcgaggaag agacagagag ctccgccagc 300 tctgagaata tccacgagaa gaacgacaac gagacaaacg agtgcaccag ctccttcgag 360 acactgtttg aacaggagcc tagcagcgag gtccccaagg acagcaagct gtacatgctg 420 gcccagaaaa cagtgcagca catcgagcaa tacggcaagg cccctgattt taacaaggtg 480 attagagccc acaacttcat ccagaccatc tatggcaccc cactcaaaga ggaagaaaag 540 gaagtggtgc accaccacca ccaccac 567 <210> 3 <211> 189 <212> PRT <213> Synthetic <400> 3 Met Asp Phe Ile Leu Asn Ile Ser Met Lys Met Glu Val Ile Phe Lys 1 5 10 15 Thr Asp Leu Arg Ser Ser Ser Gln Val Val Phe His Ala Gly Ser Leu 20 25 30 Tyr Asn Trp Phe Ser Val Glu Ile Ile Asn Ser Gly Arg Ile Val Thr 35 40 45 Thr Ala Ile Lys Thr Leu Leu Ser Thr Val Lys Tyr Asp Ile Val Lys 50 55 60 Ser Ala Arg Ile Tyr Ala Gly Gln Gly Tyr Thr Glu His Gln Ala Gln 65 70 75 80 Glu Glu Trp Asn Met Ile Leu His Val Leu Phe Glu Glu Glu Thr Glu 85 90 95 Ser Ser Ala Ser Ser Glu Asn Ile His Glu Lys Asn Asp Asn Glu Thr 100 105 110 Asn Glu Cys Thr Ser Ser Phe Glu Thr Leu Phe Glu Gln Glu Pro Ser 115 120 125 Ser Glu Val Pro Lys Asp Ser Lys Leu Tyr Met Leu Ala Gln Lys Thr 130 135 140 Val Gln His Ile Glu Gln Tyr Gly Lys Ala Pro Asp Phe Asn Lys Val 145 150 155 160 Ile Arg Ala His Asn Phe Ile Gln Thr Ile Tyr Gly Thr Pro Leu Lys 165 170 175 Glu Glu Glu Lys Glu Val Val His His His His His His 180 185 <210> 4 <211> 624 <212> DNA <213> Synthetic <400> 4 atggactgga cctggcggat cctgttcctg gtggccgctg ctaccggcgc ccattctatg 60 gatttcatcc tgaacatcag catgaaaatg gaagtgatct tcaagaccga cctgagaagc 120 tcttcccagg tggttttcca cgccggatct ctgtacaact ggttcagcgt ggaaatcatc 180 aacagcggca gaatcgtgac cacagccatc aagaccctgc tgagcaccgt gaagtacgac 240 atcgtcaaaa gcgctagaat ctacgccggc cagggctaca ccgagcacca ggcccaggag 300 gatggaata tgatcctgca cgtgctgttc gaggagaga cagagagctc cgccagctct 360 gagaatatcc acgagagaa cgacaacgag aaacgagt gcaccagctc ctcgagaca 420 ctgtttgaac aggacctag cagcgaggtc cccaaggaca gcaagctgta catgctggcc 480 cagaaaacag tgcagcacat cgagcaatac ggcaaggccc ctgattta caagtgatt 540 agagcccaca acttcatcca gaccatctat ggcaccccac tcaaagagga agaaaaggaa 600 gtggtgcacc accaccaccac 624

Claims

1. An African swine fever virus double antigen sandwich ELISA antibody detection kit, wherein: The kit includes a supporting medium coated with an African swine fever virus antigen and an enzyme-labeled African swine fever virus antigen, wherein the coated African swine fever virus antigen is African swine fever virus Δp30 protein 1, and the enzyme-labeled African swine fever virus antigen is African swine fever virus Δp30 protein 2; or, the coated African swine fever virus antigen is African swine fever virus Δp30 protein 2, and the enzyme-labeled African swine fever virus antigen is African swine fever virus Δp30 protein 1; the nucleotide sequence of the African swine fever virus Δp30 protein 1 is shown in SEQ ID No. 1, and the nucleotide sequence of the African swine fever virus Δp30 protein 2 is shown in SEQ ID No.

2.

2. The African swine fever virus double antigen sandwich ELISA antibody detection kit according to claim 1, wherein: The coating concentration of the coated African swine fever virus antigen is 200-250 μg / L, and the coating volume is 100 μL / well.

3. The African swine fever virus double antigen sandwich ELISA antibody detection kit according to claim 1, wherein The African swine fever virus Δp30 protein 1 and Δp30 protein 2 are recombinant proteins expressed by a eukaryotic expression system.

4. The African swine fever virus double antigen sandwich ELISA antibody detection kit according to claim 3, wherein: The African swine fever virus Δp30 protein 1 is a recombinant protein expressed by a baculovirus expression system, and the African swine fever virus Δp30 protein 2 is a recombinant protein expressed by a CHO cell expression system.

5. The African swine fever virus double antigen sandwich ELISA antibody detection kit according to claim 1, wherein The kit also includes ASFV positive serum, ASFV negative serum, sample diluent, 20× washing solution, blocking solution, color developing solution and stop solution.

6. The African swine fever virus double antigen sandwich ELISA antibody detection kit according to claim 5, wherein: The sample diluent contains 8 g of sodium chloride, 2.9 g of disodium hydrogen phosphate, 0.24 g of potassium dihydrogen phosphate, 0.2 g of potassium chloride, 1 mL of Proclin300, 200 mL of newborn calf serum, 0.028 g of PUR dye per 1 L, and the balance is purified water; The 20× washing solution contains 160 g of sodium chloride, 58 g of disodium hydrogen phosphate, 4.8 g of potassium dihydrogen phosphate, 4 g of potassium chloride, 10 mL of Tween 20 per 1 L, and the remainder is purified water; The blocking solution is a PBS solution containing 5% W / V sucrose, 20% V / V newborn calf serum, and 0.1% V / V Proclin 300; The color developing solution comprises a color developing agent A solution and a color developing agent B solution, wherein the color developing agent A solution contains 14.7 g of disodium hydrogen phosphate, 9.3 g of citric acid, 0.3 g of urea peroxide, and the balance is purified water per 1 L; the color developing solution B contains 0.2 g of tetramethylbenzyl diamine (TMB), 10 ml of anhydrous ethanol, and the balance is purified water per 1 L; and The stop solution is 2M H2SO4 solution.

7. The African swine fever virus double antigen sandwich ELISA antibody detection kit according to claim 1, wherein The supporting medium is a 96-well ELISA plate.

8. The method for preparing the African swine fever virus double antigen sandwich ELISA antibody detection kit according to any one of claims 1 to 7, wherein: The preparation method comprises the following steps: (1) cloning and expressing African swine fever virus antigenic protein Δp30 protein 1, and using the Δp30 protein 1 to coat a supporting medium such as an ELISA plate; (2) cloning and expressing African swine fever virus antigenic protein Δp30 protein 2, and enzyme-labeling the Δp30 protein 2; (3) preparing a sample diluent, a washing solution, a color developer A solution, a color developer B solution, a stop solution, a positive pig serum control, and a negative pig serum control; and (4) assembling the components obtained in steps (1), (2), and (3) into a kit.

9. The preparation method according to claim 8, wherein: The step (1) uses a eukaryotic expression system to express African swine fever virus Δp30 protein 1; the step (2) uses a eukaryotic expression system to express African swine fever virus Δp30 protein 2.

10. The preparation method according to claim 8, wherein: The coating concentration of the Δp30 protein 1 is 200-250 μg / L, and the coating volume is 100 μL / well.

11. Use of the African swine fever virus double antigen sandwich ELISA antibody detection kit according to any one of claims 1 to 7 in the prevention and control of African swine fever, wherein the use is for non-diagnostic and therapeutic purposes.

Images