KASP molecular marker, detection method and application of wheat leaf rust resistance gene Lr16G216 in adult stage

Abstract

The invention discloses a KASP molecular marker, a detection method and an application of a wheat leaf rust resistance gene Lr16G216 in the adult stage, and belongs to the field of molecular breeding technology. The KASP molecular markers tightly linked to the wheat leaf rust resistance gene Lr16G216 in the adult stage are Ax109403980 and Ax95083494, and the above two molecular markers are co-localized with the wheat leaf rust resistance gene Lr16G216 in the adult stage on the long arm of wheat chromosome 6B, and the genetic distance between the two is 0.59cM. Compared with conventional molecular markers, the molecular markers provided by the invention can not only efficiently, accurately and high-throughput detect the genetic mapping population of Lr16G216, and be applied to the fine positioning and map cloning of Lr16G216, but also can perform high-throughput molecular marker-assisted selection, realize high-throughput screening of the disease resistance gene Lr16G216 in a large breeding population in a short time, and can effectively improve the efficiency of molecular breeding for wheat leaf rust resistance.

Description

Technical Field

[0001] The present invention belongs to the field of wheat molecular biotechnology and breeding applications, and specifically relates to a KASP molecular marker for detecting the wheat leaf rust resistance gene Lr16G216 in the adult stage, a detection method and an application thereof. The present invention can provide new gene resources for wheat leaf rust resistance breeding; the KASP molecular marker tightly linked to Lr16G216 can be used for molecular marker-assisted selection breeding of leaf rust resistance genes. Background Art

[0002] Wheat is the third largest grain crop in my country, and its green production is of great significance to ensuring national food security. Wheat leaf rust is a fungal disease caused by the leaf rust fungus Puccinia triticna, which can cause yield losses of 7% to 20%, and up to 50% in epidemic years. my country's Huanghuaihai wheat area, Northwest wheat area, Southwest wheat area and the middle and lower reaches of the Yangtze River are areas where wheat leaf rust often occurs and reoccurs. In recent years, with global warming and changes in farming methods, leaf rust has shown an increasing trend in my country's major wheat areas. Practice has proved that breeding and using disease-resistant varieties is a green and environmentally friendly way to prevent and control wheat leaf rust.

[0003] Mining and identifying leaf rust resistance genes is the key to breeding rust-resistant varieties. At present, 80 leaf rust resistance genes have been officially named in the wheat family. These genes are distributed on 19 chromosomes other than 5A and 6D. Most of them belong to seedling resistance genes. This type of disease resistance is usually controlled by a single major effect gene, which can induce allergic necrosis reaction and inhibit further infection of pathogens. It is widely used in early leaf rust resistance breeding; however, this type of resistance has strong race-specific resistance, and often loses resistance due to evolutionary variation of toxic races of leaf rust fungi, thus losing its breeding value. At present, there are only 15 known leaf rust resistance genes for adult plants, including Lr12, Lr13, Lr22 (alleles a and b), Lr34, Lr35, Lr37, Lr46, Lr48, Lr49, Lr67, Lr68, Lr74, Lr75, Lr77 and Lr78. Adult plant resistance is usually controlled by multiple micro-effect genes. This resistance has a certain resistance to most physiological subspecies, but it is not completely immune. It can reduce the selection pressure on pathogen subspecies, thereby maintaining the persistence and stability of host disease resistance. Therefore, under the current breeding goal of pursuing durable disease resistance, it is of great significance to explore adult plant resistance genes with broad-spectrum resistance and cultivate varieties with durable disease resistance.

[0004] In the process of wheat molecular breeding, the development of molecular markers is crucial. Traditional molecular markers mainly rely on laboratory gel electrophoresis, which greatly limits the detection efficiency of target genes. With the rapid development of wheat genomics, the hexaploid common wheat variety 'Chinese Spring', wild emmer wheat, durum wheat, diploid ancestral species Urartu and Aegilops tauschii, and wheat 10+ genome sequence information have been published one after another, which has greatly promoted the efficiency of DNA variation detection and molecular marker development, especially the emergence of the third-generation KASP (Kompetitive Allele Specific PCR, KASP) molecular markers based on SNP (Single nucleotide polymorphism), which has provided great convenience for gene or QTL positioning, cloning and molecular marker-assisted breeding. KASP technology is a method based on primer end base specific matching during PCR to achieve SNP / Indel (Insertion-deletion) typing. It can accurately perform double allele typing, avoid laboratory gel electrophoresis, and greatly improve the efficiency of genotyping. At present, KASP markers have played an important role in wheat gene positioning, map-based cloning and molecular marker-assisted selection breeding.

[0005] 'Yang 16G216' is a new green, multi-resistant and high-yield wheat line bred by the Jiangsu Lixiahe Regional Agricultural Science Research Institute. It is highly resistant to powdery mildew (carrying the Pm21 gene) and yellow mosaic disease (carrying QYm.nau-2D). The material is susceptible to the local mixed leaf rust species at the seedling stage, but shows higher resistance in the field during the adult stage, indicating that Yang 16G216 has typical adult resistance to leaf rust. The highly susceptible leaf rust line 'Yang 16M6393' was also bred by the Jiangsu Lixiahe Regional Agricultural Science Research Institute. A hybrid combination was prepared using the highly susceptible leaf rust line Yang 16M6393 and Yang 16G216, and a recombinant inbred line population (RILs) was constructed through multiple generations of selfing. Genetic analysis of the RIL population revealed a major and stable leaf rust resistance gene in the adult stage on chromosome 6B, named "Lr16G216", which originated from the leaf rust resistant parent 'Yang 16G216'. Therefore, developing molecular markers closely linked to the gene Lr16G216 is of great significance for improving the selection efficiency of this gene in leaf rust resistance breeding. Summary of the invention

[0006] The object of the present invention is to provide an adult leaf rust resistance gene Lr16G216 from the common wheat line 'Yang 16G216', which can provide a new gene resource for wheat leaf rust resistance breeding.

[0007] Another object of the present invention is to provide a KASP molecular marker and fluorescent quantitative PCR primers that are tightly linked to Lr16G216.

[0008] The third aspect of the present invention is to provide the application of molecular markers tightly linked to the wheat leaf rust resistance gene Lr16G216.

[0009] The purpose of the present invention is achieved by the following technical solutions:

[0010] The wheat leaf rust resistance gene Lr16G216 in the adult stage comes from the leaf rust resistant common wheat line 'Yang 16G216'. The gene is located on the long arm of wheat chromosome 6B, and its physical position in the RefSeqv1.0 genome version is 712.34-713.94Mb. Lr16G216 has stable resistance to wheat leaf rust and can be detected in four environments; its contribution rate is large, and it can explain 58.12-85.75% of the phenotypic variation. The present invention provides the use of the wheat leaf rust resistance gene Lr16G216 in wheat leaf rust resistance breeding.

[0011] The invention provides a KASP molecular marker tightly linked to the wheat leaf rust resistance gene Lr16G216 at the adult stage. The KASP molecular markers are Ax109403980 and Ax95083494. The two molecular markers and the wheat leaf rust resistance gene Lr16G216 at the adult stage are co-localized on the long arm of wheat chromosome 6B, and the genetic distance between the two is 0.59 cM.

[0012] The present invention provides a KASP molecular marker Ax109403980 closely linked to the wheat leaf rust resistance gene Lr16G216 in the adult stage, which is obtained by PCR amplification of three primers with nucleotide sequences as shown in SEQ ID NOs. 1 to 3. The three primers include two upstream primers and one universal downstream primer, and the 5' ends of the two upstream primers are respectively modified with different fluorescent groups; the nucleotide sequences of the three primers are respectively shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 (the underlined part is the sequence of the fluorescent group):

[0013] SEQ ID NO.1: GAAGGTGACCAAGTTCATGCT TGCGGGGTCATCTAATTCTGA

[0014] SEQ ID NO.2: GAAGGTCGGAGTCAACGGATT TGCGGGGTCATCTAATTCTGG

[0015] SEQ ID NO.3:GGGAATGTCGCCAACCAGAT

[0016] The present invention provides a KASP molecular marker Ax95083494 closely linked to the wheat leaf rust resistance gene Lr16G216 in the adult stage, which is obtained by PCR amplification of three primers with nucleotide sequences as shown in SEQ ID NOs. 4 to 6. The three primers include two upstream primers and one universal downstream primer, and the 5' ends of the two upstream primers are respectively modified with different fluorescent groups; the nucleotide sequences of the three primers are respectively shown in SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6 (the underlined part is the sequence of the fluorescent group):

[0017] SEQ ID NO.4: GAAGGTGACCAAGTTCATGCT TGGTGACGGGAGACAGGAG

[0018] SEQ ID NO.5: GAAGGTCGGAGTCAACGGATT TGGTGACGGGAGACAGGAA

[0019] SEQ ID NO.6: AGTGCTACGTACGCATGTCG

[0020] The specific primer combination provided by the invention for detecting the KASP molecular marker Ax109403980 tightly linked to the wheat leaf rust resistance gene Lr16G216 in the adult stage contains primers with nucleotide sequences as shown in SEQ ID NOs.1-3.

[0021] The invention provides a specific primer combination for detecting the KASP molecular marker Ax95083494 tightly linked to the wheat leaf rust resistance gene Lr16G216 in the adult stage, comprising primers with nucleotide sequences as shown in SEQ ID NOs. 4-6.

[0022] The polymorphism of the KASP molecular marker Ax109403980 tightly linked to the wheat leaf rust resistance gene Lr16G216 in the adult stage provided by the invention is A / G, and the polymorphism of Ax95083494 is G / A.

[0023] The use of the above-mentioned KASP molecular marker or the above-mentioned specific primer combination in at least one of (1) to (3):

[0024] (1) Detection of the wheat leaf rust resistance gene Lr16G216 and its fine positioning and map-based cloning;

[0025] (2) Conduct molecular marker-assisted selection for the wheat leaf rust resistance gene Lr16G216;

[0026] (3) Identify or breed wheat varieties resistant to leaf rust.

[0027] A method for detecting the leaf rust resistance gene Lr16G216 in the adult stage of wheat, using the above-mentioned KASP molecular marker or the above-mentioned specific primer combination to determine the genotype of the wheat sample to be tested:

[0028] ① If the allele of KASP molecular marker Ax109403980 is AA, it is a homozygous disease-resistant genotype carrying gene Lr16G216; if the allele is G / A, it is a heterozygous disease-resistant genotype carrying gene Lr16G216; if the allele is GG, it is a susceptible genotype not carrying Lr16G216;

[0029] ② If the allele of KASP molecular marker Ax95083494 is GG, it is a homozygous disease-resistant genotype carrying gene Lr16G216. If the allele is A / G, it is a heterozygous disease-resistant genotype carrying gene Lr16G216. If the allele is AA, it is a susceptible genotype not carrying Lr16G216.

[0030] The above method for detecting the wheat leaf rust resistance gene Lr16G216 in the adult stage specifically comprises the following steps:

[0031] (1) extracting genomic DNA from wheat leaves to be tested as a template;

[0032] (2) using the specific primer combination of the KASP molecular markers Ax109403980 and Ax95083494 to perform PCR amplification on the genomic DNA of the sample to be tested to obtain an amplification product;

[0033] (3) Centrifuge the amplified product and observe the bottom of the PCR reaction plate to ensure that there are no bubbles;

[0034] (4) Scan the genotype of the PCR amplification product using a fluorescent quantitative PCR detector (ABI Vii) and measure the fluorescence signal at 35°C;

[0035] (5) Data genotype analysis of the scan results was performed using TaqManGenotyper v1.3.1;

[0036] (6) Determine the genotype of the wheat sample to be tested according to the genotyping of polymorphic loci.

[0037] In the above step (2), the amplification reaction system of the PCR amplification is: 10-20 ng / μL DNA 1.0 μL, HiGeno2×Probe Mix 5 μL, primer mixture 0.112 μL, ddH2O 3.89 μl, and the total system is 10 μl.

[0038] The method for preparing the specific primer combination into a primer mixture is to mix the upstream primer 1, the upstream primer 2, and the downstream primer, all of which have a primer concentration of 100 μM, with ddH2O in a volume ratio of 12:12:30:46 to obtain a primer mixture.

[0039] The PCR amplification program was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s, gradient annealing at 65°C and extension for 60 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 1°C in each cycle; denaturation at 95°C for 20 s, annealing at 57°C and extension for 60 s, for a total of 33 cycles.

[0040] A method for identifying or breeding leaf rust-resistant wheat varieties, characterized in that the above-mentioned KASP molecular marker or the above-mentioned specific primer combination is used to determine the genotype of the wheat sample to be tested, and the disease-resistant wheat variety carrying the gene Lr16G216 is selected:

[0041] ① If the allele of KASP molecular marker Ax109403980 is AA, it is a homozygous disease-resistant genotype carrying gene Lr16G216; if the allele is G / A, it is a heterozygous disease-resistant genotype carrying gene Lr16G216; if the allele is GG, it is a susceptible genotype not carrying Lr16G216;

[0042] ② If the allele of KASP molecular marker Ax95083494 is GG, it is a homozygous disease-resistant genotype carrying gene Lr16G216. If the allele is A / G, it is a heterozygous disease-resistant genotype carrying gene Lr16G216. If the allele is AA, it is a susceptible genotype not carrying Lr16G216.

[0043] Beneficial effects of the present invention:

[0044] (1) Good resistance to leaf rust: The present invention discloses for the first time the leaf rust resistance gene Lr16G216 from the new common wheat line 'Yang 16G216' in the adult stage, which is located on the long arm of wheat chromosome 6B. Lr16G216 has stable resistance to wheat leaf rust and can be detected in four environments; it has a large contribution rate and can explain 58.12-85.75% of the phenotypic variation. This gene has a high utilization value in wheat leaf rust resistance breeding.

[0045] (2) High accuracy: The present invention discloses KASP molecular markers Ax109403980 and Ax95083494 linked to the leaf rust resistance gene in the adult stage of wheat. The above two molecular markers are flanking markers of Lr16G216, and the genetic distance between the two is 0.59 cM, with a high degree of linkage. In the breeding process, PCR amplification is performed using a specific primer combination of the above markers, and the accuracy of molecular marker-assisted selection of the leaf rust resistance gene Lr16G216 is high.

[0046] (3) High detection throughput: The linked molecular marker disclosed in the present invention is a KASP marker, which can get rid of the limitation of gel electrophoresis and increase the detection flux by thousands of times. In molecular marker-assisted breeding, disease-resistant plants can be quickly screened out, thus improving breeding efficiency.

[0047] (4) Co-dominant markers: The linked molecular markers disclosed in the present invention are co-dominant markers that can distinguish between homozygous and heterozygous disease resistance loci with high resolution and are more accurate in fine positioning, map-based cloning, and molecular marker-assisted breeding of the leaf rust gene Lr16G216. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The leaf rust resistance performance of Yang 16G216 (a) and Yang 16M6393 (b) in the adult stage in the field.

[0049] Figure 2 The figure shows the location of the wheat leaf rust resistance gene Lr16G216 in the adult stage on chromosome 6BL in Example 1.

[0050] Figure 3 The encrypted genetic linkage map (A) and physical map (B) of the wheat adult leaf rust resistance gene Lr16G216 in Example 2.

[0051] Figure 4 The genotyping diagram of wheat samples detected by KASP molecular markers Ax109403980 and Ax95083494 in Example 3;

[0052] Among them, A is the genotyping map of wheat samples detected by KASP molecular marker Ax109403980; B is the genotyping map of wheat samples detected by KASP molecular marker Ax95083494. DETAILED DESCRIPTION

[0053] In order to make the purpose, technical scheme and excellent effect of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. Without departing from the spirit and essence of the present invention, the modification or replacement of the method, steps or conditions of the present invention all belong to the scope of the present invention. If not specifically indicated, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0054] The biological material sources in the present invention are:

[0055] Yang16G216, Yang16M6393 and Yangmai 29 are all new high-yield wheat varieties (lines) developed by the Lixiahe Regional Agricultural Science Research Institute in Jiangsu Province. Yang16G216 and Yang16M6393 were developed in 2016, and Yangmai 29 was developed in 2015 and approved by the Jiangsu Provincial Crop Approval Committee in 2018. Yang16G216 showed high resistance to leaf rust in the field, while Yang16M6393 and Yangmai 29 showed high susceptibility to leaf rust ( Figure 1 ). Yang 16G216, Yang 16M6393 and Yangmai 29 were sent to the Yangzhou Branch of the National Wheat Improvement Center for disease resistance identification in the 2021-2022 growing season. The wheat varieties and identification results have been published on the website of the Yangzhou Branch of the National Wheat Improvement Center (http: / / www.wheat.org.cn / fzx / index.asp). By crossing Yang 16M6393 and Yang 16G216, the hybrid F1 obtained was self-pollinated to obtain the F2 population. After multiple generations of self-pollination combined with greenhouse generation until the F6 generation, a recombinant inbred line population containing 224 families was obtained. By crossing Yangmai 29 and Yang 16G216, the hybrid F1 obtained was self-pollinated to obtain the F2 population. After multiple generations of self-pollination combined with greenhouse generation until the F8 generation, a recombinant inbred line population containing 240 families was obtained.

[0056] ② Wheat 55K SNP chip: This is an economical medium-density SNP chip developed based on the wheat 660K SNP chip. The chip contains 53,063 wheat SNP markers, evenly distributed on the 21 chromosomes of wheat, and is suitable for general germplasm resource diversity analysis, genetic mapping and new gene discovery, comparative genome analysis, variety registration and identification (fingerprint analysis). This chip is commercially available. The genotype analysis of the genetic population in this study was completed by Zhongyujin Marker (Beijing) Biotechnology Co., Ltd.

[0057] Example 1 Discovery of the leaf rust resistance gene Lr16G216 in the adult stage of Yang16G216

[0058] 1. Identification of wheat leaf rust resistance at the adult stage

[0059] Leaf rust was identified by natural field disease, with the highly susceptible wheat variety Yangmai 18 as the inducing material. The resistance of the RIL population of "Yang 16G216×Yang 16M6393" to wheat leaf rust in the adult stage was identified in four environments (2019WT, 2020WT, 2020ST and 2021WT). When the inducing material Yangmai 18 was fully diseased, the disease resistance phenotype of the test material was recorded, and the reaction type was determined according to the 0-4 classification standard (Table 1). Each environment was surveyed twice.

[0060] Table 1 Classification criteria for wheat populations for leaf rust resistance

[0061] Reactive grade Symptoms Immunity (I) 0 No uredia, normal leaf color, no symptoms High resistance (HR) 1 The summer spore pile is very small, the number is small, and there is a dieback reaction around it Medium resistance (MR) 2 Summer spores are small to medium, with dieback and chlorosis around them Moderate Sensitivity (MS) 3 The summer spores are medium to large in size, with no dieback reaction, but slight chlorosis High Sensitivity (HS) 4 The summer spore piles are large and numerous, with no dieback reaction or chlorosis phenomenon

[0062] 2. Construction of genetic linkage map

[0063] The genotype of the RIL population of "Yang 16G216×Yang 16M6393" was analyzed using a 55K SNP chip, and a total of 4016 polymorphic SNP markers were obtained. The genetic linkage map was constructed using JoinMap v4.0.

[0064] 3. Localization of leaf rust resistance sites in adult plants

[0065] Using the leaf rust phenotypic data of the above population, the Inclusive Composite Interval Mapping-ADD (ICIM-ADD) in QTL IciMapping v4.1 was used to detect leaf rust resistance loci under the condition of setting the threshold LOD ≥ 3.0, that is, genetic linkage positioning of leaf rust resistance genes was performed. A major and stably expressed wheat leaf rust resistance gene was located in the 2.8cM interval on the long arm of chromosome 6B, and it was named "Lr16G216". Lr16G216 has stable resistance to wheat leaf rust and can be detected in all four environments; the contribution rate is large, which can explain 58.12-85.75% of the phenotypic variation ( Figure 2 ).

[0066] Example 2 Encryption of genetic map and acquisition of tightly linked molecular markers

[0067] 1. Development of KASP molecular markers

[0068] In order to encrypt the genetic map and obtain a molecular marker closely linked to the leaf rust resistance gene Lr16G216, the genetic map of the wheat leaf rust resistance site Lr16G216 in the adult stage and the wheat SNP marker information were combined, and the online platform PolyMaker website (http: / / polymarker.info / ) was used to design KASP for the candidate SNP, and then the chromosome-specific marker was selected from it. For the designed KASP marker sequence, a FAM or HEX fluorescent linker sequence was added to the 5' end of the two upstream primers, wherein the FAM fluorescent linker sequence was 5'-GAAGGTGACCAAGTTCATGCT-3', and the HEX fluorescent linker sequence was 5'-GAAGGTCGGAGTCAACGGATT-3'. All primers in this embodiment were synthesized by Nanjing Qingke Biological Co., Ltd.

[0069] 2. Polymorphism screening of KASP molecular markers

[0070] The extremely disease-resistant and extremely susceptible families from the three parental lines Yang 16G216, Yang 16M6393, and Yangmai 29 as well as the "Yang 16G216×Yang 16M6393" RIL population were selected for polymorphic molecular marker screening.

[0071] 3. Acquisition of tightly linked molecular markers Ax109403980 and Ax95083494

[0072] The polymorphic KASP molecular markers obtained by screening were used to perform genotyping analysis on the "Yang 16G216×Yangmai 29" RIL population. Combined with the leaf rust phenotypic identification data of the RIL population, the composite interval mapping method was used to obtain the encrypted genetic map of the leaf rust resistance gene Lr16G216 in the adult stage. The gene Lr16G216 was further located between the KASP markers Ax109403980 and Ax95083494, with a genetic distance of 0.59 cM and a physical position of 712.34–713.94 Mb ( Figure 3 ).

[0073] Example 3 Application of KASP molecular markers Ax109403980 and Ax95083494 in selecting leaf rust resistance gene Lr16G216 at adult stage

[0074] 1. Based on the phenotypic data of leaf rust resistance identification in the field, 46 extremely resistant families and 46 extremely susceptible families were selected from the two RIL populations of "Yang 16G216×Yang 16M6393" and "Yang 16G216×Yangmai 29".

[0075] 2. KASP molecular marker amplification was performed on the DNA of the selected 92 families, the three parents Yang 16G216, Yang 16M6393, Yangmai 29, and Yang 16G216 / Yang 16M6393 F1. The specific method was as follows:

[0076] (1) extracting genomic DNA from the above materials as a template;

[0077] (2) using the specific primer combination of KASP molecular markers Ax109403980 and Ax95083494 to perform PCR amplification on the genomic DNA of the sample to be tested to obtain amplification products;

[0078] (3) The specific primer combination in the above step (2) is prepared into a primer mixture according to the following method: the upstream primer 1, the upstream primer 2, and the downstream primer, all of which have a primer concentration of 100 μM, are mixed with ddH2O in a volume ratio of 12:12:30:46 to obtain a primer mixture.

[0079] (4) The amplification reaction system for PCR amplification is: 10-20 ng / μL DNA 1.0 μL, HiGeno 2×Probe Mix 5 μL, primer mixture 0.112 μL, ddH2O 3.89 μl, the total system is 10 μl.

[0080] (5) The PCR amplification program was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s, gradient annealing and extension at 65°C for 60 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 1°C in each cycle; denaturation at 95°C for 20 s, annealing and extension at 57°C for 60 s, for a total of 33 cycles.

[0081] (6) Centrifuge the amplified product and observe the bottom of the PCR reaction plate to ensure that there are no bubbles;

[0082] (7) Scan the genotype of the PCR amplification product using a fluorescent quantitative PCR detector (ABI Vii) and detect the fluorescence signal at 35°C;

[0083] (8) Data genotype analysis of the scan results was performed using TaqManGenotyper v1.3.1;

[0084] (9) According to the polymorphic site genotyping, the genotype of the sample to be tested is determined. The genotyping results are shown in Figure 4 :

[0085] ① If the allele of KASP molecular marker Ax109403980 is AA, it is a homozygous disease-resistant genotype carrying gene Lr16G216; if the allele is G / A, it is a heterozygous disease-resistant genotype carrying gene Lr16G216; if the allele is GG, it is a susceptible genotype not carrying Lr16G216;

[0086] ② If the allele of KASP molecular marker Ax95083494 is GG, it is a homozygous disease-resistant genotype carrying gene Lr16G216. If the allele is A / G, it is a heterozygous disease-resistant genotype carrying gene Lr16G216. If the allele is AA, it is a susceptible genotype not carrying Lr16G216.

[0087] Table 2 Correspondence between genotypes and leaf rust resistance phenotypes of 96 wheat samples

[0088]

[0089]

[0090]

[0091] The experimental results show that among the 96 samples, the genotype and disease resistance performance have a good correspondence (Table 2), that is, the marker Ax109403980 is amplified as the AA genotype and the Ax95083494 is amplified as the GG genotype, and the marker Ax109403980 is amplified as the GG genotype and the Ax95083494 is amplified as the AA genotype. All are susceptible phenotypes (HS). The above results show that the KASP molecular markers Ax109403980 and Ax95083494 of the leaf rust resistance gene in the adult stage of the present invention can be used to track the leaf rust resistance gene Lr16G216, and have high detection throughput and are easy to realize automation, which is conducive to improving the efficiency of leaf rust resistance breeding.

[0092] The above embodiments are only preferred embodiments of the present invention and are not intended to limit the present invention. Any non-substantial modifications or changes made to the above embodiments by those skilled in the art without violating the spirit and scope of the present invention shall fall within the scope of protection claimed by the present invention. Sequence Listing <110> Jiangsu Lixiahe Region Agricultural Science Research Institute <120> KASP molecular marker, detection method and application of wheat leaf rust resistance gene Lr16G216 in adult stage <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 42 <212> DNA <213> Artificial Sequence <400> 1 gaaggtgacc aagttcatgc ttgcggggtc atctaattct ga 42 <210> 2 <211> 42 <212> DNA <213> Artificial Sequence <400> 2 gaaggtcgga gtcaacggat ttgcggggtc atctaattct gg 42 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 gggaatgtcg ccaaccagat 20 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <400> 4 gaaggtgacc aagttcatgc ttggtgacgg gagacaggag 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <400> 5 gaaggtcgga gtcaacggat ttggtgacgg gagacaggaa 40 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 agtgctacgt acgcatgtcg 20

Claims

1. Genes related to wheat leaf rust resistance in adult stage Lr16G216 The tightly linked KASP molecular marker is characterized by: The KASP molecule is labeled Ax109403980 and Ax95083494, The KASP molecular marker Ax109403980 and Ax95083494 and genes Lr16G216 Co-localized on the long arm of wheat chromosome 6B, the genetic distance between the two was 0.59 cM; the KASP molecular marker Ax109403980 The polymorphism of is A / G; the KASP molecular marker Ax95083494 The polymorphism is G / A; The KASP molecular marker Ax109403980 It is obtained by amplification using the following three primers, wherein the three primers include two upstream primers and one universal downstream primer, and the 5' ends of the two upstream primers are modified with different fluorescent groups respectively; the nucleotide sequences of the three primers are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively; The KASP molecular marker Ax95083494 It was obtained by amplification with the following three primers, wherein the three primers include two upstream primers and one universal downstream primer, and the 5' ends of the two upstream primers are modified with different fluorescent groups respectively; the nucleotide sequences of the three primers are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 respectively.

2. A specific primer combination for KASP molecular marker, characterized in that: The KASP molecule is labeled Ax109403980 and Ax95083494, The KASP molecular marker Ax109403980 and Ax95083494 and genes Lr16G216 Co-localized on the long arm of wheat chromosome 6B, the genetic distance between the two was 0.59 cM; the KASP molecular marker Ax109403980 The polymorphism of is A / G; the KASP molecular marker Ax95083494 The polymorphism is G / A; Ax109403980 Primers containing nucleotide sequences as shown in SEQ ID NO.1-3; Ax95083494 The primers contain nucleotide sequences as shown in SEQ ID NO.4~6.

3. Use of the KASP molecular marker according to claim 1 or the specific primer combination according to claim 2 in at least one of (1) to (3): (1) Detection of wheat leaf rust resistance genes Lr16G216 and its fine mapping and positional cloning; (2) Identification of wheat leaf rust resistance genes Lr16G216 Molecular marker-assisted selection; (3) Identify or breed wheat varieties resistant to leaf rust.

4. A method for detecting wheat leaf rust resistance genes Lr16G216 The method is characterized in that The KASP molecular marker described in claim 1 or the specific primer combination described in claim 2 is used to determine the genotype of the wheat sample to be tested: ①KASP molecular marker Ax109403980 If the allele is AA, it is a carrier gene Lr16G216 If the allele is G / A, it is a homozygous disease-resistant genotype. Lr16G216 The heterozygous disease-resistant genotype, if the allele is GG, it does not carry Lr16G216 susceptible genotype; ②KASP molecular marker Ax95083494 If the allele is GG, it is a carrier gene Lr16G216 The homozygous disease-resistant genotype, if the allele is A / G, it is a carrier of the gene Lr16G216 The heterozygous disease-resistant genotype is not a carrier if the allele is AA. Lr16G216 susceptible genotype.

5. The method according to claim 4, characterized in that The following steps are involved: (1) Extract genomic DNA from wheat leaves to be tested as a template; (2) Using the KASP molecular marker Ax109403980 and Ax95083494 PCR amplification is performed on the genomic DNA of the sample to be tested using the specific primer combination to obtain the amplified product; (3) Centrifuge the amplified product and observe the bottom of the PCR reaction plate to ensure there are no bubbles; (4) Scan the genotype of the PCR amplification product using a fluorescent quantitative PCR detector and measure the fluorescence signal at 35°C; (5) Data genotype analysis of the scanning results was performed using TaqManGenotyper v1.3.1; (6) Determine the genotype of the wheat sample according to the genotyping of polymorphic loci.

6. A method for identifying or breeding wheat varieties resistant to leaf rust, characterized in that: The KASP molecular marker described in claim 1 or the specific primer combination described in claim 2 is used to determine the genotype of the wheat sample to be tested, and the wheat sample carrying the gene is selected. Lr16G216 Disease-resistant wheat samples: ①KASP molecular marker Ax109403980 If the allele is AA, it is a carrier gene Lr16G216 If the allele is G / A, it is a homozygous disease-resistant genotype. Lr16G216 The heterozygous disease-resistant genotype, if the allele is GG, it does not carry Lr16G216 susceptible genotype; ②KASP molecular marker Ax95083494 If the allele is GG, it is a carrier gene Lr16G216 The homozygous disease-resistant genotype, if the allele is A / G, it is a carrier of the gene Lr16G216 The heterozygous disease-resistant genotype is not a carrier if the allele is AA. Lr16G216 susceptible genotype.

Images