Construction method and application of a SARS-CoV-2 susceptible model pig expressing three human genes

Abstract

The invention discloses a method for constructing a SARS-CoV-2 susceptible model pig expressing three human genes and its application. The invention constructs a porcine recombinant cell integrating and expressing three human genes (ACE2 gene, AXL gene and TMPRSS2 gene) at a specific position in the genome by using the CRISPR / Cas9 system and homologous recombination technology. Further, a SARS-CoV-2 susceptible model pig is obtained by somatic cell nuclear transfer technology using the recombinant cell. The model pig can be used for the next step of drug, vaccine and antibody screening, evaluation of the effects of drugs, vaccines and antibodies, and research on the pathogenesis mechanism.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to gene editing technology. Specifically, it relates to pig recombinant cells constructed using the CRISPR / Cas9 system and homologous recombination technology, which integrate and express three human genes (ACE2 gene, AXL gene and TMPRSS2 gene) at specific locations in the genome. The recombinant cells can be used to prepare SARS-CoV-2 susceptible model pigs, thereby using them in the field of biomedicine. Background Art

[0002] Human angiotensin I converting enzyme 2 (hACE2) is a homolog of human angiotensin-converting enzyme, a zinc metalloprotease, and a type 1 transmembrane protein. It serves as the receptor protein for coronaviruses such as SARS-CoV-2 and SARS-CoV in the human body. It is widely present in various tissues of the human body and is currently known to be the key protein that causes SARS-CoV-2 to enter host cells and cause host disease.

[0003] SARS-CoV-2 entry into host cells requires the binding of the viral spike protein (S) to the cell receptor and the activation of the S protein by host cell proteases. Human serine protease 2 (TMPRSS2) plays a key role in activating the S protein in this process.

[0004] In addition, human AXL receptor tyrosine kinase has been found to be a new SARS-CoV-2 receptor that is independent of ACE2. It mediates the adsorption and internalization of the virus on respiratory system cells by specifically binding to the NTD region at the N terminus of the SARS-CoV-2 spike protein.

[0005] Currently, there are no effective drugs against SARS-CoV-2, and countries around the world are racing against time to develop a SARS-CoV-2 vaccine. Animal models are crucial for elucidating the infection and pathogenesis of SARS-CoV-2, its transmission routes, and for the development and evaluation of antiviral drugs, vaccines, and antibodies.

[0006] In the prior art, mice are commonly used as model animals. Mice differ significantly from humans in terms of body shape, organ size, physiology, and pathology, and cannot accurately simulate normal human physiological and pathological conditions. Pigs, however, are large animals and have long been the primary source of meat for humans. Their size and physiological functions are similar to those of humans, making them easy to breed and raise on a large scale. Furthermore, they have lower ethical and animal protection requirements, making them ideal animal models for human diseases.

[0007] Gene editing is a biotechnology that has made significant progress in recent years. It encompasses technologies ranging from homologous recombination-based gene editing to nuclease-based editing techniques such as ZFNs, TALENs, and CRISPR / Cas9. CRISPR / Cas9 is currently the most advanced gene editing technology. Currently, gene editing technology is increasingly being applied to the creation of animal models. Summary of the Invention

[0008] The technical problem solved by the present invention is to provide a pig recombinant cell constructed by using the CRISPR / Cas9 system and homologous recombination technology, which integrates and expresses three human genes (ACE2 gene, AXL gene and TMPRSS2 gene) at a specific position of the genome. Furthermore, the recombinant cell is used to obtain a SARS-CoV-2 susceptible model pig through somatic cell nuclear transplantation technology. The model pig can be used for the next step of drug, vaccine and antibody screening and drug, vaccine and antibody effect evaluation and pathogenesis research.

[0009] The present invention provides a method for preparing recombinant cells, comprising the following steps: integrating a DNA molecule named DNA molecule A into the genomic DNA of pig cells to obtain recombinant cells; the DNA molecule A expresses human ACE2 protein, human AXL protein and human TMPRSS2 protein.

[0010] Specifically, the human ACE2 protein (hACE2 protein) is shown in SEQ ID NO: 15.

[0011] Specifically, the human AXL protein (hAXL protein) is shown in SEQ ID NO:16.

[0012] Specifically, the human TMPRSS2 protein (hTMPRSS2 protein) is shown in SEQ ID NO:17.

[0013] Human ACE2 protein is encoded by the human ACE2 gene.

[0014] Human AXL protein is encoded by the human AXL gene.

[0015] Human TMPRSS2 protein is encoded by the human TMPRSS2 gene.

[0016] Specifically, the human ACE2 gene (hACE2 gene) is shown as nucleotides 2290-4704 in SEQ ID NO: 14.

[0017] Specifically, the human AXL gene (hAXL gene) is represented by nucleotides 4771 to 6648 in SEQ ID NO:14.

[0018] Specifically, the human TMPRSS2 gene (hTMPRSS2 gene) is represented by nucleotides 6712-8298 in SEQ ID NO:14.

[0019] In the DNA molecule A, the human ACE2 gene, the human AXL gene and the human TMPRSS2 gene are present in the same expression cassette.

[0020] In the DNA molecule A, the expression of human ACE2 gene, human AXL gene and human TMPRSS2 gene is driven by the same promoter.

[0021] Specifically, the promoter is human hEF1α promoter.

[0022] Specifically, the human hEF1α promoter is shown in nucleotides 1094-2271 of SEQ ID NO:14.

[0023] In the DNA molecule A, the expression of human ACE2 gene, human AXL gene and human TMPRSS2 gene is terminated by the same termination codon.

[0024] In the DNA molecule A, the human ACE2 gene, the human AXL gene and the human TMPRSS2 gene share a Poly (A) signal.

[0025] Specifically, the Poly(A) signal is EF1αPoly(A).

[0026] Specifically, EF1αPoly(A) is represented by nucleotides 8302-8874 in SEQ ID NO:14.

[0027] In the DNA molecule A, the human ACE2 gene, the human AXL gene, and the human TMPRSS2 gene are present in the same coding frame, separated by a gene encoding a 2A peptide. The 2A peptide is also known as a self-splicing peptide, a self-cleaving peptide, or a 2A self-cleaving peptide.

[0028] The 2A peptide may specifically be a P2A peptide.

[0029] The 2A peptide may specifically be a T2A peptide.

[0030] Specifically, the gene encoding the P2A peptide is shown in nucleotides 4705-4770 in SEQ ID NO: 14.

[0031] Specifically, the gene encoding the T2A peptide is shown in nucleotides 6649-6711 in SEQ ID NO: 14.

[0032] Specifically, in the DNA molecule A, the coding frames of the human ACE2 gene, the human AXL gene and the human TMPRSS2 gene are shown as nucleotides 1094-8874 in SEQ ID NO: 14.

[0033] The DNA molecule A also includes a resistance screening gene expression cassette. The resistance screening gene can be a gene encoding a Puromycin resistance protein. The resistance screening gene expression cassette is shown in nucleotides 8987-10262 of SEQ ID NO: 14.

[0034] The DNA molecule A also includes a LoxP sequence.

[0035] The DNA molecule A specifically includes two LoxP sequences, which are shown as nucleotides 8911-8944 and nucleotides 10307-10340 in SEQ ID NO: 14, respectively.

[0036] The DNA molecule A also includes an insulator.

[0037] The DNA molecule A specifically includes two insulators, which are represented by nucleotides 887-1087 and 10349-10549 in SEQ ID NO: 14, respectively.

[0038] The DNA molecule A includes the following segments from upstream to downstream: human hEF1α promoter, hACE2 gene, nucleotides encoding P2A peptide, hAXL gene, nucleotides encoding T2A peptide, hTMPRSS2 gene, termination codon, EF1αPoly (A), LoxP sequence, SV40 promoter, nucleotides encoding Puromycin resistance protein, termination codon, SV40Poly (A), and LoxP sequence.

[0039] The DNA molecule A includes the following segments from upstream to downstream: insulator 1, human hEF1α promoter, hACE2 gene, nucleotides encoding P2A peptide, hAXL gene, nucleotides encoding T2A peptide, hTMPRSS2 gene, stop codon, EF1αPoly (A), LoxP sequence, SV40 promoter, nucleotides encoding Puromycin resistance protein, stop codon, SV40Poly (A), LoxP sequence, insulator 3.

[0040] Specifically, the DNA molecule A is shown as nucleotides 887-10549 in SEQ ID NO: 14.

[0041] Specifically, the DNA molecule A is shown as nucleotides 881-10549 in SEQ ID NO: 14.

[0042] The method of implementing the method of "integrating the DNA molecule named DNA molecule A into the genomic DNA of pig cells" is: introducing a DNA molecule named DNA molecule B into pig cells or introducing a recombinant plasmid containing the DNA molecule B into pig cells; the DNA molecule B contains the DNA molecule A and has an upstream homology arm upstream of the DNA molecule A and a downstream homology arm downstream of the DNA molecule A, and the upstream homology arm and the downstream homology arm are used to integrate the DNA molecule A into the genomic DNA of pig cells.

[0043] The homology arms are for the ROSA26 gene, the upstream homology arm is the SH1 left arm, and the downstream homology arm is the SH1 right arm. The SH1 left arm is shown as nucleotides 9-339 in SEQ ID NO: 3, and the SH1 right arm is shown as nucleotides 9184-10195 in SEQ ID NO: 3.

[0044] The homology arms are homology arms for the AAVS1 gene, the upstream homology arm is the SH2 left arm, and the downstream homology arm is the SH2 right arm. The SH2 left arm is shown in SEQ ID NO: 4, and the SH2 right arm is shown in SEQ ID NO: 5.

[0045] The homology arms are for the H11 site, the upstream homology arm is the SH3 left arm, and the downstream homology arm is the SH3 right arm. The SH3 left arm is shown in SEQ ID NO: 6, and the SH3 right arm is shown in SEQ ID NO: 7.

[0046] The homology arms are homology arms for the COL1A1 gene, the upstream homology arm is the SH4 left arm, and the downstream homology arm is the SH4 right arm. The SH4 left arm is shown in SEQ ID NO: 8, and the SH4 right arm is shown in SEQ ID NO: 9.

[0047] The homology arms are for the COL1A1 gene, the upstream homology arm is the SH4 left arm, and the downstream homology arm is the SH4 right arm. The SH4 left arm is shown as nucleotides 9-880 in SEQ ID NO: 14, and the SH4 right arm is shown as nucleotides 10550-11276 in SEQ ID NO: 14.

[0048] The DNA molecule B includes the following segments from upstream to downstream: upstream homology arm, insulator 1, human hEF1α promoter, hACE2 gene, nucleotides encoding P2A peptide, hAXL gene, nucleotides encoding T2A peptide, hTMPRSS2 gene, stop codon, EF1α Poly (A), LoxP sequence, SV40 promoter, nucleotides encoding Puromycin resistance protein, stop codon, SV40 Poly (A), LoxP sequence, insulator 3, and downstream homology arm.

[0049] Specifically, the DNA molecule B is shown as nucleotides 9 to 11276 in SEQ ID NO: 14.

[0050] Specifically, the recombinant plasmid containing the DNA molecule B is shown in SEQ ID NO: 14.

[0051] DNA molecule A is integrated into the ROSA26 gene, AAVS1 gene, H11 site, or COL1A1 gene of the genomic DNA of the pig cell, preferably the COL1A1 gene.

[0052] DNA molecule A is integrated into the ROSA26 safe harbor insertion site, AAVS1 safe harbor insertion site, H11 safe harbor insertion site, or COL1A1 safe harbor insertion site of the genomic DNA of the pig cell, preferably the COL1A1 safe harbor insertion site.

[0053] Integration of DNA molecule A into the ROSA26 gene of the genomic DNA of pig cells refers to inserting DNA molecule A between the SH1 left arm and the SH1 right arm in the genomic DNA; the SH1 left arm is represented by nucleotides 9-339 in SEQ ID NO: 3, and the SH1 right arm is represented by nucleotides 9184-10195 in SEQ ID NO: 3.

[0054] Integration of DNA molecule A into the AAVS1 gene of the genomic DNA of pig cells refers to inserting DNA molecule A between the SH2 left arm and the SH2 right arm in the genomic DNA; the SH2 left arm is shown in SEQ ID NO: 4, and the SH2 right arm is shown in SEQ ID NO: 5.

[0055] Integration of DNA molecule A into the H11 site of the genomic DNA of pig cells refers to inserting DNA molecule A between the SH3 left arm and the SH3 right arm in the genomic DNA; the SH3 left arm is shown in SEQ ID NO: 6, and the SH3 right arm is shown in SEQ ID NO: 7.

[0056] Integration of DNA molecule A into the COL1A1 gene of the genomic DNA of pig cells refers to inserting DNA molecule A between the SH4 left arm and the SH4 right arm in the genomic DNA; the SH4 left arm is shown in SEQ ID NO: 8, and the SH4 right arm is shown in SEQ ID NO: 9.

[0057] Integration of DNA molecule A into the COL1A1 gene of the genomic DNA of pig cells refers to inserting DNA molecule A between the SH4 left arm and the SH4 right arm in the genomic DNA; the SH4 left arm is represented by nucleotides 9-880 in SEQ ID NO: 14, and the SH4 right arm is represented by nucleotides 10550-11276 in SEQ ID NO: 14.

[0058] In the method, the recombinant plasmid containing the DNA molecule B is introduced into pig cells together with two auxiliary plasmids; the two auxiliary plasmids are the sgRNA plasmid and the Cas9 plasmid;

[0059] The sgRNA plasmid is transcribed to obtain a specific sgRNA; the specific sgRNA is sgRNA ROSA26-g3 sgRNA AAVS1-g4 sgRNA H11-g1 or sgRNA COL1A1-g3 sgRNA ROSA26-g3 The target sequence binding region is shown in nucleotides 1 to 20 of SEQ ID NO: 10; sgRNA AAVS1-g4 The target sequence binding region is shown in nucleotides 1 to 20 of SEQ ID NO: 11; sgRNA H11-g1 The target sequence binding region is shown in nucleotides 1 to 20 of SEQ ID NO: 12; sgRNA COL1A1-g3 The target sequence binding region is shown as nucleotides 1 to 20 in SEQ ID NO: 13;

[0060] Cas9 plasmid expresses Cas9 protein.

[0061] The Cas9 plasmid can specifically be plasmid pKG-GE3.

[0062] Specifically, the sgRNA plasmid is obtained by inserting the coding sequence of the target sequence binding region of the specific sgRNA into the pKG-U6gRNA vector with the help of the restriction endonuclease BbsI.

[0063] The molar ratio of the recombinant plasmid containing the DNA molecule B, the sgRNA plasmid and the Cas9 plasmid can be specifically 1:3:1.

[0064] The specific ratio of pig cells, recombinant plasmid having the DNA molecule B, sgRNA plasmid and Cas9 plasmid can be: about 200,000 pig cells: 1.3 μg recombinant plasmid having the DNA molecule B: 0.8 μg sgRNA plasmid: 0.9 μg Cas9 plasmid.

[0065] Specifically, the ROSA26 safe harbor insertion site and its surrounding region in the pig genome are shown in SEQ ID NO: 18.

[0066] Specifically, the AAVS1 safe harbor insertion site and its surrounding region in the pig genome are shown in SEQ ID NO: 19.

[0067] Specifically, the H11 safe harbor insertion site and its surrounding region in the pig genome are shown in SEQ ID NO: 20.

[0068] Specifically, the COL1A1 safe harbor insertion site and its surrounding region in the pig genome are shown in SEQ ID NO: 21.

[0069] The present invention also protects a kit comprising any one of the above-mentioned DNA molecules B.

[0070] The present invention also protects a kit comprising a recombinant plasmid containing any one of the above-mentioned DNA molecules B.

[0071] The kit also includes the sgRNA plasmid and the Cas9 plasmid.

[0072] The molar ratio of the recombinant plasmid containing the DNA molecule B, the sgRNA plasmid and the Cas9 plasmid can be specifically 1:3:1.

[0073] The present invention also protects the use of any of the above-mentioned DNA molecules B in preparing a kit.

[0074] The present invention also protects the use of a recombinant plasmid having any of the above-mentioned DNA molecules B in preparing a kit.

[0075] The present invention also protects the use of a recombinant plasmid, an sgRNA plasmid, and a Cas9 plasmid having any of the above-mentioned DNA molecules B in preparing a kit.

[0076] The use of any of the above kits is as follows (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing SARS-CoV-2 susceptible pig model; (c) preparing SARS-CoV-2 susceptible pig cell model or SARS-CoV-2 susceptible pig tissue model or SARS-CoV-2 susceptible pig organ model.

[0077] The present invention also protects the use of any of the above-mentioned DNA molecules B, a recombinant plasmid comprising any of the above-mentioned DNA molecules B, or any of the above-mentioned kits, for the following (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing a SARS-CoV-2 susceptible pig model; (c) preparing a SARS-CoV-2 susceptible pig cell model or a SARS-CoV-2 susceptible pig tissue model or a SARS-CoV-2 susceptible pig organ model.

[0078] Any of the above pig cells is a primary pig fibroblast.

[0079] The pig can be any breed of pig, and preferably, the pig can be a Congjiang Xiang pig.

[0080] The pig may specifically be a newborn pig.

[0081] The plasmid pKG-GE3 contains a specific fusion gene, which encodes a specific fusion protein.

[0082] The specific fusion protein includes the following elements from N-terminus to C-terminus: two nuclear localization signals, Cas9 protein, two nuclear localization signals, P2A peptide, fluorescent reporter protein, T2A peptide, and resistance screening marker protein;

[0083] In the plasmid pKG-GE3, the expression of the specific fusion gene is driven by the EF1a promoter;

[0084] In the plasmid pKG-GE3, the specific fusion gene has a WPRE sequence element, a 3'LTR sequence element and a bGH poly (A) signal sequence element downstream.

[0085] Plasmid pKG-GE3 contains the following elements in order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3'LTR sequence element, and bGH poly(A) signal sequence element.

[0086] In the specific fusion protein, the two nuclear localization signals upstream of the Cas9 protein are SV40 nuclear localization signals, and the two nuclear localization signals downstream of the Cas9 protein are nucleoplasmin nuclear localization signals.

[0087] In the specific fusion protein, the fluorescent reporter protein can specifically be EGFP protein.

[0088] In the specific fusion protein, the resistance screening marker protein can specifically be a Puromycin resistance protein.

[0089] The amino acid sequence of the P2A peptide is "ATNFSLLKQAGDVEENPGP" (the cleavage position is between the first and second amino acid residues starting from the C-terminus).

[0090] The amino acid sequence of the T2A peptide is "EGRGSLLTCGDVEENPGP" (the cleavage position is between the first and second amino acid residues starting from the C-terminus).

[0091] The specific fusion gene is specifically shown as nucleotides 911-6706 in SEQ ID NO: 1.

[0092] The CMV enhancer is shown in nucleotides 395-680 of SEQ ID NO: 1.

[0093] The EF1a promoter is shown in nucleotides 682 to 890 of SEQ ID NO: 1.

[0094] The WPRE sequence element is shown in nucleotides 6722-7310 of SEQ ID NO: 1.

[0095] The 3'LTR sequence element is shown in SEQ ID NO: 1 at nucleotides 7382-7615.

[0096] The bGH poly(A) signal sequence element is shown as nucleotides 7647-7871 in SEQ ID NO: 1.

[0097] The plasmid pKG-GE3 is specifically shown as SEQ ID NO: 1.

[0098] The plasmid pKG-U6gRNA contains the DNA molecule represented by nucleotides 2280-2637 in SEQ ID NO: 2.

[0099] The plasmid pKG-U6gRNA is specifically shown in SEQ ID NO: 2.

[0100] Specifically, sgRNA ROSA26-g3 As shown in SEQ ID NO:10.

[0101] Specifically, sgRNA AAVS1-g4 As shown in SEQ ID NO:11.

[0102] Specifically, sgRNA H11-g1 As shown in SEQ ID NO:12.

[0103] Specifically, sgRNA COL1A1-g3 As shown in SEQ ID NO:13.

[0104] sgRNA ROSA26-g3 (SEQ ID NO: 10):

[0105] GAAGGAGCAAACUGACAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0106] sgRNA AAVS1-g4 (SEQ ID NO: 11):

[0107] UGCAGUGGGUCUUUGGGGACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0108] sgRNA H11-g1 (SEQ ID NO: 12):

[0109] UUCCAGGAACAUAAGAAAGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0110] sgRNA COL1A1-g3 (SEQ ID NO: 13):

[0111] GCAGUCUCAGCAACCACUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0112] The present invention also protects the recombinant cells prepared by any of the above methods.

[0113] Specifically, the recombinant cell may be the following recombinant cell: compared with the primary porcine fibroblast, the only difference in the genomic DNA of the recombinant cell is that the DNA molecule represented by nucleotides 881-10549 in SEQ ID NO: 14 is inserted between the SH4 left arm and the SH4 right arm in the porcine genomic DNA.

[0114] The present invention also protects the use of the recombinant cells in preparing SARS-CoV-2 susceptible model pigs.

[0115] The recombinant cells are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, which are SARS-CoV-2 susceptible model pigs.

[0116] The recombinant cells are used as nuclear transplant donor cells for somatic cell cloning to prepare cloned pigs, which can be specifically prepared by the following method:

[0117] (1) Ovaries were isolated and cumulus-oocyte complexes (COCs) were extracted from follicles with a diameter of 3 to 6 mm. COCs with at least three layers of dense cumulus cells were selected and inoculated into 4-well plates. Each well was filled with 400 μL of porcine oocyte in vitro maturation medium, with 50 COCs inoculated into each well. Each well was covered with 400 μL of mineral oil. The culture plates containing COCs were incubated in an incubator at 38.5°C, 5% CO2, and saturated humidity for 42 hours.

[0118] (2) After completing step (1), the expanded cumulus cells of COCs were repeatedly blown away with 0.1% (w / v) hyaluronidase, and the oocytes with intact membranes and expelled first polar bodies were cultured in NCSU23 medium containing 0.1 mg / mL demeclofenac, 0.05 M sucrose, and 4 mg / mL bovine serum albumin for 0.5-1 h to promote the protrusion of the oocyte nucleus. Then, a microinjection needle with an inclined tip was used to inject the oocytes in a medium containing 10 μM HEPES, 0.3% (w / v) polyvinylpyrrolidone, 10% The protruding nuclei and polar bodies were removed in Tyrode's lactate medium containing FBS, 0.1 mg / mL demeclocycline, and 5 mg / mL cytochalasin B. Then, a single nuclear donor cell was injected into the perivitelline space of the enucleated oocyte, and the nuclear donor cell was fused with the recipient oocyte for 20 μs using an embryo cell fusion instrument in fusion medium using a 200 V / mm direct current pulse. Then, the reconstructed embryos were cultured in PZM-3 medium for 2 h to allow nuclear reprogramming, and then activated with a single pulse of 150 V / mm for 100 μs in activation medium. Then, the activated reconstructed embryos were placed in PZM-3 medium containing 5 μg / mL cytochalasin B for 2 hours to further activate the embryos. The reconstructed embryos were then cultured in PZM-3 medium.

[0119] (3) The reconstructed embryos that have been activated and cultured for 6 hours are transplanted into the oviduct of a surrogate sow and raised normally to obtain offspring, namely cloned pigs.

[0120] The surrogate sow can specifically be a Erhua-faced sow.

[0121] The surrogate sow can specifically be a 9-month-old Erhua-faced sow.

[0122] The present invention also protects pig cells, pig tissues or pig organs of SARS-CoV-2 susceptible model pigs prepared using the recombinant cells.

[0123] The present invention also protects the use of any of the above recombinant cells.

[0124] The present invention also protects the use of pig cells, pig tissues or pig organs of SARS-CoV-2 susceptible model pigs prepared using the recombinant cells.

[0125] The present invention also protects the use of SARS-CoV-2 susceptible model pigs prepared using the recombinant cells.

[0126] The application is as follows (d1) or (d2) or (d3):

[0127] (d1) Screening for drugs and / or vaccines and / or antibodies to treat novel coronavirus infection;

[0128] (d2) Evaluate the effectiveness of drugs and / or vaccines and / or antibodies for novel coronavirus infection;

[0129] (d3) Study the pathogenesis of novel coronavirus infection.

[0130] Human ACE2 gene (hACE2 gene) information: Encodes angiotensin-converting enzyme 2 [Homo sapiens]; located on human chromosome X; Gene ID 59272. Angiotensin-converting enzyme 2 [Homo sapiens], also known as hACE2 protein, is the recognized receptor protein for coronaviruses such as SARS-CoV-2 and SARS-CoV, as shown in SEQ ID NO: 15 (NP_001358344.1).

[0131] Human AXL gene (hAXL gene) information: Encodes AXL receptor tyrosine kinase [Homo sapiens]; located on human chromosome 19; Gene ID 558. AXL receptor tyrosine kinase [Homo sapiens], also known as hAXL protein, is a recently discovered protein that independently mediates SARS-CoV-2 infection, independent of hACE2 protein, as shown in SEQ ID NO: 16 (NP_001265528.1).

[0132] Human TMPRSS2 gene (hTMPRSS2 gene) information: Encodes transmembrane protease serine 2 [Homo sapiens]; located on human chromosome 21; Gene ID 7113. Transmembrane protease serine 2 [Homo sapiens], also known as hTMPRSS2 protein, can mediate the binding of SARS-CoV-2 to host cell receptors by activating the SARS-CoV-2 spike (S) protein, thereby promoting SARS-CoV-2 entry into host cells, as shown in SEQ ID NO: 17 (NP_001128571.1).

[0133] Compared with the prior art, the present invention has at least the following beneficial effects:

[0134] (1) The research object of the present invention (pig) has better applicability than other animals (rat, mouse, and primate).

[0135] Rodents such as mice and rats differ significantly from humans in terms of body shape, organ size, physiology, and pathology, making them unable to truly simulate normal human physiological and pathological conditions. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but their small size, late sexual maturity (mating begins at 6-7 years old), and single-birth primates make population expansion extremely slow and their breeding costs very high. Furthermore, primate cloning is inefficient, difficult, and costly.

[0136] Pigs, as model animals, do not have these drawbacks. They are the closest relative to humans besides primates, with body shape, weight, and organ size similar to humans. Their anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis are highly similar to humans. Furthermore, pigs reach sexual maturity early (4-6 months), have high fertility, and can produce many offspring per litter, allowing them to form a large herd within 2-3 years. Furthermore, pig cloning technology is highly mature, and the costs of cloning and rearing pigs are much lower than those of primates.

[0137] (2) The present invention explored the expression of genes after knock-in at four safe harbor sites in the pig genome, and screened out the best safe harbor site in the pig genome for insertion of exogenous genes, which can effectively improve the expression of the target gene after gene knock-in.

[0138] (3) Using the hACE2-hAXL-hTMPRSS2 homozygous knock-in single-cell clone obtained by the present invention for somatic cell nuclear transplantation animal cloning can directly obtain cloned pigs with hACE2-hAXL-hTMPRSS2 homozygous knock-in, and the homozygous inserted gene can be stably inherited.

[0139] In mouse model creation, microinjection of gene-edited material into fertilized eggs followed by embryo transfer is typically performed. However, the probability of directly obtaining homozygous mutant offspring is very low (less than 5%), requiring cross-breeding of offspring, which is not suitable for model creation in large animals with long gestation periods, such as pigs. Therefore, the present invention utilizes a technically challenging and difficult method of in vitro editing of primary cells and screening for positively edited single-cell clones. Later, the corresponding pig model is directly obtained through somatic cell nuclear transfer animal cloning technology. This significantly shortens the pig model creation cycle and saves manpower, material, and financial resources.

[0140] (4) The hACE2-hAXL-hTMPRSS2 humanized pigs prepared by the present invention can be used for preclinical experimental research on coronavirus animal infection models.

[0141] The present invention, through gene editing, has generated a humanized pig model expressing the three genes hACE2, hAXL, and hTMPRSS2. This model will help study and reveal the infection mechanism of coronaviruses such as SARS-CoV-2, which is jointly mediated by hACE2, hAXL, and hTMPRSS2. It can also be used for drug screening, efficacy evaluation, and testing the efficacy of vaccines and antibodies. It can provide effective experimental data for further clinical applications and, in turn, provide a powerful experimental method for preventing and treating human coronavirus infections such as SARS-CoV-2. This invention has significant application value in the development of drugs, vaccines, and antibodies targeting SARS-CoV-2 and in revealing the infection mechanism of the virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0142] Figure 1 Schematic diagram of the structure of plasmid PB-1G 2R 3-puro-ROSA26.

[0143] Figure 2 This is a diagram showing the regulation of GFP green fluorescence expression by different safe harbor sites.

[0144] Figure 3 Fluorescence quantitative PCR results showing that different safe harbor sites regulate the transcription level of GFP gene.

[0145] Figure 4 These are the FACS detection results of GFP protein expression regulated by different safe harbor sites.

[0146] Figure 5Schematic diagram of the structure of plasmid pKG-hACE2-hAXL-hTMPRSS2.

[0147] Figure 6 These are the results of single cell clone hACE2, hAXL and hTMPRSS2 gene transcription level detection.

[0148] Figure 7 These are the results of FACS detection of the protein expression levels of hACE2, hAXL and hTMPRSS2 in single cell clones.

[0149] Figure 8 This is a photo of a model pig obtained through somatic cell cloning.

[0150] Figure 9 Results of hACE2, hAXL, and hTMPRSS2 gene transcription level detection in humanized pigs.

[0151] Figure 10 Results of FACS analysis of hACE2, hAXL, and hTMPRSS2 protein expression levels in humanized pigs.

[0152] Figure 11 Schematic diagram of the structure of plasmid pMD2.G-SARS-C19.

[0153] Figure 12 Schematic diagram of the structure of plasmid Lenti-mCherry.

[0154] Figure 13 This is a photo of the fluorescence signal of model pig alveolar macrophages after pseudovirus infection.

[0155] Figure 14 This is a photograph of the fluorescence signal of wild-type control pig alveolar macrophages after pseudovirus infection. DETAILED DESCRIPTION

[0156] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0157] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The recombinant plasmids constructed in the examples have all been sequenced and verified. Complete culture medium (% is volume ratio): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, constant temperature incubator with 5% CO2 and 5% O2.

[0158] The porcine primary fibroblasts used in the examples were prepared from ear tissue of newborn Congjiang Xiang pigs (female, blood type AO). The following procedures were used to prepare porcine primary fibroblasts: ① 0.5 g of pig ear tissue was removed, hair and bone tissue removed, and then soaked in 75% ethanol for 30-40 seconds. The tissue was then washed five times with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco), followed by one wash with PBS buffer. ② The tissue was minced with scissors and digested with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 hour. The cells were then centrifuged at 500 g for 5 minutes and the supernatant discarded. ③ The pellet was resuspended in 1 mL of complete culture medium and plated onto a 10 cm diameter cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR). The cells were cultured until they approximately covered 60% of the bottom of the dish. ④ After completing step ③, the cells were trypsinized, harvested, and resuspended in complete culture medium. These cells were used for subsequent electroporation experiments.

[0159] eEF1a-mNLS-hSpCas9-EGFP-PURO is abbreviated as plasmid pKG-GE3 (circular plasmid), as shown in SEQ ID NO: 1. In SEQ ID NO: 1, nucleotides 395-680 constitute the CMV enhancer, nucleotides 682-890 constitute the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode the P2A peptide (the amino acid sequence of the P2A peptide is "ATNFSLLKQAGDVEENPGP" and the cleavage position is Nucleotides 5333-6046 encode the EGFP protein, nucleotides 6056-6109 encode the T2A peptide (the amino acid sequence of the T2A peptide is "EGRGSLLTCGDVEENPGP," with the cleavage site being between the first and second amino acid residues from the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 constitute the WPRE sequence element, nucleotides 7382-7615 constitute the 3'LTR sequence element, and nucleotides 7647-7871 constitute the bGH poly(A) signal sequence element. In SEQ ID NO: 1, nucleotides 911-6706 form a fusion gene that expresses a fusion protein. Due to the presence of the P2A peptide and the T2A peptide, the fusion protein spontaneously forms the following three proteins: a protein containing the Cas9 protein, a protein containing the EGFP protein, and a protein containing the Puro protein. Recorded in patent application 202011170395.1 (application publication number is CN 112522261A; application publication date is 2021.03.19).

[0160] The pKG-U6gRNA vector, also known as the plasmid pKG-U6gRNA (circular plasmid), is shown in SEQ ID NO: 2. In SEQ ID NO: 2, nucleotides 2280-2539 constitute the hU6 promoter, and nucleotides 2558-2637 are used to transcribe the gRNA backbone. During use, a 20-bp DNA molecule (used to transcribe the target sequence binding region of the gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid. The recombinant plasmid is then transcribed into cells to produce the gRNA. This is described in patent application 202011170395.1 (publication number CN 112522261 A; publication date March 19, 2021).

[0161] Example 1: Screening for the optimal safe harbor site in the pig genome for site-directed insertion of exogenous genes

[0162] 1. Construction of Donor Vectors Containing Different Safe Harbor Sites of GFP Gene

[0163] Plasmids PB-1G 2R 3-puro-ROSA26, PB-1G 2R 3-puro-AAVS1, PB-1G2R3-puro-H11, and PB-1G 2R 3-puro-COL1A1 were constructed. All four plasmids are circular plasmids.

[0164] Plasmid PB-1G 2R 3-puro-ROSA26 is shown in SEQ ID NO: 3, and the schematic diagram of its structure is shown in Figure 1 In SEQ ID NO: 3, nucleotides 9-339 comprise the porcine genomic region 5' to the ROSA26 safe harbor insertion site (SH1 left arm), and nucleotides 9184-10195 comprise the porcine genomic region 3' to the ROSA26 safe harbor insertion site (SH1 right arm). In SEQ ID NO: 3, nucleotides 346-546, 3132-3531, 6506-6706, and 8975-9175, respectively, comprise four different insulator regions. In SEQ ID NO: 3, nucleotides 637-1209 constitute the EF-1α poly (A) signal, nucleotides 1216-1935 encode the EGFP protein, nucleotides 1954-3131 constitute the EF-1α promoter, nucleotides 3543-4042 constitute the PGK promoter, nucleotides 4059-4769 encode the mCherry protein, nucleotides 4791-5015 constitute the bGH poly (A) signal, nucleotides 5054-6504 are the loxP-puro-loxP expression cassette region, nucleotides 6969-7233 constitute the β-globin poly (A) signal, and nucleotides 7259-8974 constitute the pCAG promoter.

[0165] The only differences between plasmid PB-1G 2R 3-puro-AAVS1 and plasmid PB-1G 2R 3-puro-ROSA26 are that the SH1 left arm is replaced with the porcine genomic region 5' to the AAVS1 safe harbor insertion site (SH2 left arm, SH2 left arm is shown in SEQ ID NO: 4) and the SH1 right arm is replaced with the porcine genomic region 3' to the AAVS1 safe harbor insertion site (SH2 right arm, SH2 right arm is shown in SEQ ID NO: 5).

[0166] The only differences between plasmid PB-1G 2R 3-puro-H11 and plasmid PB-1G 2R 3-puro-ROSA26 are that the SH1 left arm is replaced with the porcine genomic region 5' to the H11 safe harbor insertion site (SH3 left arm, SH3 left arm is shown in SEQ ID NO: 6) and the SH1 right arm is replaced with the porcine genomic region 3' to the H11 safe harbor insertion site (SH3 right arm, SH3 right arm is shown in SEQ ID NO: 7).

[0167] The only difference between plasmid PB-1G 2R 3-puro-COL1A1 and plasmid PB-1G 2R 3-puro-ROSA26 is that the SH1 left arm is replaced with the porcine genomic region 5' to the COL1A1 safe harbor insertion site (SH4 left arm, SH4 left arm is shown in SEQ ID NO: 8) and the SH1 right arm is replaced with the porcine genomic region 3' to the COL1A1 safe harbor insertion site (SH4 right arm, SH4 right arm is shown in SEQ ID NO: 9).

[0168] 2. Screening of efficient cleavage targets at the ROSA26, AAVS1, H11, and COL1A1 genomic safe harbor sites

[0169] Through preliminary screening, the efficient cutting target of ROSA26 safe harbor site is sgRNA ROSA26-g3 (cutting efficiency 38%), the efficient cutting target of AAVS1 safe harbor site is sgRNA AAVS1-g4 (cutting efficiency 30%), the efficient cutting target of H11 safe harbor site is sgRNA H11-g1 (cutting efficiency 60%), the efficient cutting target of COL1A1 safe harbor site is sgRNA COL1A1-g3 (Cutting efficiency 56%).

[0170] The target sequences are as follows:

[0171] sgRNA ROSA26-g3 Target: 5'-GAAGGAGCAAACTGACATGG-3';

[0172] sgRNA AAVS1-g4 Target: 5′-TGCAGTGGGTCTTTGGGGAC-3′;

[0173] sgRNA H11-g1 Target: 5′-TTCCAGGAACATAAGAAAGT-3′;

[0174] sgRNA COL1A1-g3 Target: 5'-GCAGTCTCAGCAACCACTGA-3'.

[0175] 3. Preparation of safe harbor site gRNA recombinant vector

[0176] The plasmid pKG-U6gRNA was taken and digested with the restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).

[0177] ROSA26-g3-S and ROSA26-g3-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (ROSA26-g3). Plasmid pKG-U6gRNA (ROSA26-g3) expresses the sgRNA shown in SEQ ID NO: 10 ROSA26-g3 .

[0178] AAVS1-g4-S and AAVS1-g4-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (AAVS1-g4). Plasmid pKG-U6gRNA (AAVS1-g4) expresses the sgRNA shown in SEQ ID NO: 11 AAVS1-g4 .

[0179] H11-g1-S and H11-g1-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (H11-g1). Plasmid pKG-U6gRNA (H11-g1) expresses the sgRNA shown in SEQ ID NO: 12 H11-g1 .

[0180] COL1A1-g3-S and COL1A1-g3-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain the plasmid pKG-U6gRNA (COL1A1-g3). Plasmid pKG-U6gRNA (COL1A1-g3) expresses the sgRNA shown in SEQ ID NO: 13 COL1A1-g3 .

[0181] ROSA26-g3-S, ROSA26-g3-A, AAVS1-g4-S, AAVS1-g4-A, H11-g1-S, H11-g1-A, COL1A1-g3-S, and COL1A1-g3-A are all single-stranded DNA molecules.

[0182] ROSA26-g3-S:caccGAAGGAGCAAACTGACATGG;

[0183] ROSA26-g3-A:aaacCCATGTCAGTTTGCTCCTTC。

[0184] AAVS1-g4-S:caccgTGCAGTGGGTCTTTGGGGAC;

[0185] AAVS1-g4-A:aaacGTCCCCAAGACCCACTGCAc。

[0186] H11-g1-S:caccgTTCCAGGAACATAAGAAAGT;

[0187] H11-g1-A:aaacACTTTCTTATGTTCCTGGAAc。

[0188] COL1A1-g3-S:caccGCAGTCTCAGCAACCACTGA;

[0189] COL1A1-g3-A:aaacTCAGTGGTTGCTGAGACTGC。

[0190] sgRNA ROSA26-g3 (SEQ ID NO:10):

[0191] GAAGGAGCAAACUGACAUGGguuuuagagcuagaaauagcaaguuaaaaaggcuaguccguuaucaacuugaaaaagu ggcaccgagucggugcuuuu。

[0192] sgRNA AAVS1-g4 (SEQ ID NO:11):

[0193] UGCAGUGGGUCUUUGGGGACguuuuagagcuagaaauagcaaguuaaaaaggcuaguccguuaucaacuugaaaaagu ggcaccgagucggugcuuuu。

[0194] sgRNA H11-g1 (SEQ ID NO:12):

[0195] UUCCAGGAACAUAAGAAAGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0196] sgRNA COL1A1-g3 (SEQ ID NO: 13):

[0197] GCAGUCUCAGCAACCACUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0198] IV. Electroporation of pig primary fibroblasts by mixing fluorescent donor vectors containing homology arms on both sides of different safe harbor insertion sites (i.e., vectors with different safe harbor sites containing the exogenous gene GFP), sgRNA vectors, and Cas9 vectors (i.e., plasmid pKG-GE3) and detecting the GFP fluorescence intensity of the cells

[0199] 1. Co-transfection

[0200] Group 1 (ROSA26 group): Primary porcine fibroblasts were co-transfected with plasmid PB-1G 2R 3-puro-ROSA26, plasmid pKG-U6gRNA (ROSA26-g3), and plasmid pKG-GE3. The ratio was: approximately 200,000 primary porcine fibroblasts: 1.26 μg plasmid PB-1G 2R 3-puro-ROSA26: 0.82 μg plasmid pKG-U6gRNA (ROSA26-g3): 0.92 μg plasmid pKG-GE3; i.e., the molar ratio of the three plasmids was 1:3:1, respectively.

[0201] Group 2 (AAVS1 group): Primary porcine fibroblasts were co-transfected with plasmid PB-1G 2R 3-puro-AAVS1, plasmid pKG-U6gRNA (AAVS1-g4), and plasmid pKG-GE3. The ratio was: approximately 200,000 primary porcine fibroblasts: 1.26 μg plasmid PB-1G 2R 3-puro-AAVS1: 0.82 μg plasmid pKG-U6gRNA (AAVS1-g4): 0.92 μg plasmid pKG-GE3; i.e., the molar ratio of the three plasmids was 1:3:1, respectively.

[0202] Group 3 (H11): Plasmid PB-1G2R3-puro-H11, plasmid pKG-U6gRNA (H11-g1), and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. The ratio was: approximately 200,000 porcine primary fibroblasts: 1.26 μg plasmid PB-1G2R3-puro-H11: 0.82 μg plasmid pKG-U6gRNA (H11-g1): 0.92 μg plasmid pKG-GE3; that is, the molar ratio of the three plasmids was 1:3:1.

[0203] Group 4 (COL1A1 group): Primary porcine fibroblasts were co-transfected with plasmid PB-1G 2R 3-puro-COL1A1, plasmid pKG-U6gRNA (COL1A1-g3), and plasmid pKG-GE3. The ratio was: approximately 200,000 primary porcine fibroblasts: 1.26 μg plasmid PB-1G 2R 3-puro-COL1A1: 0.82 μg plasmid pKG-U6gRNA (COL1A1-g3): 0.92 μg plasmid pKG-GE3; that is, the molar ratio of the three plasmids was 1:3:1.

[0204] Group 5: Primary porcine fibroblasts were electroporated with the same electroporation parameters without adding any plasmids.

[0205] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0206] 2. After completing step 1, culture the cells in complete culture medium for 12-24 hours, then replace with fresh complete culture medium. The total culture time is 48 hours.

[0207] 3. After completing step 2, replace the culture medium with complete culture medium containing 1.5 μg / mL puromycin for 3 weeks (replace the culture medium with new complete culture medium containing 1.5 μg / mL puromycin every 2 days), continuously observe and photograph the GFP green fluorescence, and judge the efficiency of exogenous gene expression at the safe harbor site by the strength of GFP fluorescence expression.

[0208] After one week of puromycin screening, the fluorescence intensity of the ROSA26 and COL1A1 safe harbor site test groups was significantly stronger than that of the AAVS1 and H11 test groups. After two weeks of puromycin screening, the order of fluorescence intensity from strong to weak was: COL1A1>ROSA26>H11>AAVS1, among which the fluorescence intensity of the H11 group was not very uniform, the overall fluorescence intensity of the ROSA26 group was relatively uniform and the fluorescence intensity was higher, the fluorescence expression of cells in the AAVS1 group was the weakest, and the number of fluorescent cells in the COL1A1 group was the largest and the fluorescence was the strongest. After three weeks of continued puromycin screening, the order of fluorescence intensity from strong to weak was: COL1A1>ROSA26>H11>AAVS1, as shown in the photo. Figure 2 .

[0209] 5. Detection of GFP gene transcription level

[0210] In order to compare the differences in mRNA transcription levels after the GFP gene was integrated into four different safe harbor sites, whether it can participate in the expression regulation of GFP and its effect on the expression level. A pair of primers was designed at the exon of the GFP gene, and the cells were selected for three weeks after puromycin in step 4, total RNA was extracted, reverse transcribed into cDNA, and the transcription level of the primary cells after the GFP gene was integrated into the four different safe harbor sites was detected. At the same time, the quantitative results obtained from the fifth group of cells (the control electroporation group without plasmid) were used as a control. GAPDH gene was used as the internal reference gene according to 2 -ΔCt Method to calculate.

[0211] Primers used to detect the GFP gene: F: AGATCCGCCACAACATCGAG; R: GTCCATGCCGAGAGTGATCC.

[0212] Primers used to detect the GAPDH gene: F: GGTCGGAGTGAACGGATTTG; R: CCATTTGATGTTGGCGGGAT.

[0213] SPSS statistical software was used to analyze the data, and the data were expressed as (mean ± standard deviation). Two-way analysis of variance was used for statistical analysis. -ΔCt The results showed that after three weeks of puromycin selection, the GFP expression levels in the AAVS1 and H11 groups were low, while the GFP expression levels in the ROSA26 and COL1A1 groups were high. The GFP transcription levels in the COL1A1 and ROSA26 groups were significantly different from those in the AAVS1 and H11 groups (P<0.01). -ΔCt The values ​​are shown in Table 1, and the results of the significant difference analysis are shown in Figure 3 .

[0214] Table 1 2 -ΔCt Value Information

[0215]

[0216] In summary, based on the fluorescence signal intensity after three weeks of cell culture and the results of real-time fluorescence quantitative PCR of the GFP gene, it can be concluded that among the four genomic safe harbor sites, ROSA26, AAVS1, H11, and COL1A1, the COL1A1 site has the best expression effect after insertion of exogenous genes.

[0217] 6. FACS detection of GFP gene protein expression level

[0218] To compare the expression of GFP protein after the GFP gene was integrated into four different safe harbor sites, the electroporated cells were digested with trypsin after three weeks of puromycin selection in step 4, centrifuged at 400g for 4 minutes, and the supernatant was discarded. The cells were resuspended in 1mL of complete culture medium and the cell suspension was transferred to flow cytometry tubes. The GFP signal was detected in the FITC channel of the BD FACSMelody flow cytometer, and 5×10 4 The results are shown in Figure 4 .

[0219] The results showed that the GFP fluorescence signal intensity was COL1A1>ROSA26>H11>AAVS1.

[0220] Therefore, based on the above results, the COL1A1 locus is the safe harbor locus for the most efficient expression of exogenous genes in pig primary cells among the four safe harbor loci ROSA26, AAVS1, H11, and COL1A1.

[0221] Example 2: Preparation of single cell clones with hACE2-hAXL-hTMPRSS2 site-specific insertion into the porcine COL1A1 safe harbor site

[0222] Human ACE2 gene (hACE2 gene) information: Encodes angiotensin-converting enzyme 2 [Homo sapiens]; located on human chromosome X; Gene ID 59272. Angiotensin-converting enzyme 2 [Homo sapiens], also known as hACE2 protein, is the recognized receptor protein for coronaviruses such as SARS-CoV-2 and SARS-CoV, as shown in SEQ ID NO: 15 (NP_001358344.1).

[0223] Human AXL gene (hAXL gene) information: Encodes AXL receptor tyrosine kinase [Homo sapiens]; located on human chromosome 19; Gene ID 558. AXL receptor tyrosine kinase [Homo sapiens], also known as hAXL protein, is a recently discovered protein that independently mediates SARS-CoV-2 infection, independent of hACE2 protein, as shown in SEQ ID NO: 16 (NP_001265528.1).

[0224] Human TMPRSS2 gene (hTMPRSS2 gene) information: Encodes transmembrane protease serine 2 [Homo sapiens]; located on human chromosome 21; Gene ID 7113. Transmembrane protease serine 2 [Homo sapiens], also known as hTMPRSS2 protein, can mediate the binding of SARS-CoV-2 to host cell receptors by activating the SARS-CoV-2 spike (S) protein, thereby promoting SARS-CoV-2 entry into host cells, as shown in SEQ ID NO: 17 (NP_001128571.1).

[0225] 1. Construction of pKG-hACE2-hAXL-hTMPRSS2 Donor vector

[0226] The pKG-hACE2-hAXL-hTMPRSS2 Donor vector is the plasmid pKG-hACE2-hAXL-hTMPRSS2.

[0227] Plasmid pKG-hACE2-hAXL-hTMPRSS2 is shown in SEQ ID NO: 14, which is a circular plasmid. The schematic diagram of its structure is shown in Figure 5In SEQ ID NO: 14, nucleotides 9-880 are the 5' end pig genomic region of the COL1A1 safe harbor insertion site (SH4 left arm), and nucleotides 887-1087 are the insulator 1 ( 1), nucleotides 1094-2271 are human hEF1α promoter, nucleotides 2290-4704 are hACE2 gene, nucleotides 4705-4770 encode P2A peptide, nucleotides 4771-6648 are hAXL gene, nucleotides 6649-6711 encode T2A peptide, nucleotides 6712-8298 are hTMPRSS2 gene, nucleotides 8302-8874 are EF1α Poly (A), nucleotides 8911-8944 are LoxP sequence, nucleotides 8987-9316 are SV40 promoter, and nucleotides 9365-9961 encode Puromycin protein (abbreviated as Puromycin). R protein), nucleotides 10141-10262 are SV40 Poly(A), nucleotides 10307-10340 are LoxP sequences, nucleotides 10349-10549 are insulator 3, and nucleotides 10550-11276 are the 3' end of the COL1A1 safe harbor insertion site (SH4 right arm).

[0228] 2. Co-transfection

[0229] Co-transfect porcine primary fibroblasts with the plasmids pKG-hACE2-hAXL-hTMPRSS2, pKG-U6gRNA (COL1A1-g3), and pKG-GE3. The ratio was: approximately 200,000 porcine primary fibroblasts: 1.3 μg of pKG-hACE2-hAXL-hTMPRSS2: 0.8 μg of pKG-U6gRNA (COL1A1-g3): 0.9 μg of pKG-GE3; i.e., the molar ratio of the three plasmids was 1:3:1.

[0230] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0231] Plasmids pKG-GE3 and pKG-U6gRNA (COL1A1-g3) function to create double-strand breaks in porcine genomic DNA to increase the rate of homologous recombination. Plasmid pKG-hACE2-hAXL-hTMPRSS2 undergoes homologous recombination with porcine genomic DNA, inserting the exogenous target gene fragment (the exogenous target gene fragment is the DNA molecule represented by nucleotides 881-10549 in SEQ ID NO: 14) between the left and right arms of SH4 in the porcine genomic DNA.

[0232] 3. Puromycin pressure screening

[0233] 1. Puromycin screening of positive cells with hACE2-hAXL-hTMPRSS2 gene insertion

[0234] (1) After completing step 2, culture the electroporated cells in complete culture medium for 16-18 hours, then replace with fresh complete culture medium for 48 hours.

[0235] (2) After completing step (1), the culture medium was replaced with a complete culture medium containing 1.5 μg / mL puromycin for screening culture (new complete culture medium containing 1.5 μg / mL puromycin was replaced every day), and the screening culture time was 3 weeks.

[0236] After one week of screening culture, a large number of cells died.

[0237] After 2 weeks of screening culture, only sporadic cell death occurred, and some positive clones began to divide and proliferate, and the number of cells continued to increase.

[0238] The purpose of screening culture in the third week is to completely degrade the intracellular plasmid and exclude false positive cell clones.

[0239] (3) After completing step (2), the cells were collected and cultured for 2 generations (1 generation every 2 days) using complete culture medium without puromycin to allow the cells to recover to a good state for single cell sorting in the next step.

[0240] 2. Single cell sorting and amplification culture

[0241] (1) After completing step 1, collect the cells, digest them with trypsin, and then neutralize them with complete culture medium. Then centrifuge at 500g for 5 minutes, discard the supernatant, resuspend the precipitate with 1mL of complete culture medium and dilute it appropriately. Use a mouth pipette to pick up single cells and transfer them to a 96-well plate (100μl of complete culture medium was pre-added to each well) (one 96-well plate for each group of cells, one cell per well), and culture them. After culturing for 2 days, replace the culture medium with 1.5μg / mL puromycin. After that, replace the culture medium with new 1.5μg / mL puromycin every 2 to 3 days. During this period, observe the cell growth in each well under a microscope and exclude wells with no cells or non-single cell clones.

[0242] (2) After the cells in the wells of the 96-well plate in step (1) have grown to the bottom of the wells (about 2 weeks), use trypsin to digest and collect the cells, of which 2 / 3 of the cells are inoculated into a 6-well plate containing complete culture medium, and the remaining 1 / 3 of the cells are collected in a 1.5 mL centrifuge tube.

[0243] (3) When the cells in the wells of the 6-well plate in step (2) grow to 50% confluence, use 0.25% (Gibco) trypsin to digest and collect the cells, and use cell freezing solution (90% complete culture medium + 10% DMSO, volume ratio) to freeze the cells.

[0244] IV. Genomic identification of the porcine COL1A1 safe harbor site with targeted insertion of hACE2-hAXL-hTMPRSS2

[0245] To detect whether the porcine COL1A1 safe harbor site was successfully inserted into hACE2-hAXL-hTMPRSS2, the centrifuge tube in step 3 (2) was taken to extract genomic DNA from the cells. PCR amplification was performed using specific primer pairs (the specific primer pairs were: primer pairs consisting of sh4-Lr-JDF1414 and sh4-Lr-JDR5965, primer pairs consisting of sh4-Rr-JDF282 and sh4-Rr-JDR4723, and primer pairs consisting of sh4-wt-JDF1085 and sh4-wt-JDR1560), followed by electrophoresis. Porcine primary fibroblasts were used as wild-type controls (WT).

[0246] The primer pair consisting of sh4-Lr-JDF1414 and sh4-Lr-JDR5965 was used to identify successful hACE2-hAXL-hTMPRSS2 recombination at the 5' end of the porcine COL1A1 safe harbor insertion site (the target sequence is 4552 bp, and obtaining an amplification product of approximately 4552 bp indicates successful recombination). The primer pair consisting of sh4-Rr-JDF282 and sh4-Rr-JDR4723 was used to identify successful hACE2-hAXL-hTMPRSS2 recombination at the 3' end of the porcine COL1A1 safe harbor insertion site (the target sequence is 4442 bp, and obtaining an amplification product of approximately 4442 bp indicates successful recombination). The primer pair consisting of sh4-wt-JDF1085 and sh4-wt-JDR1560 is used to identify whether the hACE2-hAXL-hTMPRSS2 expression cassette inserted into the porcine COL1A1 safe harbor site is homozygous or heterozygous (a 476 bp fragment can be amplified from genomic DNA of the wild-type control, but amplification cannot be achieved in recombinant cells because the exogenous insert is too large; therefore, if no amplification product is displayed, it indicates that the cell is homozygous for the hACE2-hAXL-hTMPRSS2 insertion; if a 476 bp amplification product is displayed, it indicates that the cell is heterozygous for the hACE2-hAXL-hTMPRSS2 insertion or is wild-type).

[0247] sh4-Lr-JDF1414: CCTGCTGTAAGTGCCGTAGT;

[0248] sh4-Lr-JDR5965: CTAGGGGCACAGCACGTC;

[0249] sh4-Rr-JDF282:AAGTTATTAGGTCTGAAGAGGAGTTT;

[0250] sh4-Rr-JDR4723: CCCATCATTCCGTCCCAGAG;

[0251] sh4-wt-JDF1085: TGCTGAGTTCTGGCTTCCTG;

[0252] sh4-wt-JDR1560:TCTACCAGAGAGTGACCAGCAG.

[0253] According to the identification results, single-cell clones numbered 1-20 all successfully inserted hACE2-hAXL-hTMPRSS2 into the porcine COL1A1 safe harbor site. Single-cell clones 10 and 15 were homozygous for site-directed insertion, while the other single-cell clones were heterozygous for site-directed insertion. See Table 2.

[0254] Table 2 Genotypes of single-cell clones of hACE2-hAXL-hTMPRSS2 inserted into the porcine COL1A1 safe harbor site

[0255]

[0256]

[0257] The recombinant cell numbered hACE2-hAXL-hTMPRSS2-1 (heterozygous site-directed insertion type) in Table 2 was named 1# recombinant cell.

[0258] The recombinant cell numbered hACE2-hAXL-hTMPRSS2-10 (homozygous site-specific insertion) in Table 2 was designated recombinant cell #10. Whole-genome sequencing revealed that the genomic DNA of recombinant cell #10 differed only from that of primary porcine fibroblasts from the same source in that the DNA molecule represented by nucleotides 881-10549 of SEQ ID NO: 14 was inserted between the left and right arms of SH4 in the porcine genomic DNA.

[0259] 5. Detection of hACE2, hAXL, and hTMPRSS2 gene transcription levels in single-cell clones

[0260] Test cells: 1# recombinant cells and 10# recombinant cells.

[0261] The test cells were taken, total RNA was extracted, and cDNA was obtained by reverse transcription. The cDNA was used as a template to detect the relative expression levels of hACE2 gene, hAXL gene and hTMPRSS2 gene by fluorescence quantitative PCR (using β-actin as the internal reference gene according to 2 -ΔCt Primary porcine fibroblasts were used as a control (WT).

[0262] The primers for fluorescent quantitative PCR are as follows:

[0263] hACE2-F:CTAACCAGCCCCTTGTTTCC;

[0264] hACE2-R: GGAGGCATAAGGATTTTCTCCAC;

[0265] hAXL-F: TCAACTCCTGCCTTCTCGTG;

[0266] hAXL-R:ACCTCTTTCCACTGTTGGTTCA;

[0267] hTMPRSS2-F: TGGAAGTTCATGGGCAGCAA;

[0268] hTMPRSS2-R:GTAGAGGCGAACACACCGAT;

[0269] β-actin-F: CACGCCATCCTGCGTCTGGA;

[0270] β-actin-R:AGCACCGTGTTGGCGTAGAG.

[0271] SPSS statistical software was used to analyze the data, and the data were expressed as (mean ± standard deviation) and analyzed using independent sample T test. Figure 6 .2 -ΔCt The results showed that the expression levels of hACE2, hAXL and hTMPRSS2 genes in the test cells were significantly higher than those in the control, and the expression levels of single cell clones with homozygous site-directed insertion were higher than those with heterozygous site-directed insertion. The results showed that the hACE2, hAXL and hTMPRSS2 genes were all expressed at a high level in the test cells.

[0272] VI. FACS analysis of protein expression levels of hACE2, hAXL, and hTMPRSS2 in single-cell clones

[0273] Recombinant cells #10 (using porcine primary fibroblasts as a control, WT) were washed thoroughly with PBS buffer, then resuspended in -20°C pre-chilled 90% methanol and fixed for 20 min. After fixation, the cells were centrifuged and the fixative was discarded. 3% BSA was added for blocking for 1 h. After blocking, the cells were centrifuged, the blocking solution was discarded, and the cells were washed with complete medium. After washing, the cells were resuspended with human-specific ACE2 antibodies (Novus Biologicals, NBP2-80038) (1:100 dilution), hAXL antibodies (Santa Cruz Biotechnology, sc-166269) (1:50 dilution), and hTMPRSS2 antibodies (Santa Cruz Biotechnology, sc-515727) (1:50 dilution), respectively, and incubated at room temperature for 1 h. After the antibody incubation, the cells were washed thoroughly with complete medium, resuspended in 500 μL of complete medium, and the cell suspension was transferred to a flow cytometer. The fluorescence signals of hACE2, hAXL and hTMPRSS2 antibodies were detected in the relevant channels of BD FACSMelody flow cytometer, and 5×10 4 cells were analyzed.

[0274] See the results Figure 7The results showed that antibody fluorescence signals of hACE2, hAXL and hTMPRSS2 were detected in 10# recombinant cells, while no antibody fluorescence signals of hACE2, hAXL and hTMPRSS2 were detected in the control WT cells, indicating that the inserted hACE2 gene, hAXL gene and hTMPRSS2 gene were significantly expressed in porcine fibroblasts.

[0275] Example 3: Cloning and production of model pigs and expression analysis of the inserted target gene in the model pigs

[0276] 1. Cloning and producing model pigs using somatic cell nuclear transfer technology

[0277] 1. Oocyte maturation in vitro

[0278] Fresh isolated porcine ovaries (ovaries from Duroc-Changda hybrid sows) were collected from the slaughterhouse, preserved in 0.9% sodium chloride solution containing 75 mg / mL penicillin and 50 mg / mL streptomycin, and transported to the laboratory at 25-30°C.

[0279] Ovaries were harvested and cumulus-oocyte complexes (COCs) were extracted from follicles 3 to 6 mm in diameter. COCs with at least three layers of dense cumulus cells were selected and seeded into 4-well plates. Fifty COCs were seeded per well in 400 μL of porcine oocyte in vitro maturation medium and covered with 400 μL of mineral oil (Sigma, M8410). 300–400 COCs were cultured per transplant. The plates containing the COCs were incubated in a 38.5°C, 5% CO2, and saturated humidity incubator for 42–44 hours.

[0280] Porcine oocyte in vitro maturation medium (IVM medium): contains 0.1 mg / mL pyruvate, 0.1 mg / mL cysteine ​​hydrochloride, 10 ng / mL epidermal growth factor, 10% (v / v) porcine follicular fluid, 75 mg / mL penicillin, 50 mg / mL streptomycin, 10 IU / mL eCG and 10 IU / mL hCG, with the balance being TCM-199 medium.

[0281] 2. Somatic Cell Nuclear Transfer and Embryo Transfer

[0282] (1) Somatic cell nuclear transfer (SCNT)

[0283] The nuclear donor cells were the 10# recombinant cells obtained in Example 2.

[0284] After completing step 1, the expanded cumulus cells of the COCs were removed by repeated pipetting with 0.1% (w / v) hyaluronidase. Oocytes with intact membranes and extruded first polar bodies were cultured in NCSU23 medium containing 0.1 mg / mL demeclocycline, 0.05 M sucrose, and 4 mg / mL bovine serum albumin for 0.5-1 h to induce oocyte nuclear protrusion. The protruding nuclei and polar bodies were then removed using a microinjection needle with a beveled tip (approximately 20 μm diameter) in Tyrode's lactate medium containing 10 μM HEPES, 0.3% (w / v) polyvinylpyrrolidone, 10% FBS, 0.1 mg / mL demeclocycline, and 5 mg / mL cytochalasin B. A single nuclear donor cell was injected into the perivitelline space of an enucleated oocyte. The donor cell and recipient oocyte were fused for 20 μs using an embryonic cell fusion instrument (ET3, Fujihira Industry) in fusion medium using a 200 V / mm direct current pulse. The reconstructed embryos were then cultured in PZM-3 medium (formula see Table 3) for 2 h to allow nuclear reprogramming and then activated with a single pulse of 150 V / mm for 100 μs in activation medium. The activated reconstructed embryos were then placed in PZM-3 medium supplemented with 5 μg / mL cytochalasin B for 2 h in an incubator at 38.5°C, 5% CO₂, 5% O₂, 90% N₂, and saturated humidity for further activation. The reconstructed embryos were then placed in PZM-3 medium in an incubator at 38.5°C, 5% CO₂, 5% O₂, 90% N₂, and saturated humidity. Most reconstructed embryos were ready for subsequent embryo transfer within 6 h of activation.

[0285] Fusion medium: contains 0.25M D-sorbitol, 0.05mM Mg(C2H3O2)2, 20mg / mL BSA and 0.5mM HEPES [acid-free], with the balance being water.

[0286] Activation medium: contains 0.25M D-sorbitol, 0.01mM Ca(C2H3O2)2, 0.05mM Mg(C2H3O2)2 and 0.1mg / mL BSA, with the balance being water.

[0287] Table 3 Formulation of PZM-3 medium

[0288] Element g / 50mL 1 NaCl 0.3156g 2 KCl 0.0373g 3 <![CDATA[KH2PO4]]> 0.0024g 4 <![CDATA[MgSO4·7H2O]]> 0.0024g 5 <![CDATA[NaHCO3]]> 0.1055g 6 Na-pyruvate 0.0011g 7 <![CDATA[Ca-(lactate)2·5H2O]]> 0.0308g 8 Myo-Inositol 0.0250 9 Phenol Red (stock solution 10 mg / mL) 0.5mL stock solution 10 L-glutamine* 0.0073g 11 hypotaurine* 0.0273g 12 BME essential amino acid(50×)* 1mL 13 MEM non-essential amino acid(100×)* 0.5mL 14 Ultrapure water Make up to 50mL

[0289] *Add before use

[0290] (2) Embryo transfer

[0291] Four nine-month-old Erhua-faced sows in estrus were selected as surrogate sows for the reconstructed embryos. The reconstructed embryos, activated and cultured for six hours, were transplanted into the oviducts of the surrogate sows, with 300-350 reconstructed embryos transplanted into each sow. Approximately 23 days after embryo transfer, an ultrasound scanner (HS-101V, Honda Electronics, Japan) was used to check for pregnancy in the recipient sows. Of the four surrogate sows, two became pregnant.

[0292] The cloned pigs were born around 116-117 days after embryo transfer. Two successfully pregnant sows gave birth to a total of five cloned pigs. The cloned pigs are model pigs (see photos). Figure 8 ).

[0293] 3. Preparation of wild-type control pigs

[0294] In step 2, primary porcine fibroblasts from the same source were used as nuclear donors instead of recombinant cells. This resulted in four cloned pigs, designated wild-type control pigs. The wild-type control pigs' genetic background was identical to that of the model pigs, except for the absence of exogenous inserted DNA.

[0295] 2. Analysis of exogenous gene expression in humanized pig models

[0296] 1. Isolation of alveolar macrophages from pig lungs

[0297] (1) The complete trachea and lungs of the model pig (or wild-type control pig) were separated and thoroughly washed with PBS buffer containing 0.3% streptomycin / penicillin, and then washed with PBS buffer; then 50 mL of sterile PBS buffer was poured into the trachea, and the lungs were gently tapped and the liquid was poured out; then 50 mL of sterile PBS buffer was poured into the trachea, and the lungs were gently tapped and the liquid was poured out; then 50 mL of sterile PBS buffer was poured into the trachea, and the lungs were gently tapped and the liquid was poured out; the liquids obtained three times were combined, centrifuged at 1500 g for 4 minutes, the supernatant was discarded, and the precipitate was collected.

[0298] (2) Add 10 mL of red blood cell lysis buffer to resuspend the cell pellet obtained in step (1), let it stand for 4 minutes, then add 20 mL of PBS buffer, centrifuge at 1500 g for 10 minutes, discard the supernatant, and the pellet is the alveolar macrophages.

[0299] 2. Detection of hACE2, hAXL, and hTMPRSS2 gene transcription levels in humanized pigs

[0300] The primers and method are the same as step 5 in Example 2.

[0301] See the results Figure 9In the alveolar macrophages of the model pig (hACE2-hAXL-hTMPRSS2-pig), the expression level of the hACE2 gene was 0.11 times that of the housekeeping gene β-actin, the expression level of the hAXL gene was 0.06 times that of the housekeeping gene β-actin, and the expression level of the hTMPRSS2 gene was 0.04 times that of the housekeeping gene β-actin, all of which were significantly higher than the expression levels of the corresponding genes in the alveolar macrophages of the wild-type control pig (WT-pig).

[0302] In summary, hACE2 gene, hAXL gene and hTMRSS2 gene are strongly expressed in alveolar macrophages of model pigs.

[0303] 3. FACS detection of hACE2, hAXL, and hTMPRSS2 protein expression levels in humanized pigs

[0304] The method is the same as step 6 of Example 2.

[0305] See the results Figure 10 The results showed that antibody fluorescence signals for hACE2, hAXL, and hTMPRSS2 were detected in the alveolar macrophages of the model pigs, while no antibody fluorescence signals for the corresponding genes were detected in the alveolar macrophages of the wild-type control pigs. This indicates that the inserted hACE2, hAXL, and hTMPRSS2 genes were successfully expressed in the alveolar macrophages of the model pigs.

[0306] Example 4: Study on the infectivity of alveolar macrophages of model pigs to SARS-CoV-2 pseudovirus

[0307] Pseudoviruses lack the ability to replicate, minimizing the risks associated with SARS virus research. Furthermore, because the infection process of the pseudovirus is identical to that of the real virus, it can simulate the early stages of viral infection. Furthermore, the pseudoviruses carry a reporter gene, facilitating various assays and analyses.

[0308] 1. Preparation of SARS-CoV-2-Spike pseudovirus

[0309] 1. Construction of recombinant plasmid

[0310] The schematic diagram of the structure of plasmid pMD2.G-SARS-C19 is shown in Figure 11The initial plasmid is the commercial pMD2.G plasmid; the transformation process is as follows: the VSV-G region of the pMD2.G plasmid is deleted, and the spike protein of the SARS-CoV-2 virus (Spike, a membrane protein of SARS-CoV-2) is subjected to a 19-amino acid deletion mutation at the intracellular C-terminus, and then inserted into the pMD2.G vector from which the VSV-G region has been deleted. The plasmid pMD2.G-SARS-C19 is a circular plasmid as shown in SEQ ID NO: 22. In SEQ ID NO: 22, nucleotides 161-540 are the CMV enhancer, nucleotides 541-744 are the CMV promoter, nucleotides 878-1353 are the β-globin intron, nucleotides 1415-5188 are the coding sequence of the SARS-CoV-2 spike protein (Spike), and nucleotides 5264-5648 are the β-globin poly (A) signal.

[0311] See the schematic diagram of the structure of the plasmid Lenti-mCherry. Figure 12 The initial plasmid was the commercially available Lenti-CRISPRV2. The modification process involved removing the gRNA backbone and the region encoding the Cas9 protein from the plasmid and inserting the reporter gene (mCherry) into the corresponding region, while retaining the puromycin resistance gene carried by the original plasmid. This ensures that the genome of the pseudovirus constructed using this plasmid in combination with the supporting plasmid contains both an mCherry fluorescent tag and a puromycin resistance tag. The plasmid Lenti-mCherry is a circular plasmid, as shown in SEQ ID NO: 23. In SEQ ID NO: 23, nucleotides 2602-2813 are the EF1a core promoter element, nucleotides 2844-3551 encode the mCherry fluorescent protein, nucleotides 3567-3623 encode the P2A peptide (the amino acid sequence of the P2A peptide is "ATNFSLLKQAGDVEENPGP", and the cleavage position is between the first and second amino acid residues from the C-terminus), and nucleotides 3624-4220 encode the Puromycin resistance protein (abbreviated as Puromycin). R protein), nucleotides 5161-5385 are bGH poly (A) signal.

[0312] 2. Preparation of SARS-CoV-2-Spike pseudovirus

[0313] psPAX2 lentiviral packaging plasmid: Addgene, #12260.

[0314] (1) The plasmid pMD2.G-SARS-C19, plasmid Lenti-mCherry and psPAX2 lentiviral packaging plasmid were mixed at a ratio of 6 μg: 4 μg: 5 μg, and the water was removed using a vacuum concentrator.

[0315] (2) After completing step (1), add 750 μL Opti- Medium, blend gently.

[0316] (3) After completing step (2), add 24 μL Lipo8000 TM (Biyuntian, ST483) transfection reagent and mix gently.

[0317] (4) HEK293T cells were seeded into a cell culture dish with a diameter of 10 cm and cultured to a cell density of 70%-80%.

[0318] (5) The mixture obtained in step (3) was added dropwise to the cell culture dish obtained in step (4) and cultured for 6 hours, and then replaced with new complete culture medium for further culture. The total culture time was 48 hours.

[0319] (6) After completing step (5), collect the supernatant, filter with a 0.45 μm filter membrane, and collect the filtrate.

[0320] (7) Take 10 mL of the filtrate obtained in step (6), add 3.3 ml of Lenti-X Concentrator (Clontech, 631231), mix gently, and let it stand at 4°C overnight.

[0321] (8) After completing step (7), centrifuge at 1500 g for 45 minutes at 4°C, discard the supernatant, and add 100 μL of DMEM medium to dissolve the precipitate, which is the concentrated SARS-CoV-2 pseudovirus solution, referred to as the concentrated virus stock solution.

[0322] 2. Pseudovirus infection of porcine alveolar macrophages

[0323] Test cells: alveolar macrophages of model pigs (prepared in Example 3) or alveolar macrophages of wild-type control pigs (prepared in Example 3).

[0324] (1) 24 hours before infection, the test cells were inoculated into 96-well plates (3×10 4 cells / well).

[0325] (2) Add 500 μl of concentrated virus stock solution to the cells in the 96-well plate and add 0.8 μl of polybrene reagent.

[0326] (3) After 6 hours of infection, the culture medium was replaced with new complete culture medium for cultivation.

[0327] (4) 48 hours after infection, the mCherry fluorescence signal of the cells was observed under an inverted fluorescence microscope.

[0328] The results showed that the viral mCherry fluorescence signal integrated into the cell genome was observed in the alveolar macrophages of the model pigs ( Figure 13 ), indicating that SARS-CoV-2 pseudovirus can infect alveolar macrophages of model pigs, while no fluorescent signal was observed in alveolar macrophages of wild-type control pigs ( Figure 14 The results showed that the alveolar macrophages of the model pigs have the ability to be infected with SARS-Cov-2 pseudovirus, and the model pigs can be used as an animal model for SARS-Cov-2 virus infection.

[0329] Furthermore, the model pig (hACE2-hAXL-hTMPRSS2 humanized pig) prepared by the present invention can be used for the next step of drug screening, drug efficacy evaluation, vaccine and antibody effect testing, viral infection mechanism and other related research in the biomedical field.

[0330] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims. Sequence Listing <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Construction and application of SARS-CoV-2 susceptible model pigs expressing three human genes <130> GNCYX220181 <160> twenty three <170> SIPOSequenceListing 1.0 <210> 1 <211> 10476 <212> DNA <213> Artificial Sequence <400> 1 gaggggcctat ttcccatgat tccttcatat tgcatatac gatacaggc tgttagagag 60 aatattggaa ttaatttgac tgtaacaca agatattag tacaaatac gtgacgtaga 120 aagtaataat ttctgggta gtttgcagtt ttaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatctt gtggaagga 240 cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaataag 300 gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgctttttc tagcgcgtgc 360 gccaattctg cagacaatg gctctagagg taccgttac atacttacg gtaaatggcc 420 cgcctggctg acccccac gaccccgcc cattgacgtc atagtaacg ccaataggga 480 ctttccattg acgtcaatgg gtggagtatt tacggtaac tgcccacttg gcagtacatc 540 aagtgtatca tatgccaagt acggcccccta tgacgtca tgacggtaa tggcccgcct 600 ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660 tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720 ggggaggggt cggcaattga tccggtgcct agaaaggtg gcgcggggta aactgggaaa 780 gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840 footgtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900 cggtgccacc atggactata aggaccacga cggagactac aggatcatg atattgatta 960 caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020 gaaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080 cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140 cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200 cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agaaccgc 1260 cagaaaga tacaccagac ggagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320 cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380 agggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440 ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500 ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560 cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620 ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680 caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740 gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800 gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860 ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920 cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980 gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040 ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100 agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160 ccaggaaag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220 actgctcgtg aagctgaaca gagaggacct gctgggaag cagcggacct tcgacaacgg 2280 cagcatcccc caccagatcc acctgggaga gctccacgcc attctgcggc ggcaggaga 2340 tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400 cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460 gagcgaggaa accatcacccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520 ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580 gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640 atacgtgacc gaggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700 cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760 cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820 cgcctccctg ggcacatacc acgatctgct gaaaattatc areacaagg acttcctgga 2880 2940 cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000 gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060 cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120 cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180 ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240 cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300 gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360 gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420 caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480 cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540 ggacatcaac cggctgtccg actacgatgt ggacatatc gtgcctcaga gctttctgaa 3600 ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660 caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720 cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780 gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840 aaagcacgtg gcacagatcc tggactccg gatgaacact aagtacgacg agaatgacaa 3900 gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960 ggattccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020 cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080 cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140 aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200 cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260 aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320 catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380 gtctatcctg cccaagagga acagcgataa gctgatcgcc agaagaagg actgggaccc 4440 tagaaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500 agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gaggctgctgg ggatcaccat 4560 catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620 agaagtgaaa agaagcctga tcatcaagct gcctaagtac tccctgttcg agctgggaaaa 4680 cggccggaag agaatgctgg cctctgccgg cgaactgcag aaggggaaacg aactggccct 4740 gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800 ccccgaggat aatgagcaga aacagctggtt tgtggagacag caaagcact acctggacga 4860 gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920 caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980 tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040 caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100 ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160 caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220 gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280 aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340 gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400 cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460 cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520 cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580 cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640 cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700 cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760 caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820 gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880 gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940 ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000 cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060 caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120 gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180 cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240 ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300 ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360 ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420 gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480 ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540 ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600 ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660 cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720 caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780 tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840 tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900 gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960 tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020 tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080 gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140 cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200 caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260 tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320 agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380 ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620 cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680 cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740 aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800 ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860 gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920 atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980 cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040 ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100 taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160 aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220 ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280 tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340 ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400 ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460 cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580 caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640 tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700 ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760 gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820 cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940 tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000 cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480 ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960 taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380 tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440 ggttcctggc cttttgctgg ccttttgctc acatgt 10476 <210> 2 <211> 3120 <212> DNA <213> Artificial Sequence <400> 2 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaagaagagt atgagtattc aacatttccg tgtcgccctt attcccttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgctttttttg caacacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 780 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga obedientctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280 ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340 tgttagagag ataattggaa ttaatttgac tgtaaacaca aagattag tacaaaatac 2400 gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460 ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520 gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580 ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640 tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700 ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760 accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820 atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880 ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940 gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000 cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060 tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120 <210> 3 <211> 14138 <212> DNA <213> Artificial Sequence <400> 3 ggcgcgccct ctacctgctc tcggacccgt gggggtgggg ggtggaggaa ggagtggggg 60 gtcggtcctg ctggcttgtg ggtgggaggc gcatgttctc caaaaacccg cgcgagctgc 120 aatcctgagg gagctgcagt ggaggaggcg gagagaaggc cgcacccttc tccgcagggg 180 gaggggagtg ccgcaatacc tttatgggag ttctctgctg cctccttttc ctaaggaccg 240 ccctgggcct agaaaaatcc ctccctcccc cgcgatctcg tcatcgcctc catgtcagtt 300 tgctccttct cgattatggg cgggattctt ttgccctggc gcgccccaga cccgggcctg 360 gggggcaagt cggggggcgg ggggaggtcg ggcagggtcc cctgggagga tggggacgtg 420 ctgtgcccct agcggccacc agagggcacc aggacaccac tgcggtcggc tcagcggctc 480 ctgccctggt cagggggcgc caggtcctgc ccctcctggg gagggcgggg ggcgagaagg 540 gcgattttaa ttaacccacg tttcaacatg cacatcccag taatttggaa acattttgtt 600 tccaaagatt cacttaacat tggtttagca acatgaagct ttctatgcaa cccaaggact 660 cagtttttgg cctgttttag tgacaggcaa tcagcaacat gctgcatttc tctccagtgt 720 tgtaatcaaa gaaaccctcc catagcttta aatgatattc cttccccttc caattatgtg 780 gggggaaaac aaccctattc tccacccaga agtgttaact caagaattac attttcaaga 840 agtttccaga ttcgtaaaac cagaattaga tgtctttcac ctaaatgtct cggtgttgac 900 caaaggaaca cacaggtttc tcatttaact tttttaatgg gtctcaaaat tctgtgacaa 960 atttttggtc aagttgtttc cattaaaaag tactgatttt aaaaactaat aacttaaaac 1020 tgccacacgc aaaaaagaaa accaaagtgg tccacaaaac attctccttt ccttctgaag 1080 gttttacgat gcattgttat cattaaccag tcttttacta ctaaacttaa atggccaatt 1140 gaaacaaaca gttctgagac cgttcttcca ccactgatta agagtggggt ggcaggtatt 1200 agggataatg ctagcttact tgtacagctc gtccatgccg agagtgatcc cggcggcggt 1260 cacgaactcc agcaggacca tgtgatcgcg cttctcgttg gggtctttgc tcagggcgga 1320 ctgggtgctc aggtagtggt tgtcgggcag cagcacgggg ccgtcgccga tggggtgtt 1380 ctgctggtag tggtcggcga gctccacgct gccgtcctcg atgttgtggc ggatcttgaa 1440 gttcaccttg atgccgttct tctgcttgtc ggccatgata tagacgttgt ggctgttgta 1500 gttgtactcc agcttgtgcc ccaggatgtt gccgtcctcc ttgaagtcga tgcccttcag 1560 ctcgatgcgg ttcaccaggg tgtcgccctc gaacttcacc tcggcgcggg tcttgtagtt 1620 gccgtcgtcc ttgaaga tggtgcgctc ctggacgtag ccttcgggca tggcggactt 1680 gaagagtcg tgctgcttca tgtggtcggg gtagcggctg aagcactgca cgccgtaggt 1740 cagggtggtc acgagggtgg gccagggcac gggcagcttg ccggtggtgc agatgaactt 1800 cagggtcagc ttgccgtagg tggcatcgcc ctcgccctcg ccggacacgc tgaacttgtg 1860 gccgtttacg tcgccgtcca gctcgaccag gatgggcacc accccggtga acagctcctc 1920 gcccttgctc accatggtgg cgtcgaccgt acgtcacgac acctgaaatg gaaaaaa 1980 actttgaacc actgtctgag gcttgagaat gaaccaagat ccaaactcaa aaagggcaaa 2040 ttccaaggag aattacatca agtgccaagc tggcctaact tcagtctcca cccactcagt 2100 gtggggaaac tccatcgcat aaaacccctc cccccaacct aaagacgacg tactccaaaa 2160 gctcgagaac taatcgaggt gcctggacgg cgcccggtac tccgtggagt cacatgaagc 2220 gacggctgag gacggaaagg cccttttcct ttgtgtgggt gactcacccg cccgctctcc 2280 cgagcgccgc gtcctccatt ttgagctccc tgcagcaggg ccgggaagcg gccatctttc 2340 cgctcacgca actggtgccg accgggccag ccttgccgcc cagggcgggg cgatacacgg 2400 cggcgcgagg ccaggcacca gagcaggccg gccagcttga gactaccccc gtccgattct 2460 cggtggccgc gctcgcaggc cccgcctcgc cgaacatgtg cgctgggacg cacgggcccc 2520 gtcgccgccc gcggccccaa aaaccgaaat accagtgtgc agatcttggc ccgcatttac 2580 aagactatct tgccagaaaa aaagcgtcgc agcaggtcat caaaaatttt aaatggctag 2640 agacttatcg aaagcagcga gacaggcgcg aaggtgccac cagattcgca cgcggcggcc 2700 ccagcgccca ggccaggcct caactcaagc acgaggcgaa ggggctcctt aagcgcaagg 2760 cctcgaactc tcccacccac ttccaacccg aagctcggga tcaagaatca cgtactgcag 2820 ccagtggaag taattcaagg cacgcaaggg ccataacccg taaagaggcc aggcccgcgg 2880 gaaccacaca cggcacttac ctgtgttctg gcggcaaacc cgttgcgaaa aagaacgttc 2940 acggcgacta ctgcacttat atacggttct cccccaccct cgggaaaaag gcggagccag 3000 tacacgacat cactttccca gtttaccccg cgccaccttc tctaggcacc ggttcaattg 3060 ccgacccctc cccccaactt ctcggggact gtgggcgatg tgcgctctgc ccactgacgg 3120 gcaccggagc cctagattcg attccctttg gggcaaaact caccgcctaa tcccctataa 3180 ctctaccggg gagcccggtg gagagcagac gggctgacgc tgccacctgc cggccatccc 3240 aggataggac cgccgtattc aagtcgccct caggaaggac cctcggggca ccagaggcct 3300 tcgaagcccc aatgagtgag gcaactgagg gtcgcgggtg ccattacaag gcccagccaa 3360 ggcctagagc caaggcttga accgtggggg acccccaagc cccacctgcc caggaacagc 3420 agacactggg acactttgtt tcaggtcctg cccaggcccc tcccactgtg aggctgggat 3480 ttgtcgccca gggtgcagat gagaagagtg gggaaagcag tcctgagcca ggaaattcta 3540 ccgggtaggg gaggcgcttt tcccaaggca gtctggagca tgcgctttag cagccccgct 3600 gggcacttgg cgctacacaa gtggcctctg gcctcgcaca cattccacat ccaccggtag 3660 gcgccaaccg gctccgttct ttggtggccc cttcgcgcca ccttctactc ctcccctagt 3720 caggaagttc ccccccgccc cgcagctcgc gtcgtgcagg acgtgacaaa tggaagtagc 3780 acgtctcact agtctcgtgc agatggacag caccgctgag caatggaagc gggtaggcct 3840 ttggggcagc ggccaatagc agctttgctc cttcgctttc tgggctcaga ggctgggaag 3900 gggtgggtcc gggggcgggc tcaggggcgg gctcaggggc ggggcgggcg cccgaaggtc 3960 ctccggaggc ccggcattct gcacgcttca aaagcgcacg tctgccgcgc tgttctcctc 4020 ttcctcatct ccgggccttt cgacctccta gggccaccat ggtgagcaag ggcgaggacg 4080 acaacatggc catcatcaag gagttcatgc gcttcaaggt gcacatggag ggctccgtga 4140 acggccacga gttcgagatc gagggcgagg gcgagggccg cccctacgag ggcacccaga 4200 ccgccaagct gaaggtgacc aagggcggcc ccctgccctt cgcctgggac atcctgtccc 4260 ctcagttcat gtacggctcc aaggcctacg tgaagcaccc cgccgacatc cccgactact 4320 tgaagctgtc cttccccgag ggcttcaagt gggagcgcgt gatgaacttc gaggacggcg 4380 gcgtggtgac cgtgacccag gactcctccc tgcaggacgg cgagttcatc tacaaggtga 4440 agctgcgcgg caccaacttc ccctccgacg gccccgtaat gcagaagaag accatgggct 4500 gggaggcctc ctccgagcgg atgtaccccg aggacggcgc cctgaagggc gagatcaagc 4560 agaggctgaa gctgaaggac ggcggccact acgacgccga ggtcaagacc acctacaagg 4620 ccaagaagcc cgtgcagctg cccggcgcct acaacgtcaa catcaagctg gacatcacct 4680 cccacaacga ggactacacc atcgtggaac agtacgagcg cgccgagggc cgccactcca 4740 ccggcggcat ggacgagctg tacaagtgag gatccgctga tcagcctcga ctgtgccttc 4800 tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc 4860 cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg 4920 tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa 4980 tagcaggcat gctggggatg cggtgggctc tatggcttct gaggcggaaa gaacccttct 5040 gaggcggaaa gaaccagctg ccttaatata acttcgtata atgtatgcta tacgaagtta 5100 ttaggtctga agaggagttt acgtccagcc aattctgtgg aatgtgtgtc agttagggtg 5160 tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc tcaattagtc 5220 agcaaccagg tgtggaaagt ccccaggctc cccagcaggc agaagtatgc aaagcatgca 5280 tctcaattag tcagcaacca tagtcccgcc cctaactccg cccatcccgc ccctaactcc 5340 gcccagttcc gcccattctc cgccccatgg ctgactaatt ttttttattt atgcagaggc 5400 cgaggccgcc tctgcctctg agctattcca gaagtagtga ggaggctttt ttggaggcct 5460 aggcttttgc aaaaagctcc cgggagcttg tatatccatt ttcggcggcc gcgccaccat 5520 gaccgagtac aagcccacgg tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg 5580 caccctcgcc gccgcgttcg ccgactaccc cgccacgcgc cacaccgtcg atccggaccg 5640 ccacatcgag cgggtcaccg agctgcaaga actcttcctc acgcgcgtcg ggctcgacat 5700 cggcaaggtg tgggtcgcgg acgacggcgc cgcggtggcg gtctggacca cgccggagag 5760 cgtcgaagcg ggggcggtgt tcgccgagat cggcccgcgc atggccgagt tgagcggttc 5820 ccggctggcc gcgcagcaac agatggaagg cctcctggcg ccgcaccggc ccaaggagcc 5880 cgcgtggttc ctggccaccg tcggagtctc gcccgaccac cagggcaagg gtctgggcag 5940 cgccgtcgtg ctccccggag tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga 6000 gacctccgcg ccccgcaacc tccccttcta cgagcggctc ggcttcaccg tcaccgccga 6060 cgtcgaggtg cccgaaggac cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaga 6120 attcgcggga ctctggggtt cgaaatgacc gaccaagcga cgcccaacct gccatcacga 6180 gatttcgatt ccaccgccgc cttctatgaa aggttgggct tcggaatcgt tttccgggac 6240 gccggctgga tgatcctcca gcgcggggat ctcatgctgg agttcttcgc ccaccccaac 6300 ttgtttattg cagcttataa tggttacaa taaagcaata gcatcacaa ttcacaaat 6360 aaagcatttt ttcactgca ttctagttgt gttttgtcca aactcatcaa tgtatcttat 6420 catgtctgta taccgctcga ctagagcttg cggaaccctt atattactt cgtataatgt 6480 atgctatacg aagttag gtccgctggc catctacgag ccaagactt tcaatcttt 6540 ggctgccttg gccagtagga ggcgacacga aggatttgct gctgccttgg gggatgggaa 6600 ggaacctgaa ggcattttt ccagagtggt gcagtaccac tgaggactgt tgctgtattg 6660 attaggaaaa gagacagagt aatttgcagt ttgttgatt tatactgggc tgcaggtcga 6720 gggatcttca tagagaga gggacagcta tgactgggag tagtcaggg aggaggaaaa 6780 atctggctag taaaacatgt aaggaaaatt tagggt taaaaaaa aaacacaa 6840 aaaaatat aaaaaaatc taacctcag tcaggcttt tctatggaat aaggaatgga 6900 cagcaggggg ctgtttcata tactgatgac ctctttag ccaccttgt tcatggcagc 6960 cagcatatgg catatgttgc caactctaa accaatact cattctgatg ttttaatga 7020 tttgccctcc catatgtcct tccgagtgag agacacaaaa aattccaaca cactattgca 7080 atgaaaataa atttccttta ttagccagaa gtcagatgct caaggggctt catgatgtcc 7140 ccataatttt tggcagaggg aaaaagatct cagtggtatt tgtgagccag ggcattggcc 7200 acaccagcca ccaccttctg ataggcagcc tgcggtacct tacatggtgg cgaattcgtt 7260 tgccaaaatg atgagacagc acaataacca gcacgttgcc caggagctgt aggaaaaaga 7320 agaaggcatg aacatggtta gcagaggctc tagagccgcc ggtcacacgc cagaagccga 7380 accccgccct gccccgtccc ccccgaaggc agccgtcccc ctgcggcagc cccgaggctg 7440 gagatggaga aggggacggc ggcgcggcga cgcacgaagg ccctccccgc ccatttcctt 7500 cctgccggcg ccgcaccgct tcgcccgcgc ccgctagagg gggtgcggcg gcgcctccca 7560 gatttcggct ccgccagatt tgggacaaag gaagtccctg cgccctctcg cacgattacc 7620 ataaaaggca atggctgcgg ctcgccgcgc ctcgacagcc gccggcgctc cggggccgcc 7680 gcgcccctcc cccgagccct ccccggcccg aggcggcccc gccccgcccg gcacccccac 7740 ctgccgccac cccccgcccg gcacggcgag ccccgcgcca cgccccgcac ggagccccgc 7800 acccgaagcc gggccgtgct cagcaactcg gggagggggg tgcagggggg ggttacagcc 7860 cgaccgccgc gcccacaccc cctgctcacc cccccacgca cacaccccgc acgcagcctt 7920 tgttcccctc gcagcccccc cgcaccgcgg ggcaccgccc ccggccgcgc tcccctcgcg 7980 cacacgcgga gcgcacaaag ccccgcgccg cgcccgcagc gctcacagcc gccgggcagc 8040 gcgggccgca cgcggcgctc cccacgcaca cacacacgca cgcacccccc gagccgctcc 8100 cccccgcaca aagggccctc ccggagccct ttaaggcttt cacgcagcca cagaaaagaa 8160 acgagccgtc attaaaccaa gcgctaatta cagcccggag gagaagggcc gtcccgcccg 8220 ctcacctgtg ggagtaacgc ggtcagtcag agccggggcg ggcggcgcga ggcggcgcgg 8280 agcggggcac ggggcgaagg caacgcagcg actcccgccc gccgcgcgct tcgcttttta 8340 tagggccgcc gccgccgccg cctcgccata aaaggaaact ttcggagcgc gccgctctga 8400 ttggctgccg ccgcacctct ccgcctcgcc ccgccccgcc cctcgccccg ccccgccccg 8460 cctggcgcgc gcccccccc ccccgccc catcgctgca caaaataatt aaaaaataaa 8520 taatacaaa attgggggtg gggagggggg ggagatgggg agagtgaagc agaacgtggg 8580 gctcacctcg acccatggta atagcgatga ctaatacgta gatgtactgc caagtaggaa 8640 agtcccataa ggtcatgtac tgggcataat gccaggcggg ccatttaccg tcattgacgt 8700 caataggggg cgtacttggc atatgataca cttgatgtac tgccaagtgg gcagtttacc 8760 gtaaatagtc cacccattga cgtcaatgga aagtccctat tggcgttact atgggaacat 8820 acgtcattat tgacgtcaat gggcgggggt cgttgggcgg tcagccaggc gggccatta 8880 ccgtaagtta tgtaacgcgg aactccatat atgggctatg aactaatgac cccgtaattg 8940 attactatta ataactagtc aataatcaat gtcgtaaatg tcgtaaatgt ctcagctagt 9000 caggtagtaa aaggtgtcaa ctaggcagtg gcagagcagg attcaaattc agggctgttg 9060 tgatgcctcc gcagactctg agcgccacct ggtggtaatt tgtctgtgcc tcttctgacg 9120 tggaagaaca gcaactaaca cactaacacg gcatttacta tgggccagcc attgtacgcg 9180 ttgcttaacc tgattcttgg gcgttgtcct gcaggggatt gagcaggtgt acgaggacga 9240 gcccaatttc tctatattcc cacagtcttg agtttgtgtc acaaaataat tatagtgggg 9300 tggagatggg aaatgagtcc aggcaacacc taagcctgat tttatgcatt gagactgcgt 9360 gttattacta aagatctttg tgtcgcaatt tcctgatgaa gggagatagg ttaaaaagca 9420 cggatctact gagttttaca gtcatcccat ttgtagactt ttgctacacc accaaagtat 9480 agcatctgag attaaatatt aatctccaaa ccttaggccc cctcacttgc atccttacgg 9540 tcagataact ctcactcata ctttaagccc attttgtttg ttgtacttgc tcatccagtc 9600 ccagacatag cattggcttt ctcctcacct gttttaggta gccagcaagt catgaaatca 9660 gataagttcc accaccaatt aacactaccc atcttgagca taggcccaac agtgcattta 9720 ttcctcattt actgatgttc gtgaatattt accttgattt tcattttttt ctttttctta 9780 agctgggatt ttactcctga ccctattcac agtcagatga tcttgactac cactgcgatt 9840 ggacctgagg ttcagcaata ctccccttta tgtcttttga atacttttca ataaatctgt 9900 ttgtattttc attagttagt aactgagctc agttgccgta atgctaatag cttccaaact agtgtctctg tctccagtat ctgataaatc ttaggtgttg ctgggacagt tgtcctaaaa ttagtaaa gcatgaaaat aactgacaca actccattac tggctcctaa ctacttaaac aatgcattct atcatcacaa atgtgaaaaa ggagttccct cagtggacta accttatctt ttctcaacac ctttttcttt gcacaatttt ccacacatgc ctacaaaaag tacttatgcg gccgccataa aagttttgtt actttataga agaaatttg agttttgtt ttttttaata aataataaa cataaataaa ttgtttgttg aatttattat tagtatgtaa gtgtaaatat aataaaactt aatatctatt caataata aataacctc throwing ccgataaaac acatgcgtca attttacaca tgattatctt taacgtacgt cacaatatga ttatctttct agggttaatc tagctgcgtg ttctgcagcg tgtcgagcat cttcatctgc tccatcacgc 10500 10560. tgtaaaacac atttgcaccg cgagtctgcc cgtcctccac gggttcaaaa acgtgaatga acgaggcgcg ctcactggcc gtcgttttac aacgtcgtga ctgggaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg 10680 cccgcaccga tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg gacgcgccct 10740 gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg 10800 ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg 10860 gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac 10920 ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct 10980 gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt 11040 tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta taagggattt 11100 tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt 11160 ttaacaaaat attaacgctt acaatttagg tggcactttt cggggaaatg tgcgcggaac 11220 ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc 11280 ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt 11340 cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct 11400 ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga 11460 tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag 11520 cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca 11580 actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga 11640 aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag 11700 tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc 11760 ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa 11820 tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt 11880 gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg 11940 gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt 12000 tattgctgat aaatctggag ccggtgagcg tggttcacgc ggtatcattg cagcactggg 12060 gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagagtc aggcaactat 12120 ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact 12180 gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa 12240 aaggaatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt 12300 ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt 12360 ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg 12420 tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca 12480 gataccaaat actgtcctt tagtgtagcc gtagttaggc caccacttca agaactctgt 12540 agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga 12600 taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc 12660 gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaag cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggac aggagagcgc acgagggagc ttccaggggg 12840 aaacgcctgg tatcttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt 12900 tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt 12960 acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga 13020. ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggagag cgcccaatac gcaaaccgcc 13140. tctccccgcg cgttggccga ttcattaatg cagctggcac gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca cacaggaac agctatgacc atgattacgc caagcgcgcc cgccgggtaa ctcacggggt atccatgtcc atttctgcgg catccagcca ggatacccgt cctcgctgac gtaatatccc 13440 agcgccgcac cgctgtcatt aatctgcaca ccggcacggc agttccggct gtcgccggta 13500 ttgttcgggt tgctgatgcg cttcgggctg accatccgga actgtgtccg gaaaagccgc 13560 gacgaactgg tatcccaggt ggcctgaacg aacagttcac cgttaaaggc gtgcatggcc 13620 acaccttccc gaatcatcat ggtaaacgtg cgttttcgct caacgtcaat gcagcagcag 13680 tcatcctcgg caaactcttt ccatgccgct tcaacctcgc gggaaaaggc acgggcttct 13740 tcctccccga tgcccagata gcgccagctt gggcgatgac tgagccggaa aaaagacccg 13800 acgatatgat cctgatgcag ctagattaac cctagaaaga tagtctgcgt aaaattgacg 13860 catgcattct tgaaatattg ctctctcttt ctaaatagcg cgaatccgtc gctgtgcatt 13920 taggacatct cagtcgccgc ttggagctcc cgtgaggcgt gcttgtcaat gcggtaagtg 13980 tcactgattt tgaactataa cgaccgcgtg agtcaaaatg acgcatgatt atcttttacg 14040 tgactttaa gatttaactc atacgataat tatattgtta tttcatgttc tacttacgtg 14100 ataacttatt atatatatat tttcttgtta tagatatc 14138 <210> 4 <211> 1069 <212> DNA <213> On sow <400> 4 gtgctgagtc cttttcccat cccacccacc tggagctccc ctcttccagt cctgagccac 60 ttgaactggc ctggttttg ccatcctgcg ctgccctctc tccggactcg agccactgct 120 gagggcctca ggccagtcca tcctcgtctt gtctctttcg ccctgctctt tccccacctt 180 gagcgctctt aaccagcctg gcccgtgcca cctctactct gccatcgaat gctgccccac 240 tttctcgagt ccgccacttc tcccagcttc accggtaccc actgtttccc ctagtccagg 300 caggtaccac tttccctgag cgtcctcctc ctctctcctg ggcctgtgct gcttcttttc 360 ccgctctctg gcctgggccg tttcttcggc cagcccccga gccttccatg cctttcctt 420 caggtttctg ctcttcatcc ttggtctctg ccatctgttg ccatgtaagg gtgctctttc 480 ctgagccatc gccctcaagg cgctctgctc ctcaagtgga tgcttccctc gcctggctca 540 cctcctgctc tctctcctgc ccccttcacc tgcgtgccct cctcattctc cctctgtgcc 600 acctctggcc ttgcactgta ggctctctct tggggatgtt tctccttctc cacacacttc 660 tctttcactc tgtcctcttg ctttgtgtgg gcctgcagcg ttaccctttt ttctgggcac 720 actcagagca ccctcctctt tctggttctg ggccacctgt ctgtcctcgg gtcatcttgc 780 tctctctgcc tggatgccct cctgtggctt tgggcagctt ctccctcctt cagagtgcac 840 cgccagttct cctaggcccg gtcacttccc cttcccaggg gacctagagc cctgctaggt 900 cctctctctc cacaacctgg gcccccaaac ctttccaaaa caccttgctt tctgcctcca 960 ttggtcttgt gttccagagc cagagtcact atatgtccca gaaccaggat tccctctggt 1020 tctgagggct tttatcgcat cccctgcctg gctgcagtgg gtctttggg 1069 <210> 5 <211> 260 <212> DNA <213> Sus scrofa <400> 5 gacaggccac agaagagcct ctactcctcc ctctgtcccc gaggctgtct ccctcccagt 60 cttcccagct caggccagtc cccaggcctc tcttccctgc cagagcccgt caggttcggt 120 tactttgggg cccagagagg accctgtgaa ggaagcgtgg gtaggggcac gggaatgggg 180 aggatgcctg aagaggcccc cttagccaga agaggagcag agaggagca ggtacccaga 240 shaking shaking 260 <210> 6 <211> 540 <212> DNA <213> His sow <400> 6 aaatacccac gtttattggg acaaagttg ttagggaaa tggggcctca gagttatgat 60 tcaagtcata attctttcca tttataattt cactcgagac tctgttaact gattccttgt 120 gtgttgtatc ttactcctca gctcacaatt acttttagtt attcacctta actgtatgaa 180 taacagtgga gaaaaggatt ctaccagaat actctatta tggtttgag tcccctttcc 240 agactgaaga tttcagtc ttttgatt tall gatttt tcagtcttt tcgatctgag 300 gtgacagtct caagctccctc aattcaccca gtctctgat acttgtccat ttaggccac 360 caaagctact ttgactcat actagagagt cattaatga ggccattctc tgatggacag 420 gtgaagcagg caggtgact atattttgac taaacggtag aaaacagcct gagtgttaac 480 agtgtagcct ataaaaccca gagctgccca ccctgatcta aacttccagg aacataagaa 540 <210> 7 <211> 1009 <212> DNA <213> His sow <400> 7 agtaggtcac atttcagtaa aacctggctt tgtggattga gcatgtctg tctctctcctg 60 gtacttcatt agtcccctaa gtgggatttg ctgagcaaga ctcctcatt acagaaatac 120 tccagtttag aattctcgca aaggctttt gtttccacaa gtagaatcta gaagcaatc 180 tcaagtaaca acagcagaga cctgaatccc aatccatctt tcctgtgtgt cctcttttac 240 ctccttccct ttcatgttga accacagtc cttttcagt ctgaagcta gtacgaaaga 300 aatgtacaga tgtaggtacc aagcaaagcc attagccaat aactggtgag atggagctaa 360 gaggaataa aagtgttccct aagaataagca cagcagaagc tagatccaca gatcttaaa 420 cavattttggt tgagtagag taggaggaaa gaggaagct ataatgcag ttttaggag 480 ctaagagcca gataaagggt aagggcagga ggaagtgcta tctcagctaa cgagatacat 540 gaaacaacgg tggagtcca gcaggcaca gatgagttga gaagcaatca gggccagaag 600 gatgtgcaag gcctcaaat aaaaaagcac agggccacag ggaaccttat ggaattaaa 660 aggaagga tgcagtcagg agagaaaa agatgctcc ctccccatg cccaggag 720 cagctgagca gccagtactt gggaagttag tagtaatag ttggtaagag ggagttctgt 780 tcgtggctca atggttaaca aatcagacta gaaaccgtga ggttgcggt ttgatccctg 840 gccttgctca gtgggttaag gatccggcat tgccgtgacc tgtggtgtag gtcacagacg 900 tggctcagtt cccgcattcc tgtggctctg gtgtaggctg gtggtacag ctctgattag 960 acccctaggc tgggaacctc catatgccct ggaagtggcc gtagaaaag 1009 <210> 8 <211> 872 <212> DNA <213> His sow <400> 8 ggatggggac tcatgtgaat ttctaagg tgcttatttaa acggggggca cgagtgccgg 60 ctttggacag ggccgctcgc tctctctcc ccctcggccg cctctcacc 120 cctgaggcct ctctcccccc acgaccctc ctctctcctc tgaaccctc tcctcctcag 180 ctgcatccca ccctcgtggc ctctctctct ctctgtctgt cctgtgtcct ctctcactgg 240 gttcagagc acagatgcc aaagcacaaa agcagttttc ccctggggtg ggaggaagca 300 agagactttg tacctatttt gtatgtgtat aataatttga gatgttttta attattttga 360 ttgctggaat aaagcatgtg gaaatgacc aaaccaatct tgcactggcc tcctgatttc 420 cttccttgga gacggaggga gggggagacc tgggggaggg cgcttggggg ggggtgggct 480 ctcttctttc tgcgctcccc cccccacct ccaacacctt gacgacccct cctgcttccg 540 cttgccttc tcaggcttta acactttctc ctcgccctct cagcatgcgc atgcgcgtgc 600 ctctacctcc cccgcacatc ctggcctgcc caccctgaat ggcctggccc agcgatgcca 660 ccaactctct cgctccgtcc acggctgggg aggggggcac tctgcagggt tggggggcac 720 tgggaggctg ggttgggtga gggaggggtg cctgggcccc caccccccag caagttctct 780 ccctaggcga actggagggt cgtctggcct cttgagcctt gttgctggct ctgagctcta 840 ccaagagagt gaccagcagg accgcaccat ca 872 <210> 9 <211> 727 <212> DNA <213> On sow <400> 9 gtggttgctg agactgcgtg ggggcccaag gagacctgga gaaaggaatg cttcctgctc 60 cttcttctgg ggccccagga gagccttccc agggccttgg agaggtgctg tccagggact 120 aaccctgtgc tctaggaagg ctgcaggccc tgaccagctg ggcaggtcct gggtccctcc 180 tggccttcta agttccccaa acatgagacc tctgggtgtg gggtggcctg gggaggtcat 240 tttgcccagg ccctacctcc tgcccattcc taacccttt taaaaatctg tgcgtcctct 300 tctctctct tctccctccc tccctttc gctcaccctc tgctgctggc ctgagagccg 360 gaggccccca gggggaaggc gactggtctc ctccccagtc tcagggaagg gagacagaga 420 atccaggaag ccagaactca gcagacgaag cacccaggga cctagagatg ggttgaaaag 480 ttgacagctg tcccacctgc ctcccaaggt ctcagggcct aaacctccaa ggcaggaaag 540 gccctgtcc ctccctgggg tccatagaaa gagggacaag tctgcacgga ccatttgctg 600 tatattaac accttggctg tcattaggta gtcttggctg ttaattatgt cctgtgataa 660 tgtattatta gcacgccgac cacatagggt agggaactgc agctagtaaa caaaagtttg 720 ttcctat 727 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10 gaaggagcaa acugacaugg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 ugcagugggu cuuuggggac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 uuccaggaac auaagaaagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 [[ID=...]](原文中ID=43-51之间可能有缺失内容,这里按照格式要求原样保留) cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 gcagucucag caaccacuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 15219 <212> DNA <213> Artificial Sequence <400> 14 ggcgcgccgg atggggactc atgtgaattt tctaaaggtg ctatttaaac ggggggcacg 60 agtgccggct ttggacaggg ccgctcgctc tccacccttt cttcttcccc ctcggccgcc 120 tctcaccccc tgaggcctct ctccccccac gacctcctct ctctcctctg aaaccctctc 180 ctcctcagct gcatcccacc ctcgtggcct ctctctctct ctgtctgtcc tgtgtcctct 240 ctcactgggt ttcagagcac agatgcccaa agcacaaaag cagttttccc ctggggtggg 300 aggaagcaag agactttgta cctattttgt atgtgtataa taatttgaga tgtttttaat 360 tattttgatt gctggaataa agcatgtgga aatgacccaa accaatcttg cactggcctc 420 ctgatttcct tccttggaga cggagggagg gggagacctg ggggagggcg cttggggggg 480 ggtgggctct cttctttctg cgctcccccc ccccacctcc aacaccttga cgacccctcc 540 tgcttccgct tgcctttctc aggctttaac actttctcct cgccctctca gcatgcgcat 600 gcgcgtgcct ctacctcccc cgcacatcct ggcctgccca ccctgaatgg cctggcccag 660 cgatgccacc aactctctcg ctccgtccac ggctgggggagggggcactc tgcagggttg 720 gggggcactg ggaggctggg ttgggtgagg gaggggtgcc tgggccccca ccccccagca 780 agttctctcc ctaggcgaac tggagggtcg tctggcctct tgagccttgt tgctggctct 840 gagctctacc aagagagtga ccagcaggac cgcaccatca cgcgccccag acccgggcct 900 ggggggcaag tcggggggcg gggggaggtc gggcagggtc ccctgggagg atggggacgt 960 gctgtgcccc tagcggccac cagagggcac caggacacca ctgcggtcgg ctcagcggct 1020 cctgccctgg tcaggggcg ccaggtcctg cccctcctgg ggagggcggg gggcgagaag 1080 ggcgattacg cgtggctccg gtgcccgtca gtgggcagag cgcacatcgc ccacagtccc 1140 cgagaagttg gggggagggg tcggcaattg aaccggtgcc tagagaaggt ggcgcggggt 1200 aaactgggaa agtgatgtcg tgtactggct ccgccttttt cccgagggtg ggggagaacc 1260 gtatataagt gcagtagtcg ccgtgaacgt tctttttcgc aacgggtttg ccgccagaac 1320 acaggtaagt gccgtgtgtg gttcccgcgg gcctggcctc tttacgggtt atggcccttg 1380 cgtgccttga attacttcca ctggctgcag tacgtgattc ttgatcccga gcttcgggtt 1440 ggaagtgggt gggagagttc gaggccttgc gcttaaggag ccccttcgcc tcgtgcttga 1500 gttgaggcct ggcctgggcg ctggggccgc cgcgtgcgaa tctggtggca ccttcgcgcc 1560 tgtctcgctg ctttcgataa gtctctagcc atttaaaatt tttgatgacc tgctgcgacg 1620 ctttttttct ggcaagatag tcttgtaaat gcgggccaag atctgcacac tggtatttcg 1680 gtttttgggg ccgcgggcgg cgacggggcc cgtgcgtccc agcgcacatg ttcggcgagg 1740 cggggcctgc gagcgcggcc accgagaatc ggacgggggt agtctcaagc tggccggcct 1800 gctctggtgc ctggcctcgc gccgccgtgt atcgccccgc cctgggcggc aaggctggcc 1860 cggtcggcac cagttgcgtg agcggaaaga tggccgcttc ccggccctgc tgcagggagc 1920 tcaaaatgga ggacgcggcg ctcgggagag cgggcgggtg agtcacccac acaaaggaaa 1980 agggcctttc cgtcctcagc cgtcgcttca tgtgactcca cggagtaccg ggcgccgtcc 2040 aggcacctcg attagttctc gagcttttgg agtacgtcgt ctttaggttg gggggagggg 2100 ttttatgcga tggagtttcc ccacactgag tgggtggaga ctgaagttag gccagcttgg 2160 cacttgatgt aattctcctt ggaatttgcc ctttttgagt ttggatcttg gttcattctc 2220 aagcctcaga cagtggttca aagttttttt cttccatttc aggtgtcgtg acgtacggtc 2280 gacgccacca tgtcaagctc ttcctggctc cttctcagcc ttgttgctgt aactgctgct 2340 cagtccacca ttgaggaaca ggccaagaca tttttggaca agtttaacca cgaagccgaa 2400 gacctgttct atcaaagttc acttgcttct tggaattata acaccaatat tactgaagag 2460 aatgtccaaa acatgaataa tgctggggac aaatggtctg cctttttaaa ggaacagtcc 2520 acacttgccc aaatgtatcc actacaagaa attcagaatc tcacagtcaa gcttcagctg 2580 caggctcttc agcaaaatgg gtcttcagtg ctctcagaag acaagagcaa acggttgaac 2640 acaattctaa atacaatgag caccatctac agtactggaa aagtttgtaa cccagataat 2700 ccacaagaat gcttattact tgaaccaggt ttgaatgaaa taatggcaaa cagtttagac 2760 tacaatgaga ggctctgggc ttgggaaagc tggagatctg aggtcggcaa gcagctgagg 2820 ccattatatg aagagtatgt ggtcttgaaa aatgagatgg caagagcaaa tcattatgag 2880 gactatgggg attattggag aggagactat gaagtaaatg gggtagatgg ctatgactac 2940 agccgcggcc agttgattga agatgtggaa catacctttg aagagattaa accattatat 3000 gaacatcttc atgcctatgt gagggcaaag ttgatgaatg cctatccttc ctatatcagt 3060 ccaattggat gcctccctgc tcatttgctt ggtgatatgt ggggtagatt ttggacaaat 3120 ctgtactctt tgacagttcc ctttggacag aaaccaaaca tagatgttac tgatgcaatg 3180 gtggaccagg cctgggatgc acagagaata ttcaaggagg ccgagaagtt ctttgtatct 3240 gttggtcttc ctaatatgac tcaaggattc tgggaaaatt ccatgctaac ggacccagga 3300 aatgttcaga aagcagtctg ccatcccaca gcttgggacc tggggaaggg cgacttcagg 3360 atccttatgt gcacaaaggt gacaatggac gacttcctga cagctcatca tgagatgggg catatccagt atgatatggc atatgctgca caaccttttc tgctaagaaa tggagctaat gaggattcc atgaagctgt tggggaaatc atgtcacttt ctgcagccac acctaagcat ttaaatcca ttggtcttct gtcacccgat tttcaagaag acaatgaaac agaaataac ttcctgctca aacaagcact cacgattgtt gggactctgc catttactta catgttagag aagtggaggt ggatggtctt taaagggga attcccaaag accagtggat gaaaaagtgg tgggagatga agcgagagat agttggggtg gtggaacctg tgccccatga tgaaacatac 3780. tgtgaccccg catctctgtt ccatgtttct aatgattact cattcattcg attackcaca aggacccttt accaattcca gtttcaaga gcactttgtc aagcagctaa acatgaaggc cctctgcaca aatgtgacat ctcaaactct acagaagctg gacagaaact gttcaatatg ctgaggcttg gaaaatcaga accctggacc ctagcattgg aaaatgttgt aggagcaaag aacatgaatg taaggccact gctcaactac tttgagccct tatttacctg gctgaaagac cagaacaaga attctttgtgt gggatggagt accgactgga gtccatatgc agaccaaagc 4140 atcaaagtga ggataagcct aaaatcagct cttggagata aagcatatga atggaacgac 4200 aatgaaatgt acctgttccg atcatctgtt gcatatgcta tgaggcagta cttttaaaa 4260 gtaaaaaatc agatgattct ttttggggag gaggatgtgc gagtggctaa tttgaaacca 4320 agaatctcct ttaatttctt tgtcactgca cctaaaaatg tgtctgatat cattcctaga 4380 actgaagttg aaaaggccat caggatgtcc cggagccgta tcaatgatgc tttccgtctg 4440 aatgacaaca gcctagagtt tctggggata cagccaacac ttggacctcc taaccagccc 4500 cctgtttcca tatggctgat tgtttttgga gttgtgatgg gagtgatagt ggttggcatt 4560 gtcatcctga tcttcactgg gatcagagat cggaagaaga aaaataaagc aagaagtgga 4620 gaaaatcctt atgcctccat cgatattagc aaaggagaaa ataatccagg attccaaaac 4680 actgatgatg ttcagacctc ctttggcagc ggcgccacaa acttctctct gctaaagcaa 4740 gcaggtgatg ttgaagaaaa ccccgggcct atgggcatcc aggcggggaga accagacccc 4800 ccagaggac ccctcacctc gcaagcatcc gtgcccccccc atcagcttcg gctaggcagc 4860 ctccatcctc acacccctta tcacatccgc gtggcatgca ccagcagcca gggcccctca 4920 tcctggaccc actggcttcc tgtggagacg ccggagggag tgcccctggg cccccctgag 4980 aacattagtg ctacgcggaa tgggagccag gccttcgtgc attggcaaga gccccgggcg 5040 cccctgcagg gtaccctgtt agggtaccgg ctggcgtatc aaggccagga caccccagag 5100 gtgctaatgg acatagggct aaggcaagag gtgaccctgg agctgcaggg ggacgggtct 5160 gtgtccaatc tgacagtgtg tgtggcagcc tacactgctg ctggggatgg accctggagc 5220 ctcccagtac ccctggaggc ctggcgccca gggcaagcac agccagtcca ccagctggtg 5280 aaagcacctt caactcctgc cttctcgtgg ccctggtggt atgtactgct aggagcagtc 5340 gtggccgctg cctgtgtcct catcttggct ctcttccttg tccaccggcg aaagaggag 5400 acccgttatg gagaagtgtt tgaaccaaca gtggagaagag gtgaactggt agtcaggtac 5460 cgcgtgcgca agtcctacag tcgtcggacc actgaagcta ccttgaacag cctgggcatc 5520 agtgaagagc tgaaggaga gctgcgggat gtgatggtgg accggcacaa ggtggccctg 5580 gggaagactc tgggagagg agagtttgga gctgtgatgg aaggccagct caaccaggac 5640 gactccatcc tcaaggtggc tgtgaagacg atgaagattg ccatctgcac gaggtcagag 5700 ctggaggatt tcctgagtga agcggtctgc atgaaggaat ttgaccatcc caacgtcatg 5760 aggctcatcg gtgtctgttt ccagggttct gaacgaga gcttcccagc acctgtggtc 5820 atcttacctt tcatgaaaca tggagaccta cacagcttcc tcctctattc ccggctcggg 5880 gaccagccag tgtacctgcc cactcagatg ctagtgaagt tcatggcaga catcgccagt 5940 ggcatggagt atctgagtac caagagattc atacaccggg acctggcgg caggaactgc 6000 atgctgaatg agaacatgtc cgtgtgtgtg gcggacttcg ggctctccaa gaagatctac 6060 aatggggact actaccgcca gggacgtatc gccaagatgc cagtcaagtg gattgccatt 6120 gagagtctag ctgaccgtgt ctacaccagc aagagcgatg tgtggtcctt cggggtgaca 6180 atgtgggaga ttgccacaag aggccaaacc ccatatccgg gcgtggagaa cagcgagatt 6240 tatgactatc tgcgccaggg aaatcgcctg aagcagcctg cggactgtct ggatggactg 6300 tatgccttga tgtcgcggtg ctgggagcta aatccccagg accggccaag ttttacagag 6360 ctgcgggaag atttggagaa cacactgaag gccttgcctc ctgcccagga gcctgacgaa 6420 atcctctatg tcaacatgga tgagggtgga ggttatcctg aaccccctgg agctgcagga 6480 ggagctgacc ccccaaccca gccagaccct aaggattcct gtagctgcct cactgcggct 6540 gaggtccatc ctgctggacg ctatgtcctc tgcccttcca caacccctag ccccgctcag 6600 cctgctgata ggggctcccc agcagcccca gggcaggagg atggtgccgg ctccggcgag 6660 ggcaggggaa gtcttctaac atgcggggac gtggaggaaa atcccggccc aatgccccct 6720 gccccgcccg gaggtgaaag cgggtgtgag gagcgcggcg cggcaggtca tattgaacat 6780 tccagatacc tatcattact cgatgctgtt gataacagca agatggcttt gaactcaggg 6840 tcaccaccag ctattggacc ttactatgaa aaccatggat accaaccgga aaacccctat 6900 cccgcacagc ccactgtggt ccccactgtc tacgaggtgc atccggctca gtactacccg 6960 tcccccgtgc cccagtacgc cccgagggtc ctgacgcagg cttccaaccc cgtcgtctgc 7020 acgcagccca aatccccatc cgggacagtg tgcacctcaa agactaagaa agcactgtgc 7080 atcaccttga ccctggggac cttcctcgtg ggagctgcgc tggccgctgg cctactctgg 7140 aagttcatgg gcagcaagtg ctccaactct gggatagagt gcgactcctc aggtacctgc 7200 atcaacccct ctaactggtg tgatggcgtg tcacactgcc ccggcgggga ggacgagaat 7260 cggtgtgttc gcctctacgg accaaacttc atccttcagg tgtactcatc tcagaggaag 7320 tcctggcacc ctgtgtgcca agacgactgg aacgagaact acgggcgggc ggcctgcagg 7380 gacatgggct ataagaataa tttttactct agccaaggaa tagtggatga cagcggatcc 7440 accagcttta tgaaactgaa cacaagtgcc ggcaatgtcg atatctataa aaaactgtac 7500 cacagtgatg cctgttcttc aaaagcagtg gtttctttac gctgtatagc ctgcggggtc 7560 aacttgaact caagccgcca gagcaggatt gtgggcggcg agagcgcgct cccgggggcc 7620 tggccctggc aggtcagcct gcacgtccag aacgtccacg tgtgcggagg ctccatcatc 7680 accccccgagt ggatcgtgac agccgcccac tgcgtggaaa aacctctttaa caatccatgg 7740 cattggacgg catttgcggg gattttgaga caatctttca tgttctatgg agccggatac 7800 7860 gcgctgatga agctcgagaa gcctctgact ttcaacgacc tagtgaaacc agtgtgtctg 7920 cccaacccag gcatgatgct gcagccagaa cagctctgct ggatttccgg gtggggggcc 7980 accgagaga aagggaagac ctcagaagtg ctgaacgctg ccaaggtgct tctcattgag 8040 acacagagat gcaacagcag atatgtctat gacaacctga tcacaccagc catgatctgt 8100 gccggcttcc tgcaggggaa cgtcgattct tgccagggtg acagtggagg gcctctggtc 8160 acttcgaaga aaatatctg gtggctgata ggggatacaa gctggggttc tggctgtgcc 8220 aaagcttaca gaccaggagt gtacgggaat gtgatggtat tcacggactg gatttatcga 8280 caaatgagg cagacggcta aattatccct aatacctgcc accccactct taatcagtgg 8340 tggagaacg gtctcagaac tgtttgtttc aattggccat ttaagtttag tagtaaaaga 8400 ctggttaatg ataacaatgc atcgtaaaac cttcagaagg aaaggagaat gttttgtgga 8460 ccactttggt tttcttttt gcgtgtggca gttttaagtt attagtttt aaaatcagta 8520 cttttaatg gaaacaactt gaccaaaaat ttgtcacaga atttgagac cattaaaaa 8580 agttaaatga gaaacctgtg tgttccttg gtcaacaccg agacatttag gtgaaagaca 8640 tctaattctg gttttacgaa tctggaaact tcttgaaaat gtaattcttg agttaacact 8700 tctgggtgga gaatagggtt gttttccccc cacataattg gaaggggaag gaatatcatt 8760 taaagctatg ggagggtttc tttgattaca acactggaga gaaatgcagc atgttgctga 8820 ttgcctgtca ctaaaacagg ccaaaaactg agtccttggg ttgcatagaa agctacgcgt 8880 tctgaggcgg aaagaaccag ctgccttaat ataacttcgt ataatgtatg ctatacgaag 8940 ttattaggtc tgaagaggag tttacgtcca gccaattctg tggaatgtgt gtcagttagg 9000 gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta 9060 gtcagcaacc aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat 9120 gcatctcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac 9180 tccgcccagt tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga 9240 ggccgaggcc gcctctgcct ctgagctatt ccagaagtag tgaggaggct tttttggagg 9300 cctaggcttt tgcaaaaagc tcccgggagc ttgtatatcc attttcggcg gccgcgccac 9360 catgaccgag tacaagccca cggtgcgcct cgccacccgc gacgacgtcc ccagggccgt 9420 acgcaccctc gccgccgcgt tcgccgacta ccccgccacg cgccacaccg tcgatccgga 9480 ccgccacatc gagcgggtca ccgagctgca agaactcttc ctcacgcgcg tcgggctcga 9540 catcggcaag gtgtgggtcg cggacgacgg cgccgcggtg gcggtctgga ccacgccgga 9600 gagcgtcgaa gcgggggcgg tgttcgccga gatcggcccg cgcatggccg agttgagcgg 9660 ttcccggctg gccgcgcagc aacagatgga aggcctcctg gcgccgcacc ggcccaagga 9720 gcccgcgtgg ttcctggcca ccgtcggagt ctcgcccgac caccagggca agggtctggg 9780 cagcgccgtc gtgctccccg gagtggaggc ggccgagcgc gccggggtgc ccgccttcct 9840 ggagacctcc gcgccccgca acctcccctt ctacgagcgg ctcggcttca ccgtcaccgc 9900 cgacgtcgag gtgcccgaag gaccgcgcac ctggtgcatg acccgcaagc ccggtgcctg 9960 agaattcgcg ggactctggg gttcgaaatg accgaccaag cgacgcccaa cctgccatca 10020 cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat cgttttccgg 10080 gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt cgcccacccc 10140 aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 10200 aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 10260 tatcatgtct gtataccgct cgactagagc ttgcggaacc cttaatataa cttcgtataa 10320 tgtatgctat acgaagttat taggtccgct ggccatctac gagccaaaga ctttcaaatc 10380 tttggctgcc ttggccagta ggaggcgaca cgaaggattt gctgctgcct tgggggatgg 10440 gaaggaacct gaaggcattt tttccagagt ggtgcagtac cactgaggac tgttgctgta 10500 ttgattagga aaagagacag agtaatttgc agtttgtttg atttatactg tggttgctga 10560 gactgcgtgg gggcccaagg agacctggag aaaggaatgc ttcctgctcc ttcttctggg 10620 gccccaggag agccttccca gggccttgga gaggtgctgt ccagggacta accctgtgct 10680 ctaggaaggc tgcaggccct gaccagctgg gcaggtcctg ggtccctcct ggccttctaa 10740 gttccccaaa catgagacct ctgggtgtgg ggtggcctgg ggaggtcatt ttgcccaggc 10800 cctacctcct gcccattcct aacccttttt aaaaatctgt gcgtcctctt cttccttctt 10860 ctccctccct tccctttcg ctcaccctct gctgctggcc tgagagccgg aggcccccag 10920 ggggaaggcg actggtctcc tccccagtct cagggaaggg agacagagaa tccaggaagc 10980 cagaactcag cagacgaagc acccagggac ctagagatgg gttgaaaagt tgacagctgt 11040 cccacctgcc tcccaaggtc tcagggccta aacctccaag gcaggaaagg cccctgtccc 11100 tccctggggt ccatagaaag agggacaagt ctgcacggac catttgctgt aatattaaca 11160 ccttggctgt cattaggtag tcttggctgt taattatgtc ctgtgataat gtattattag 11220 cacgccgacc acatagggta gggaactgca gctagtaaac aaaagtttgt tcctatatgc ggccgccata aaagttttgt tactttatag aagaaatttt gagtttttgt tttttttaat 11400. 11400. 11400. 11400. 11400. 11400. 11400. 11400. 11460. 11460. 11460. 11460. 11460. 11460. 11460. 11460 cacatgcgtc aattttacac atgattatct ttaacgtacg tcacaatatg attatctttc tagggttaat ctagctgcgt gttctgcagc gtgtcgagca tcttcatctg ctccatcacg ctgtaaaca catttgcacc gcgagtctgc ccgtcctcca cgggttcaaa aacgtgaatg aacgaggcgc gctcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgaatg ggacgcgccc 11820. tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt 11880. gccagcgccc tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc 11940 ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta 12000 cggcacctcg accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccc 12060 tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg 12120 ttccaaactg gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt 12180 ttgccgattt cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat 12240 tttaacaaaa tattaacgct tacaatttag gtggcacttt tcggggaaat gtgcgcggaa 12300 cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac 12360 cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg 12420 tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc 12480 tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg 12540 atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga 12600 gcacttta agttctgcta tgtggcgcgg tattacccg tattgacgcc gggcaagagc 12660 aactcggtcg ccgcatacac tattctcaga atgactgt tgagtactca ccagtcacag 12720 aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc ataccatga 12780 gtgatacac tgcggccaac ttactctga caacgatcgg aggaccgag gagctaccg 12840 cttttttgca cacatgggg gatcatgtaa ctcgccttga tcgttggga ccggagctga 12900 atgaagccat accaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt 12960 tgcgcaact atttactggc gaactactta ctctagcttc ccggcaacaa ttatagact 13020 ggatggaggc ggataagtt gcaggaccac ttctgcgctc ggccctccg gctggctggt 13080 ttattgctga taatctgga gccggtgagc gtggttcacg cggtatcatt gcagcactgg 13140 ggccagatgg taagccctcc cgtacgtag ttactacac gacggggagt caggcaacta 13200 tggatgaacg aaatagacag atcgctgaga taggtgccctc actgattaag cattgtaac 13260 tgtcagacca agtttactca tatatacttt agattgatt aaaacttcat ttttaattta 13320 aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt 13380 tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt 13440 tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt 13500 gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc 13560 agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg 13620 tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg 13680 ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt 13740 cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac 13800 tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg 13860 acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg 13920 gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat 13980 ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt 14040 tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg 14100 attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attack gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaa cagctatgac catgattacg ccaagcgcgc ccgccgggta actcacgggg tatccatgtc catttctgcg gcatccagcc aggatacccg tcctcgctga cgtaatatcc cagcgccgca ccgctgtcat taatctgcac accggcacgg cagttccggc tgtcgccggt attgttcggg ttgctgatgc gcttcgggct gaccatccgg aactgtgtcc ggaaaagccg cgacgaactg gtatcccagg tggcctgac gaacagttca ccgttaaagg cgtgcatggc cacaccttcc cgaatcatca tggtaaacgt gcgttttcgc tcaacgtcaa tgcagcagca 14760 gtcatcctcg gcaaactctt tccatgccgc ttcaacctcg cgggaaaagg cacgggcttc 14820 ttcctccccg atgcccagat agcgccagct tgggcgatga ctgagccgga aaaaagaccc 14880 gacgatatga tcctgatgca gctagattaa ccctagaaag atagtctgcg taaattgac 14940 gcatgcattc ttgaaatatt gctctctctt tctaaatagc gcgaatccgt cgctgtgcat 15000 ttaggacatc tcagtcgccg cttggagctc ccgtgaggcg tgcttgtcaa tgcggtaagt 15060 gtcactgatt ttgaactata acgaccgcgt gagtcaaaat gacgcatgat tatcttttac 15120 gtgactttta agatttaact catacgataa ttatattgtt atttcatgtt ctacttacgt 15180 gataacttat tatatatatta ttttcttgtt atagatatc 15219 <210> 15 <211> 805 <212> PRT <213> Homo sapiens <400> 15 Put Dear Dear Dear Dear Trp Leu Leu Leu Dear Leu Val Ala Val Thr Ala 1 5 10 15 Ala Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe 20 25 30 Asn His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp 35 40 45 Asn Tyr Asn Thr Asn Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn 50 55 60 Ala Gly Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala 65 70 75 80 Gln Met Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln 85 90 95 Leu Gln Ala Leu Gln Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys 100 105 110 Ser Lys Arg Leu Asn Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser 115 120 125 Thr Gly Lys Val Cys Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu 130 135 140 Glu Pro Gly Leu Asn Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu 145 150 155 160 Arg Leu Trp Ala Trp Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu 165 170 175 Arg Pro Leu Tyr Glu Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg 180 185 190 Ala Asn His Tyr Glu Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu 195 200 205 Val Asn Gly Val Asp Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu 210 215 220 Asp Val Glu His Thr Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu 225 230 235 240 His Ala Tyr Val Arg Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile 245 250 255 Ser Pro Ile Gly Cys Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly 260 265 270 Arg Phe Trp Thr Asn Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys 275 280 285 Pro Asn Ile Asp Val Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala 290 295 300 Gln Arg Ile Phe Lys Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu 305 310 315 320 Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro 325 330 335 Gly Asn Val Gln Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly 340 345 350 Lys Gly Asp Phe Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp 355 360 365 Phe Leu Thr Ala His His Glu Met Gly His Ile Gln Tyr Asp Met Ala 370 375 380 Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe 385 390 395 400 His Glu Ala Val Gly Glu Ile Met Ser Leu Ser Ala Ala Thr Pro Lys 405 410 415 His Leu Lys Ser Ile Gly Leu Leu Ser Pro Asp Phe Gln Glu Asp Asn 420 425 430 Glu Thr Glu Ile Asn Phe Leu Leu Lys Gln Ala Leu Thr Ile Val Gly 435 440 445 Thr Leu Pro Phe Thr Tyr Met Leu Glu Lys Trp Arg Trp Met Val Phe 450 455 460 Lys Gly Glu Ile Pro Lys Asp Gln Trp Met Lys Lys Trp Trp Glu Met 465 470 475 480 Lys Arg Glu Ile Val Gly Val Val Glu Pro Val Pro His Asp Glu Thr 485 490 495 Tyr Cys Asp Pro Ala Ser Leu Phe His Val Ser Asn Asp Tyr Ser Phe 500 505 510 Ile Arg Tyr Tyr Thr Arg Thr Leu Tyr Gln Phe Gln Phe Gln Glu Ala 515 520 525 Leu Cys Gln Ala Ala Lys His Glu Gly Pro Leu His Lys Cys Asp Ile 530 535 540 Ser Asn Ser Thr Glu Ala Gly Gln Lys Leu Phe Asn Met Leu Arg Leu 545 550 555 560 Gly Lys Ser Glu Pro Trp Thr Leu Ala Leu Glu Asn Val Val Gly Ala 565 570 575 Lys Asn Met Asn Val Arg Pro Leu Leu Asn Tyr Phe Glu Pro Leu Phe 580 585 590 Thr Trp Leu Lys Asp Gln Asn Lys Asn Ser Phe Val Gly Trp Ser Thr 595 600 605 Asp Trp Ser Pro Tyr Ala Asp Gln Ser Ile Lys Val Arg Ile Ser Leu 610 615 620 Lys Ser Ala Leu Gly Asp Lys Ala Tyr Glu Trp Asn Asp Asn Glu Met 625 630 635 640 Tyr Leu Phe Arg Ser Ser Val Ala Tyr Ala Met Arg Gln Tyr Phe Leu 645 650 655 Lys Val Lys Asn Gln Met Ile Leu Phe Gly Glu Glu Asp Val Arg Val 660 665 670 Ala Asn Leu Lys Pro Arg Ile Ser Phe Asn Phe Phe Val Thr Ala Pro 675 680 685 Lys Asn Val Ser Asp Ile Ile Pro Arg Thr Glu Val Glu Lys Ala Ile 690 695 700 Arg Met Ser Arg Ser Arg Ile Asn Asp Ala Phe Arg Leu Asn Asp Asn 705 710 715 720 Ser Leu Glu Phe Leu Gly Ile Gln Pro Thr Leu Gly Pro Pro Asn Gln 725 730 735 Pro Pro Val Ser Ile Trp Leu Ile Val Phe Gly Val Val Met Gly Val 740 745 750 Ile Val Val Gly Ile Val Ile Leu Ile Phe Thr Gly Ile Arg Asp Arg 755 760 765 Lys Lys Lys Asn Lys Ala Arg Ser Gly Glu Asn Pro Tyr Ala Ser Ile 770 775 780 Asp Ile Ser Lys Gly Glu Asn Asn Pro Gly Phe Gln Asn Thr Asp Asp 785 790 795 800 Val Gln Thr Ser Phe 805 <210> 16 <211> 626 <212> PRT <213> Homo sapiens <400> 16 Met Gly Ile Gln Ala Gly Glu Pro Asp Pro Pro Glu Glu Pro Leu Thr 1 5 10 15 Ser Gln Ala Ser Val Pro Pro His Gln Leu Arg Leu Gly Ser Leu His 20 25 30 Pro His Thr Pro Tyr His Ile Arg Val Ala Cys Thr Ser Ser Gln Gly 35 40 45 Pro Ser Ser Trp Thr His Trp Leu Pro Val Glu Thr Pro Glu Gly Val 50 55 60 Pro Leu Gly Pro Pro Glu Asn Ile Ser Ala Thr Arg Asn Gly Ser Gln 65 70 75 80 Ala Phe Val His Trp Gln Glu Pro Arg Ala Pro Leu Gln Gly Thr Leu 85 90 95 Leu Gly Tyr Arg Leu Ala Tyr Gln Gly Gln Asp Thr Pro Glu Val Leu 100 105 110 Met Asp Ile Gly Leu Arg Gln Glu Val Thr Leu Glu Leu Gln Gly Asp 115 120 125 Gly Ser Val Ser Asn Leu Thr Val Cys Val Ala Ala Tyr Thr Ala Ala 130 135 140 Gly Asp Gly Pro Trp Ser Leu Pro Val Pro Leu Glu Ala Trp Arg Pro 145 150 155 160 Gly Gln Ala Gln Pro Val His Gln Leu Val Lys Glu Pro Ser Thr Pro 165 170 175 Ala Phe Ser Trp Pro Trp Trp Tyr Val Leu Leu Gly Ala Val Val Ala 180 185 190 Ala Ala Cys Val Leu Ile Leu Ala Leu Phe Leu Val His Arg Arg Lys 195 200 205 Lys Glu Thr Arg Tyr Gly Glu Val Phe Glu Pro Thr Val Glu Arg Gly 210 215 220 Glu Leu Val Val Arg Tyr Arg Val Arg Lys Ser Tyr Ser Arg Arg Thr 225 230 235 240 Thr Glu Ala Thr Leu Asn Ser Leu Gly Ile Ser Glu Glu Leu Lys Glu 245 250 255 Lys Leu Arg Asp Val Met Val Asp Arg His Lys Val Ala Leu Gly Lys 260 265 270 Thr Leu Gly Glu Gly Glu Phe Gly Ala Val Met Glu Gly Gln Leu Asn 275 280 285 Gln Asp Asp Ser Ile Leu Lys Val Ala Val Lys Thr Met Lys Ile Ala 290 295 300 Ile Cys Thr Arg Ser Glu Leu Glu Asp Phe Leu Ser Glu Ala Val Cys 305 310 315 320 Met Lys Glu Phe Asp His Pro Asn Val Met Arg Leu Ile Gly Val Cys 325 330 335 Phe Gln Gly Ser Glu Arg Glu Ser Phe Pro Ala Pro Val Val Ile Leu 340 345 350 Pro Phe Met Lys His Gly Asp Leu His Ser Phe Leu Leu Tyr Ser Arg 355 360 365 Leu Gly Asp Gln Pro Val Tyr Leu Pro Thr Gln Met Leu Val Lys Phe 370 375 380 Met Ala Asp Ile Ala Ser Gly Met Glu Tyr Leu Serve Thr Lys Arg Phe 385 390 395 400 His Arg Asp Leu Ala Ala Arg Asn Cys Met Leu Asn Glu Asn Met 405 410 415 Ser Val Cys Val Ala Asp Phe Gly Leu Ser Lys Lys Ile Tyr Asn Gly 420 425 430 Asp Tyr Tyr Arg Gln Gly Arg Ile Ala Lys Met Pro Val Lys Trp Ile 435 440 445 Only Glu Ser Leu Only Asp Arg Val Tyr Thr Ser Ser Asp Val 450 455 460 Trp Ser Phe Gly Val Thr Met Trp Glu Ile Ala Thr Arg Gly Gln Thr 465 470 475 480 Pro Tyr Pro Gly Val Glu Asn Ser Glu Ile Tyr Asp Tyr Leu Arg Gln 485 490 495 Gly Asn Arg Leu Lys Gln Pro Ala Asp Cys Leu Asp Gly Leu Tyr Ala 500 505 510 Leu Met Ser Arg Cys Trp Glu Leu Asn Pro Gln Asp Arg Pro Ser Phe 515 520 525 Thr Glu Leu Arg Glu Asp Leu Glu Asn Thr Leu Lys Ala Leu Pro Pro 530 535 540 Ala Gln Glu Pro Asp Glu Ile Leu Tyr Val Asn Met Asp Glu Gly Gly 545 550 555 560 Gly Tyr Pro Glu Pro Pro Gly Ala Ala Gly Gly Ala Asp Pro Pro Thr 565 570 575 Gln Pro Asp Pro Lys Asp Ser Cys Ser Cys Leu Thr Ala Ala Glu Val 580 585 590 His Pro Ala Gly Arg Tyr Val Leu Cys Pro Ser Thr Thr Pro Ser Pro 595 600 605 Ala Gln Pro Ala Asp Arg Gly Ser Pro Ala Ala Pro Gly Gln Glu Asp 610 615 620 Gly Ala 625 <210> 17 <211> 529 <212> PRT <213> Homo sapiens <400> 17 Met Pro Pro Ala Pro Pro Gly Gly Glu Ser Gly Cys Glu Glu Arg Gly 1 5 10 15 Ala Ala Gly His Ile Glu His Ser Arg Tyr Leu Ser Leu Leu Asp Ala 20 25 30 Val Asp Asn Ser Lys Met Ala Leu Asn Ser Gly Ser Pro Pro Ala Ile 35 40 45 Gly Pro Tyr Tyr Glu Asn His Gly Tyr Gln Pro Glu Asn Pro Tyr Pro 50 55 60 Ala Gln Pro Thr Val Val Pro Thr Val Tyr Glu Val His Pro Ala Gln 65 70 75 80 Tyr Tyr Pro Ser Pro Val Pro Gln Tyr Ala Pro Arg Val Leu Thr Gln 85 90 95 Ala Ser Asn Pro Val Val Cys Thr Gln Pro Lys Ser Pro Ser Gly Thr 100 105 110 Val Cys Thr Ser Lys Thr Lys Lys Ala Leu Cys Ile Thr Leu Thr Leu 115 120 125 Gly Thr Phe Leu Val Gly Ala Ala Leu Ala Ala Gly Leu Leu Trp Lys 130 135 140 Phe Met Gly Ser Lys Cys Ser Asn Ser Gly Ile Glu Cys Asp Ser Ser 145 150 155 160 Gly Thr Cys Ile Asn Pro Ser Asn Trp Cys Asp Gly Val Ser His Cys 165 170 175 Pro Gly Gly Glu Asp Glu Asn Arg Cys Val Arg Leu Tyr Gly Pro Asn 180 185 190 Phe Ile Leu Gln Val Tyr Ser Ser Gln Arg Lys Ser Trp His Pro Val 195 200 205 Cys Gln Asp Asp Trp Asn Glu Asn Tyr Gly Arg Ala Ala Cys Arg Asp 210 215 220 Met Gly Tyr Lys Asn Asn Phe Tyr Ser Ser Gln Gly Ile Val Asp Asp 225 230 235 240 Ser Gly Ser Thr Ser Phe Met Lys Leu Asn Thr Ser Ala Gly Asn Val 245 250 255 Asp Ile Tyr Lys Lys Leu Tyr His Ser Asp Ala Cys Ser Ser Lys Ala 260 265 270 Val Val Ser Leu Arg Cys Ile Ala Cys Gly Val Asn Leu Asn Ser Ser 275 280 285 Arg Gln Ser Arg Ile Val Gly Gly Glu Ser Ala Leu Pro Gly Ala Trp 290 295 300 Pro Trp Gln Val Ser Leu His Val Gln Asn Val His Val Cys Gly Gly 305 310 315 320 Ser Ile Ile Thr Pro Glu Trp Ile Val Thr Ala Ala His Cys Val Glu 325 330 335 Lys Pro Leu Asn Asn Pro Trp His Trp Thr Ala Phe Ala Gly Ile Leu 340 345 350 Arg Gln Ser Phe Met Phe Tyr Gly Ala Gly Tyr Gln Val Glu Lys Val 355 360 365 Ile Ser His Pro Asn Tyr Asp Ser Lys Thr Lys Asn Asn Asp Ile Ala 370 375 380 Leu Met Lys Leu Gln Lys Pro Leu Thr Phe Asn Asp Leu Val Lys Pro 385 390 395 400 Val Cys Leu Pro Asn Pro Gly Met Met Leu Gln Pro Glu Gln Leu Cys 405 410 415 Trp Ile Ser Gly Trp Gly Ala Thr Glu Glu Lys Gly Lys Thr Ser Glu 420 425 430 Val Leu Asn Ala Ala Lys Val Leu Leu Ile Glu Thr Gln Arg Cys Asn 435 440 445 Ser Arg Tyr Val Tyr Asp Asn Leu Ile Thr Pro Ala Met Ile Cys Ala 450 455 460 Gly Phe Leu Gln Gly Asn Val Asp Ser Cys Gln Gly Asp Ser Gly Gly 465 470 475 480 Pro Leu Val Thr Ser Lys Asn Asn Ile Trp Trp Leu Ile Gly Asp Thr 485 490 495 Ser Trp Gly Ser Gly Cys Ala Lys Ala Tyr Arg Pro Gly Val Tyr Gly 500 505 510 Asn Val Met Val Phe Thr Asp Trp Ile Tyr Arg Gln Met Arg Ala Asp 515 520 525 Gly <210> 18 <211> 1101 <212> DNA <213> Sus scrofa <400> 18 aataaatgca ctgttgggcc tatgctcaag atgggtagtg ttaattggtg gtggaactta 60 tctgatttca tgacttgctg gctacctaaa acaggtgagg agaaagccaa tgggactggg 120 actggatgag caagtacaac aaacaaaatg ggcttaaagt atgagtgaga gttatctgac 180 cgtaaggatg caagtgaggg ggcctaaggt ttggagatta atatttaatc tcagatgcta 240 tactttggtg gtgtagcaaa agtctacaaa tgggatgact gtaaaactca gtagatccgt 300 gctttttaac ctatctccct tcatcaggaa attgcgacac aaagatcttt agtaataaca 360 cgcagtctca atgcataaaa tcaggcttag gtgttgcctg gactcatttc ccatctccac 420 cccactataa ttattttgtg acacaaactc aagactgtgg gaatatagag aaattgggct 480 cgtcctcgta cacctgctca atcccctgca ggacaacgcc caagaatcag gttaagccag 540 ggcaaaagaa tcccgcccat aatcgagaag gagcaaactg acatggaggc gatgacgaga 600 tcgcggggga gggagggatt tttctaggcc cagggcggtc cttaggaaaa ggaggcagca 660 gagaactccc ataaaggtat tgcggcactc ccctccccct gcggagaagg gtgcggcctt 720 ctctccgcct cctccactgc agctccctca ggattgcagc tcgcgcgggt ttttggagaa 780 catgcgcctc ccacccacaa gccagcagga ccgacccccc actccttcct ccacccccca 840 cccccacggg tccgagagca ggtagagagc tagtctcgtc cttcaggcgg cggacgccca 900 gggcggagcc gcagtcacca ccacccagaa gcctcggccc ggcagcccgc ccccgcctcc 960 tgcgcgcgct tctgccacg ttgcgcaggg gcgaggggcc agacactgcg gcgctggcct 1020 cggggagggc cgtaccaaag accgcctccc tgccgactcg cgtagtggtt tcgctcattt 1080 gggacccaag caataacaa g 1101 <210> 19 <211> 1056 <212> DNA <213> On sow <400> 19 tgctctct cctgccccct tcacctgcgt gccctcctca ttctccctct gtgccaccctc 60 tggccttgca ctgtaggctc tctcttgggg atgtttctct ttctccacac acttctcttt 120 cactctgtcc tcttgctttg tgtgggcctg cagcgttacc cttttttctg ggcacactca 180 gagcaccctc ctctttctgg ttctgggcca cctgtctgtc ctcgggtcat cttgctctct 240 ctgcctggat gccctcctgt ggctttgggc agcttctccc tccttcagag tgcaccgcca 300 gttctcctag gcccggtcac ttccccttcc caggggacct agagccctgc taggtcctct 360 ctctccacaa cctgggcccc caaacctttc caaaacacct tgctttctgc ctccattggt 420 cttgtgttcc agagccagag tcactatatg tcccagaacc aggattccct ctggttctga 480 gggcttttat cgcatcccct gcctggctgc agtgggtctt tggggacagg ccacagaaga 540 gcctctactc ctccctctgt ccccgaggct gtctccctc cagtctccc agctcaggcc 600 agtccccagg cctctcttcc ctgccagagc ccgtcaggtt cggttacttt ggggcccaga 660 gaggaccctg tgaggaagc gtgggtaggg gcacgggaat ggggaggatg cctgaaggg 720 cccccttagc cagagagga gcagagagg agcaggtacc cagagagga gcagttcagg 780 gaaatagaag agtccccgagc tctttttttttttttttttttttc ttttctttc 840 tttttatggc agcatccgtg gtatatggag gttcccagcc taggttcag atcatacctg 900 caactgccag cctacaccac agccacagca ctcaggatcc gagctgcatc tgcggcttac 960 gccacaggtc accacgc tggatcctta acccactga tgaggccagg gattgaacct 1020 gcaacctcat gcacactg ctggggtctt aatcgg 1056 <210> 20 <211> 1108 <212> DNA <213> His sow <400> 20 acttcctcct gccttaccc tttatctgc tcttagctcc taaaaactgc attack 60 tcctcttttg cctctactct tactcaacca aaattgtttt aagatctgtg gatctagctt 120 ctgctgtgct attcttagga acacttttat ttcctcttag ctccatctca ccagttattg 180 gctaatggct ttgcttggta cctacatctg tacatttctt tcgtactagc ttctagactg 240 aaaaaggact gttggttcaa catgaaaggg aaagggtaa aaggacac acaggaaaga 300 tggattggga ttcaggtctc tgctgttgtt acttgagatt gctttctaga ttctacttgt 360 ggaaaaaaa agcctttgcg agaattctaa actggagtat ttctgtaatt gaggagtctt 420 gctcagcaaa tcccacttag gggactaatg aagtaccagg aagacaga ccatgctcaa 480 tccacaaagc caggttttac tgaaatgtga cctactttct tatgttcctg gaagtttaga 540 tcagggtggg cagctctggg ttttataggc tacactgtta acactcaggc tgttttctac 600 cgtttagtca aaatatagtc accttgcctg cttcacctgt ccatcagaga atggcctcat 660 720 agagactggg tgaattgagg agcttgagac tgtcacctca gatcgaaaag actgaaaaat 780 cacctcagat caaaaagact gaaaaatctt cagtctggaa aggggactca aaaccataat 840 tagagtattc tggtagaatc cttttctcca ctgttattca tacagttaag gtgaataact 900 aaaagtaatt gtgagctgag gagtaagata caacacacaa ggaatcagtt aacagagtct 960 cgagtgaaat tataaatgga aagaattatg acttgaatca taactctgag gccccatttt 1020 ccctaacaac ttttgtccca ataaacgtgg gtatttgttt gggagaaact atcatataca 1080 tgattaccca gtaaacagac tgtttact 1108 <210> 21 <211> 1089 <212> DNA <213> Sus scrofa <400> 21 actttgtacc tattttgtat gtgtataata atttgagatg tttttaatta ttttgattgc 60 tggaataaag catgtggaaa tgacccaaac caatcttgca ctggcctcct gatttccttc 120 cttggagacg gaggagggg gagacctggg ggagggcgct tgggggggg tgggctctct 180 tctttctgcg ctcccccccc ccacctccaa caccttgacg acccctcctg cttccgcttg 240 cctttctcag gctttaacac tttctctcg ccctctcagc atgcgcatgc gcgtgcctct 300 acctccccg cacatcctgg cctgcccacc ctgaatgtcc tggcccagcg atgccaccaa 360 ctctctcgct ccgtccacgg ctggggaggg gggcactctg cagggttggg gggcactggg 420 aggctgggtt gggtgaggga ggggtgcctg ggcccccacc ccccagcaag ttctctccct 480 aggcgaactg gagggtcgtc tggcctcttg agccttgttg ctggctctga gctctaccaa 540 gagagtgacc agcaggaccg caccatcagt ggttgctgag actgcgtggg ggcccaagga 600 gacctggaga aaaggaatgct tcctgctcct tcttctgggg cccagaggaga gccttcccag 660 ggccttggag agttgctgtc cagggactaa ccctgtgctc taggaaggct gcaggccctg 720 accagctggg caggtcctgg gtccctcctg gccttctaag ttccccaaac atgagacctc 780 tgggtgtggg gtggcctggg gaggtcattt tgcccaggcc ctacctcctg cccattccta 840 acccttttta aaaatctgtg cgtcctcttc ttccttcttc tccctccctt cccttttcgc 900 tcaccctctg ctgctggcct gagagccgga ggcccccagg gggaaggcga ctggtctcct 960 ccccagtctc agggaaggga gacagagaat ccaggaagcc agaactcagc agacgaagca 1020 cccagggacc tagagatggg ttgaaaagtt gacagctgtc ccacctgcct cccaaggtct 1080 cagggccta 1089 <210> 22 <211> 7922 <212> DNA <213> Artificial Sequence <400> 22 ggatcccctg agggggcccc catgggctag aggatccggc ctcggcctct gcataaataa 60 aaaaaattag tcagccatga gcttggccca ttgcatacgt tgtatccata tcataatatg 120 tacatttata ttggctcatg tccaacatta ccgccatgtt gacattgatt attgactagt 180 tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga gttccgcgtt 240 acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg cccattgacg 300 tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg acgtcaatgg 360 gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca tatgccaagt 420 acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc ccagtacatg 480 accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc tattaccatg 540 gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt 600 ccaagtctcc accccattga cgtcaatggg agttgtttt ggcaccaaaa tcaacgggac 660 tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag gcgtgtacgg 720 tgggaggtct atataagcag agctcgttta gtgaaccgtc agatcgcctg gagacgccat 780 ccacgctgtt ttgacctcca tagagacac cgggaccgat ccagcctccc ctcgaagctt 840 acatgtggta ccgagctcgg atcctgagaa cttcagggtg agtctatggg acccttgatg 900 ttttctttcc cctttttttc tatggttaag ttcatgtcat aggaagggga gaagtaacag 960 ggtacacata ttgaccaaat cagggtaatt ttgcatttgt aattttaaaa aatgctttct 1020 tcttttaata tactttttg tttatcttat ttctaatact ttccctaatc tctttctttc 1080 agggcaataa tgatacaatg tatcatgcct ctttgcacca ttctaaagaa taacagtgat 1140 aatttctggg ttaaggcaat agcaatattt ctgcatataa atatttctgc atataaattg 1200 taactgatgt aagaggtttc atattgctaa tagcagctac aatccagcta ccattctgct 1260 tttattttat ggttgggata aggctggatt attctgagtc caagctaggc ccttttgcta 1320 atcatgttca tacctcttat cttcctccca cagctcctgg gcaacgtgct ggtctgtgtg 1380 ctggcccatc actttggcaa agcacgtgag atctatgttt gtttttcttg ttttattgcc 1440 actagtctct agtcagtgtg ttaatcttac aaccagaact caattacccc ctgcatacac 1500 taattctttc acacgtggtg tttattaccc tgacaaagtt ttcagatcct cagttttaca 1560 ttcaactcag gacttgttct tacctttctt ttccaatgtt acttggttcc atgctataca 1620 tgtctctggg accaatggta ctaagaggtt tgataaccct gtcctaccat ttaatgatgg 1680 tgtttatttt gcttccactg agaagtctaa cataataaga ggctggattt ttggtactac 1740 tttagattcg aagacccagt ccctacttat tgttaataac gctactaatg ttgttattaa 1800 agtctgtgaa tttcaatttt gtaatgatcc atttttgggt gtttattacc acaaaaacaa 1860 caaaagttgg atggaaagtg agttcagagt ttattctagt gcgaataatt gcacttttga 1920 atatgtctct cagccttttc ttatggacct tgaaggaaaa cagggtaatt tcaaaaatct 1980 tagggaattt gtgtttaaga atattgatgg ttattttaaa atatattcta agcacacgcc 2040 tattaattta gtgcgtgatc tccctcaggg ttttcggct ttagaaccat tggtagattt 2100 gccaataggt attaacatca ctaggttca aactttactt gctttacata gaagttattt 2160 gactcctggt gattcttctt caggttggac agctggtgct gcagcttatt atgtgggtta 2220 tcttcaacct aggactttc tattaaaata taatgaaaat ggaaccatta cagatgctgt 2280 agactgtgca cttgaccctc tctcagaaac aaagtgtacg ttgaaatcct tcactgtaga 2340 aaaaggaatc tatcaaactt ctaactttag agtccaacca acagaatcta ttgttagatt 2400 tcctaatatt acaaacttgt gcccttttgg tgaagtttttt aacgccacca gatttgcatc 2460 tgttatgct tggaacagga agagaatcag caactgtgtt gctgattatt ctgtcctata 2520 taattccgca tcattttcca cttttaagtg ttatggagtg tctcctacta aattaaatga 2580 tctctgcttt actaatgtct atgcagattc atttgtaatt agaggtgatg aagtcagaca 2640 aatcgctcca gggcaaactg gaaagattgc tgattataat tataaattac cagatgattt 2700 tacaggctgc gttatagctt ggaattctaa caatcttgat tctaaggttg gtggtaatta tattacctg tatagattgt ttaggaagtc taatctcaaa ccttttgaga gagatatttc aactgaaatc tatcaggccg gtagcacacc ttgtaatggt gttgaaggtt ttaattgtta ctttccttta caatcatatg gtttccaacc cactaatggt gttggttacc aaccatacag tagged ctttcttttg aacttctaca tgcaccagca actgtttgtg gacctaaaa gtctactaat ttggttaaaa acaaatgtgt caatttcaac ttcaatggtt taacaggcac aggtgttctt actgagtcta acaaaagtt tctgcctttc caacaatttg gcagagacat 3120. tgctgacact actgatgctg tccgtgatcc acagacactt gagattcttg acattacacc atgttctttt ggtggtgtca gtgttataac accaggaca aatacttcta accaggttgc tgttctttat caggatgtta actgcacaga agtccctgtt gctattcatg cagatcaact 3300 tactcctact tggcgtgttt attctacagg ttctaatgtt tttcaaacac gtgcaggctg 3360 3420. tttaataggg gctgaacatg tcaacaactc atatgagtgt gacataccca ttggtgcagg tatatgcgct agttatcaga ctcagactaa ttctcctcgg cgggcacgta gtgtagctag 3480 tcaatccatc attgcctaca ctatgtcact tggtgcagaa aattcagttg cttactctaa 3540 taactctatt gccataccca caaattttac tattagtgtt accacagaaa ttctaccagt 3600 gtctatgacc aagacatcag tagattgtac aatgtacatt tgtggtgatt caactgaatg 3660 cagcaatctt ttgttgcaat atggcagttt ttgtacacaa ttaaaccgtg cttaactgg 3720 atagctgtt gaacaagaca aaaacaccca agaagtttttt gcacaagtca aacaaattta 3780 caaaacacca ccaattaaag atttggtgg ttttaatttt tcacaaatat taccagatcc 3840 atcaaaacca agcaagaggt catttattga agatctactt ttcaacaaag tgacacttgc 3900 agatgctggc ttcatcaaac aatatggtga ttgccttggt gatattgctg ctagagacct 3960 catttgtgca caaaagttta acggccttac tgttttgcca cctttgctca cagatgaaat 4020 gattgctcaa tacacttctg cactgttagc gggtacaatc acttctggtt ggacctttgg 4080 tgcaggtgct gcattacaaa taccatttgc tatgcaaatg gcttataggt ttaatggtat 4140 tggagttaca cagaatgttc tctatgagaa ccaaaaattg attgccaacc aatttaatag 4200 tgctattggc aaaattcaag actcactttc ttccacagca agtgcacttg gaaaacttca 4260 agatgtggtc aaccaaaatg cacaagcttt aaacacgctt gttaaacaac ttagctccaa 4320 ttttggtgca atttcaagtg ttttaaatga tatcctttca cgtcttgaca aagttgaggc 4380 tgaagtgcaa attgataggt tgatcacagg cagacttcaa agtttgcaga catatgtgac 4440 tcaacaatta attagagctg cagaaatcag agcttctgct aatcttgctg ctactaaaat 4500 gtcagagtgt gtacttggac aatcaaaaag agttgatttt tgtggaaagg gctatcatct 4560 tatgtccttc cctcagtcag cacctcatgg tgtagtcttc ttgcatgtga cttatgtccc 4620 tgcacaagaa aagaacttca caactgctcc tgccatttgt catgatggaa aagcacactt 4680 tcctcgtgaa ggtgtctttg tttcaaatgg cacacactgg tttgtaacac aaaggaattt 4740 ttatgaacca caaatcatta ctacagacaa cacatttgtg tctggtaact gtgatgttgt 4800 aataggaatt gtcaacaaca cagtttatga tcctttgcaa cctgaattag actcattcaa 4860 ggaggagtta gataaatatt ttaagaatca tacatcacca gatgttgatt taggtgacat 4920 ctctggcatt aatgcttcag ttgtaaacat tcaaaaagaa attgaccgcc tcaatgaggt 4980 tgccaagaat ttaaatgaat ctctcatcga tctccaagaa cttggaaagt atgagcagta 5040 tataaaatgg ccatggtaca tttggctagg ttttatagct ggcttgattg ccatagtaat 5100 ggtgacaatt atgctttgct gtatgaccag ttgctgtagt tgtctcaagg gctgttgttc 5160 ttgtggatcc tgctgcaaat ttgattaaac cccaccagtg caggctgcct atcagaaagt 5220 ggtggctggt gtggctaatg ccctggccca caagtatcac taagctcgct ttcttgctgt 5280 ccaatttcta ttaaaggttc ctttgttccc taagtccaac tactaaactg ggggatatta 5340 tgaagggcct tgagcatctg gattctgcct aataaaaaac atttattttc attgcaatga 5400 tgtatttaaa ttatttctga atattttact aaaaagggaa tgtgggaggt cagtgcattt 5460 aaaacataaa gaaatgaaga gctagttcaa accttgggaa aatacactat atcttaaact 5520 ccatgaaaga aggtgaggct gcaaacagct aatgcacatt ggcaacagcc cctgatgcct 5580 atgccttatt catccctcag aaaaggattc aagtagaggc ttgatttgga ggttaaagtt 5640 ttgctatgct gtattttaca ttacttattg ttttagctgt cctcatgaat gtcttttcac 5700 tacccatttg cttatcctgc atctctcagc cttgactcca ctcagttctc ttgcttagag 5760 ataccacctt tcccctgaag tgttccttcc atgttttacg gcgagatggt ttctcctcgc 5820 ctggccactc agccttagtt gtctctgttg tcttatagag gtctacttga agaaggaaaa 5880 acagggggca tggtttgact gtcctgtgag cccttcttcc ctgcctcccc cactcacagt 5940 gacccggaat ccctcgacat ggcagtctag cactagtgcg gccgcagatc tgcttcctcg 6000 ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag 6060 gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 6120 ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc 6180 cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 6240 ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg 6300 accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 6360 catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 6420 gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 6480 tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 6540 agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac 6600 actagaagaa cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga 6660 gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc 6720 aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg 6780 gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca 6840 aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt 6900 atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca 6960 gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg 7020 attack gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca 7080 ccggctccag atttatcagc aaaaaccag ccagccggaa gggccgagcg cagaagtggt 7140 cctgcaactt tatccgcctc catccagtct atttattgtt gccgggaagc tagtaagt 7200 agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca 7260 cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca 7320 tgatccccca tgttgtgcaa aaagcggtt agctccttcg gtcctccgat cgttgtcaga 7380 agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact 7440 gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga 7500 gatagtgta tgcggcgacc gagttgctt tgcccggcgt caatacggga taataccgcg 7560 ccacatagca gaactttaaa agtgctcatc attggaaac gttctcggg gcgaaaactc 7620 tcaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga 7680 tcttcagcat cttttactt caccagcgtt tctgggtg caaaaacagg aaggcaaat 7740 gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt 7800 caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt 7860 atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac 7920 gt 7922 <210> 23 <211> 9144 <212> DNA <213> Artificial Sequence <400> 23 gtcgacggat cgggagatct cccgatcccc tatggtgcac tctcagtaca atctgctctg 60 atgccgcata gttaagccag tatctgctcc ctgcttgtgt gttggaggtc gctgagtagt 120 gcgcgagcaa aatttaagct acaacaaggc aaggcttgac cgacaattgc atgaagaatc 180 tgcttagggt taggcgtttt gcgctgcttc gcgatgtacg ggccagatat acgcgttgac 240 attgattatt gactagttat taatagtaat caattacggg gtcattagtt catagcccat 300 atatggagtt ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg 360 acccccgccc attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt 420 tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag 480 tgtatcatat gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc 540 attatgccca gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag 600 tcatcgctat taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt 660 ttgactcacg gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc 720 accaaaatca acgggacttt ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg 780 gcggtaggcg tgtacggtgg gaggtctata taagcagcgc gttttgcctg tactgggtct 840 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 900 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 960 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc 1020 gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc 1080 ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa 1140 ttttgactag cggaggctag aaggagag atgggtgcga gagcgtcagt attaagcggg 1200 ggagaattag atcgcgatgg gaaaaaatttc ggttaaggcc aggggaag aaaaatata 1260 aattaaaaca tatagtatgg gcaagcagggg agctagaacg attcgcagtt aatcctggcc 1320 tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga 1380 caggatcaga agaacttaga tcattatata atacagtagc aaccctct tgtgtgcatc 1440 aaaggaagaaaagaaaaaaaaaaaaaaaaaaaaaaaaggaaaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaad imagind haveaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaees says   cttaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaggs ct aaagtaagac caccgcacag caagcggccg ctgatcttca gacctggagg aggagatg 1560 agggacaatt gagaagtga attaataa tataaagtag taaaaattga accattagga 1620 gtagcacca ccaaggcaa gagagagtg gtgcagagag aaaaagagc agtgggaata 1680 ggagctttgt tccttgggtt cttgggagca gcaggaagca ctatggggcgc agcgtcaatg 1740 acgctgacgg tacaggccag acaattattg tctgtatag tgcagcagca gaacaatttg 1800 ctgagggcta tgaggcgca acagcatctg ttgcactca cagtctgggg catcagcag 1860 ctccaggcaa gaatcctggc tgtggaaaga tacctaaagg atcaacagct cctggggatt 1920 tggggttgct ctggaaaact catttgcacc actgctgtgc cttggaatgc tagttggagt 1980 aataaatctc tggaacagat ttggaatcac acgacctgga tggagtggga cagagaaatt 2040 aacaattaca caagcttaat acactcctta attgaagaat cgcaaacca gcaagaaaag 2100 aatgaacaag aattattgga attagataaa tgggcaagtt tgtggaattg gtttaacata 2160 acaaattggc tgtggtatat aaaattattc ataatgatag taggaggctt ggtaggttta 2220 agaatagttt ttgctgtact ttctatagtg aatagagtta ggcagggata ttcaccatta 2280 tcgtttcaga cccacctccc aaccccgagg ggacccgaca ggcccgaagg aatagaagaa 2340 gaaggtggag agagagacag agacagatcc attcgattag tgaacggatc ggcactgcgt 2400 gcgccaattc tgcagacaaa tggcagtatt catccacaat tttaaaagaa aaggggggat 2460 tgggggtac agtgcagggg aaagaatagt agacataata gcaacagaca tacaaactaa 2520 agaattacaa aaacaaatta caaaaattca aaattttcgg gtttattaca gggacagcag 2580 agatccagtt tggttaatta agggcagagc gcacatcgcc cacagtcccc gagaagttgg 2640 ggggaggtt cggcaattga tccggtgcct agagaggtg gcgcggggta aactgggaaa 2700 gtgatgtcgt gtactggctc cgccttttc ccgagggtgg gggagaaccg tatataagtg 2760 cagtagtcgc cgtgaacgtt cttttcgca acggttttgc cgccagaaca caggaccggt 2820 tctagagcgc tctcgaggcc accatggtga gcaagggcga ggaggataac atggccatca 2880 tcaggagtt catgcgctc aaggtgcaca tggaggctc cgtgaacggc cacgagttcg 2940 agatcgagggg cgaggggcgag ggccgcccct acgagggcac ccagaccgcc aagctgaagg 3000 tgaccaaggg tggccccctg cccttcgcct gggacatcct gtcccctcag ttcatgtacg 3060 gctccaaggc ctacgtgaag caccccgccg acatccccga ctacttgaag ctgtccttcc 3120 ccgaggctt caagtgggag cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga 3180 cccaggactc ctccctgcag gacggcgagt tcatctacaa ggtgaagctg cgcggcacca 3240 acttccccctc cgacggcccc gtaatgcaga agagaccat gggctgggag gcctcctccg 3300 agcggatgta ccccgaggac ggcgccctga agggcgagat caagcagagg ctgaagctga 3360 aggacggcgg ccactacgac gctgaggtca agaccaccta caaggccaag aagcccgtgc 3420 agctgcccgg cgcctacaac gtcaacatca agttggacat cacctcccac aacgaggact 3480 acaccatcgt ggaacagtac gaacgcgccg agggccgcca ctccaccggc ggcatggacg 3540 agctgtacaa gggtaccgga tccggcgcaa caaacttctc tctgctgaaa caagccggag 3600 atgtcgaaga gaatcctgga ccgaccgagt acaagcccac ggtgcgcctc gccacccgcg 3660 acgacgtccc cagggccgta cgcaccctcg ccgccgcgtt cgccgactac cccgccacgc 3720 gccacaccgt cgatccggac cgccacatcg agcgggtcac cgagctgcaa gaactcttcc 3780 tcacgcgcgt cgggctcgac atcggcaagg tgtgggtcgc ggacgacggc gccgcggtgg 3840 cggtctggac cacgccggag agcgtcgaag cgggggcggt gttcgccgag atcggcccgc 3900 gcatggccga gttgagcggt tcccggctgg ccgcgcagca acagatggaa ggcctcctgg 3960 cgccgcaccg gcccaaggag cccgcgtggt tcctggccac cgtcggagtc tcgcccgacc 4020 accagggcaa gggtctgggc agcgccgtcg tgctccccgg agtggaggcg gccgagcgcg 4080 ccggggtgcc cgccttcctg gagacctccg cgccccgcaa cctccccttc tacgagcggc 4140 tcggcttcac cgtcaccgcc gacgtcgagg tgcccgaagg accgcgcacc tggtgcatga 4200 cccgcaagcc cggtgcctga acgcgttaag tcgacaatca acctctggat tacaaaattt 4260 gtgaaagatt gactggtatt cttaactatg ttgctccttt tacgctatgt ggatacgctg 4320 ctttaatgcc tttgtatcat gctattgctt cccgtatggc tttcattttc tcctccttgt 4380 ataaatcctg gttgctgtct ctttatgagg agttgtggcc cgttgtcagg caacgtggcg 4440 tggtgtgcac tgtgtttgct gacgcaaccc ccactggttg gggcattgcc accacctgtc 4500 agctcctttc cgggactttc gctttccccc tccctattgc cacggcggaa ctcatcgccg 4560 cctgccttgc ccgctgctgg acaggggctc ggctgttggg cactgacaat tccgtggtgt 4620 tgtcggggaa atcatcgtcc tttccttggc tgctcgcctg tgttgccacc tggattctgc 4680 gcgggacgtc cttctgctac gtcccttcgg ccctcaatcc agcggacctt ccttcccgcg 4740 gcctgctgcc ggctctgcgg cctcttccgc gtcttcgcct tcgccctcag acgagtcgga 4800 tctccctttg ggccgcctcc ccgcgtcgac tttaagacca atgacttaca aggcagctgt 4860 agatcttagc cactttttaa aagaaaaggg gggactggaa gggctaattc actcccaacg 4920 aagacaagat ctgctttttg cttgtactgg gtctctctgg ttagaccaga tctgagcctg 4980 ggagctctct ggctaactag ggaacccact gcttaagcct caataaagct tgccttgagt 5040 gcttcaagta gtgtgtgccc gtctgttgtg tgactctggt aactagagat ccctcagacc 5100 cttttagtca gtgtggaaaa tctctagcag ggcccgttta aacccgctga tcagcctcga 5160 ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 5220 tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 5280 tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 5340 gggaagacaa tagcaggcat gctggggatg cggtgggctc tatggcttct gaggcggaaa 5400 gaaccagctg gggctctagg gggtatcccc acgcgccctg tagcggcgca ttaagcgcgg 5460 cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta gcgccccgctc 5520 ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg ctttccccgt caagctctaa 5580 atcgggggct ccctttaggg ttccgattta gtgctttacg gcacctcgac ccccaaaaaac 5640 ttgattaggg tgatggttca cgtagtgggc catcgccctg atagacggtt tttcgccctt 5700 tgacgttgga gtccacgttc tttaatagtg gactcttgtt ccaaactgga acaacactca 5760 accctatctc ggtctattct tttgatttat aagggatttt gccgatttcg gcctattggt 5820 taaaaaatga gctgatttaa caaaaattta acgcgaatta attctgtgga atgtgtgtca 5880 gttagggtgt ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct 5940 caattagtca gcaaccaggt gtggaaagtc ccccaggctcc ccagcaggca gaagtatgca 6000 aagcatgcat ctcaattagt cagcaaccat agtccccgccc ctaactccgc ccatcccgcc 6060 cctaactccg cccagttccg cccattctcc gccccatggc tgactaattt tttttattta 6120 tgcagaggcc gaggccgcct ctgcctctga gctattccag aagtagtgag gaggcttttt 6180 tggaggccta ggcttttgca aaaagctccc gggagcttgt atatccattt tcggatctga 6240 tcagcacgtg ttgacaatta atcatcggca tagtatatcg gcatagtata atacgacaag 6300 gtgaggaact aaaccatggc caagttgacc agtgccgttc cggtgctcac cgcgcgcgac 6360 gtcgccggag cggtcgagtt ctggaccgac cggctcgggt tctcccggga cttcgtggag 6420 gacgacttcg ccggtgtggt ccgggacgac gtgaccctgt tcatcagcgc ggtccaggac 6480 caggtggtgc cggacaacac cctggcctgg gtgtgggtgc gcggcctgga cgagctgtac 6540 gccgagtggt cggaggtcgt gtccacgaac ttccgggacg cctccgggcc ggccatgacc 6600 gagatcggcg agcagccgtg ggggcgggag ttcgccctgc gcgacccggc cggcaactgc 6660 gtgcacttcg tggccgagga gcaggactga cacgtgctac gagatttcga ttccaccgcc 6720 gccttctatg aaaggttggg cttcggaatc gttttccggg acgccggctg gatgatcctc 6780 cagcgcgggg atctcatgct ggagttcttc gcccacccca acttgtttat tgcagcttat 6840 aatggttaca aataaagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg 6900 cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatgtctg tataccgtcg 6960 acctctagct agagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat 7020 ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc 7080 taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga 7140 aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 7200 attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 7260 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 7320 gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg 7380 ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca 7440 agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc 7500 tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc 7560 ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag 7620 gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc 7680 ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca 7740 gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg 7800 aagtggtggc ctaactacgg ctacactaga agaacagtat ttggtatctg cgctctgctg 7860 aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct 7920 ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 7980 gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 8040 gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 8100 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 8160 ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 8220 ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 8280 atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 8340 ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 8400 tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 8460 attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 8520 tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 8580 ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 8640 gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 8700 gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 8760 gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 8820 aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 8880 taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 8940 tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 9000 tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 9060 atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 9120 tttccccgaa aagtgccacc tgac 9144

Claims

1. A method for preparing a recombinant cell, comprising the following steps: integrating a DNA molecule named DNA molecule A into the COL1A1 gene locus of the genomic DNA of a porcine cell to obtain a recombinant cell; the DNA molecule A is as shown by the nucleotides at positions 881-10549 in SEQ ID NO: 14; The implementation method of "integrating the DNA molecule named DNA molecule A into the genomic DNA of porcine cells" is to co-import a recombinant plasmid with DNA molecule B and two auxiliary plasmids into porcine cells; DNA molecule B is as shown by the nucleotides at positions 9-11276 in SEQ ID NO: 14; the two auxiliary plasmids are the sgRNA plasmid and the Cas9 plasmid; the sgRNA plasmid transcribes specific sgRNA; the specific sgRNA is sgRNA COL1A1-g3 ; sgRNA COL1A1-g3 The target sequence binding region of is as shown by the nucleotides at positions 1-20 in SEQ ID NO: 13; the Cas9 plasmid expresses the Cas9 protein.

2. A kit, comprising a recombinant plasmid having the DNA molecule B described in claim 1, an sgRNA plasmid, and a Cas9 plasmid; the sgRNA plasmid is the sgRNA plasmid described in claim 1; the Cas9 plasmid is the Cas9 plasmid described in claim 1; The uses of the kit are as follows (a) or (b) or (c): (a) preparing a recombinant cell; (b) preparing a SARS-CoV-2 susceptible model pig; (c) preparing a SARS-CoV-2 susceptible porcine cell model or a SARS-CoV-2 susceptible porcine tissue model or a SARS-CoV-2 susceptible porcine organ model.

3. The application of a recombinant plasmid having the DNA molecule B described in claim 1, an sgRNA plasmid, and a Cas9 plasmid in the preparation of a kit; the sgRNA plasmid is the sgRNA plasmid described in claim 1; the Cas9 plasmid is the Cas9 plasmid described in claim 1; the uses of the kit are as follows (a) or (b) or (c): (a) preparing a recombinant cell; (b) preparing a SARS-CoV-2 susceptible model pig; (c) preparing a SARS-CoV-2 susceptible porcine cell model or a SARS-CoV-2 susceptible porcine tissue model or a SARS-CoV-2 susceptible porcine organ model.

4. The application of the kit described in claim 2 is as follows (a) or (b) or (c): (a) preparing a recombinant cell; (b) preparing a SARS-CoV-2 susceptible model pig; (c) preparing a SARS-CoV-2 susceptible porcine cell model or a SARS-CoV-2 susceptible porcine tissue model or a SARS-CoV-2 susceptible porcine organ model.

5. The application of the recombinant cell prepared by the method described in claim 1 in the preparation of a SARS-CoV-2 susceptible model pig.

6. The application of a recombinant cell, a porcine cell of a SARS-CoV-2 susceptible model pig prepared from the recombinant cell, a porcine tissue of a SARS-CoV-2 susceptible model pig prepared from the recombinant cell, a porcine organ of a SARS-CoV-2 susceptible model pig prepared from the recombinant cell, or a SARS-CoV-2 susceptible model pig prepared from the recombinant cell is as follows (d1) or (d2) or (d3): (d1) screening drugs and / or vaccines and / or antibodies for the treatment of COVID-19 infection; (d2) evaluating the efficacy of drugs and / or vaccines and / or antibodies for the treatment of COVID-19 infection; (d3) studying the pathogenesis of COVID-19 infection; The recombinant cell is the recombinant cell prepared by the method described in claim 1.

Images