Application of apple transcription factor MdWRKY31 in maintaining postharvest fruit quality

Abstract

The invention discloses the application of apple transcription factor MdWRKY31 in maintaining the quality of fruits after harvest, and belongs to the technical field of fruit and vegetable preservation technology and genetic engineering breeding. The invention separates a WRKY transcription factor MdWRKY31 from apple, and proves that the MdWRKY31 gene can increase the malic acid content of apple fruit through MdWRKY31 transgenic plants and fruit transient expression systems. Therefore, the apple transcription factor MdWRKY31 can be applied to the fields of maintaining the quality of fruits after harvest and breeding for quality improvement.

Description

Technical Field

[0001] The invention relates to the fields of fruit and vegetable preservation technology and genetic engineering breeding, and in particular to application of apple transcription factor MdWRKY31 in quality improvement breeding in post-harvest fruit quality maintenance. Background Art

[0002] With the continuous improvement of living standards and consumption capacity, people's consumption concept has gradually changed from "eating enough" to "eating well", and fresh and high-quality fruits are deeply loved by everyone. Due to factors such as origin, season, and benefits, many fruits cannot reach consumers in time, while fruits with strong storage resistance, such as apples, have long-term storage capacity. Storage solves the problem of seasonal sales and can greatly improve the benefits of fruits, but there are also many risks, such as flavor loss, taste loss, and increased diseases. There are three main reasons for post-harvest storage losses: first, mechanical damage during picking and transportation accelerates the aging process of fruits and the possibility of invasion by pathogenic microorganisms; second, mature fruits are rich in nutrients and separated from the mother body, so their disease resistance is very weak and they are more susceptible to invasion by pathogenic microorganisms; third, the physiological aging of the fruit itself. The fruit is still an organic life after picking. As the storage time increases, it continuously consumes organic components such as sugar and acid, which eventually leads to a lighter flavor. According to statistics, 20% to 25% of the total fruit has lost its edible value due to rot and deterioration (Pan Siming, 2018). This not only reduces the income of fruit producers, but is also a huge waste for national agricultural production.

[0003] Apple (Malus domestica) is rich in nutrition and has strong environmental adaptability. Its cultivation area and output are among the highest in China and abroad. Due to its good storage resistance and long market supply cycle, the post-harvest storage and preservation of apples also plays a vital role in the development of the apple industry. At present, the most widely used storage technologies for apple preservation are refrigeration, controlled atmosphere storage, and the application of preservatives (such as 1-MCP). The application of these technologies has greatly extended the storage time of apples. However, as the storage time increases, the flavor becomes lighter and the taste deteriorates. To extend the shelf life while maintaining the quality, we must not only start with storage technology, but also improve the preservation ability of apples themselves. It is crucial to develop varieties with good storage resistance and strong quality retention ability.

[0004] Organic acids can promote digestion and improve appetite, and are an indispensable flavor in people's lives. Sweetness and sourness are important indicators of apple quality. Different apple varieties have their own unique flavors due to different sugar and acid content and ratios (Guo Yan, 2012). Malic acid is the main organic acid in apples. Its sour taste is refreshing and lasts for a long time. It has a great influence on the formation of apple sugar and acid flavor. In apple processing and utilization, concentrated juice is one of the main processing forms. Internationally, high acidity is the basic requirement for apple concentrated juice, while Gala and Fuji cultivated in China have low acidity (Zhang Xiaocai, 2013). The processed apple concentrated juice does not meet international standards and lacks market competitiveness, which hinders the development of the apple industry. In addition, organic acids reduce the pH of apple fruits, which is not conducive to the reproduction of pathogenic microorganisms. While maintaining the flavor, it increases the storage time. However, studies in recent years have shown that malic acid gradually degrades during the storage process of apples after harvest, and once the apple acidity drops to a certain threshold, the storage performance of apples is significantly reduced. Therefore, the industry urgently needs to cultivate high-acid or post-harvest resistant apple varieties.

[0005] Apple is a perennial woody plant. Conventional breeding has a long breeding cycle. Genetic engineering breeding and molecular marker-assisted breeding can greatly shorten the breeding cycle. WRKY family transcription factors play an important role in resisting pathogenic microorganisms. On the other hand, WRKY family transcription factors are also involved in regulating fruit quality-related traits such as sugar (Huang et al., 2021), anthocyanins and flavonoids (Wang et al., 2018), but their function in regulating malic acid accumulation has not been reported. Summary of the invention

[0006] In view of the above-mentioned prior art, the purpose of the present invention is to provide an application of apple transcription factor MdWRKY31 in maintaining the quality of fruits after harvest. The present invention isolates a WRKY transcription factor MdWRKY31 from apples, and proves that the MdWRKY31 gene can increase the malic acid content of apples through MdWRKY31 transgenic plants and fruit transient expression systems. Therefore, the apple transcription factor MdWRKY31 can be applied to the fields of post-harvest fruit preservation and quality improvement breeding.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] The first aspect of the present invention provides an application of the apple transcription factor MdWRKY31 in any one of the following (1)-(2):

[0009] (1) Increase V-ATPase hydrolase activity and H + transporter enzyme activity;

[0010] (2) Increase the malic acid content in the fruit;

[0011] The amino acid sequence of the apple transcription factor MdWRKY31 is as shown in the NCBI database ( https: / / www.ncbi.nlm.nih.gov / , amino acid sequence ID: XP_008364089.2); the nucleotide sequence is shown in the NCBI database (https: / / www.ncbi.nlm.nih.gov / , nucleotide sequence ID: XM_008365867.3).

[0012] The second aspect of the present invention provides the use of a gene encoding apple transcription factor MdWRKY31 in any one of the following (1)-(2):

[0013] (1) Increase V-ATPase hydrolase activity and H + transporter enzyme activity;

[0014] (2) Increase the malic acid content in the fruit;

[0015] In the above application, the apple transcription factor MdWRKY31 or its encoding gene is used as the target. By overexpressing the MdWRKY31 encoding gene or increasing the expression level or activity of the apple transcription factor MdWRKY31, the V-ATPase hydrolase activity and H + Transport enzyme activity promotes the accumulation of malic acid in the fruit, thereby maintaining the taste of the fruit after harvest and is beneficial to maintaining the quality of the fruit after harvest.

[0016] The third aspect of the present invention provides the use of a recombinant expression vector, a transgenic cell line or an engineered bacterium containing a gene encoding the apple transcription factor MdWRKY31 in regulating the accumulation of malic acid.

[0017] A fourth aspect of the present invention provides a method for increasing the accumulation of malic acid in apple fruit, comprising the step of overexpressing a gene encoding the transcription factor MdWRKY31 in apple.

[0018] In the above method, the overexpression of the gene encoding the transcription factor MdWRKY31 in apple can be achieved by exogenously introducing the gene encoding the transcription factor MdWRKY31; or by upregulating the expression of the gene encoding the transcription factor MdWRKY31 in the apple genome.

[0019] A fifth aspect of the present invention provides a method for cultivating transgenic apples with increased malic acid content in the fruit, comprising the following steps:

[0020] The coding gene of the transcription factor MdWRKY31 is transferred into a wild apple plant to overexpress the coding gene of the transcription factor MdWRKY31, thereby obtaining a transgenic apple plant; the content of malic acid in the fruit of the transgenic apple plant is higher than that of the wild apple plant.

[0021] In the above-mentioned cultivation method, the method for transferring the coding gene of the transcription factor MdWRKY31 into the wild apple plant includes: polyethylene glycol method, Agrobacterium-mediated method or gene gun bombardment method.

[0022] Beneficial effects of the present invention:

[0023] (1) The present invention is helpful to clarify the mechanism of action of apple WRKY gene in regulating malic acid accumulation from the molecular mechanism, and provide a theoretical basis and gene resources for apple molecular assisted breeding and genetic engineering breeding.

[0024] (2) MdWRKY31 can guide the quality maintenance of apple fruit during postharvest storage. By detecting the expression level and protein changes of MdWRKY31 gene, we can determine whether the apple variety is suitable for long-term storage, reduce storage losses, and improve production efficiency.

[0025] (3) Genetic engineering can be used to introduce the MdWRKY31 gene into apple varieties with poor storability, thereby improving apple varieties and enhancing storability in a short period of time. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 :MdWRKY31 enhances the accumulation of malic acid in apple fruit.

[0027] The transient expression system showed that compared with the TRV control, silencing the MdWRKY31 gene reduced the malic acid content, and at the same time, the V-ATPase hydrolysis activity, proton pump activity, and V-PPase activity were also reduced (vacuolar proton pumps V-ATPase and V-PPase establish transmembrane electrochemical potential gradients inside and outside the vacuole, drive protons to pump into the vacuole, acidify the vacuole, and provide energy for malic acid transporters, so that malic acid accumulates in the vacuole), indicating that silencing the MdWRKY31 gene is not conducive to malic acid accumulation; while overexpression of MdWRKY31 has the opposite result. The above shows that MdWRKY31 positively regulates the accumulation of malic acid in apple fruit.

[0028] Figure 2 : MdWRKY31 promotes malic acid accumulation in transgenic apple seedlings.

[0029] Using the overexpression vector MdWRKY31-pRI101, we obtained apple plants stably transformed with the MdWRKY31 gene. Compared with the wild type, the expression level of the MdWRKY31 gene in the MdWRKY31 transgenic plants was significantly increased, and the malic acid content in the leaves was also significantly increased, indicating that MdWRKY31 promotes the accumulation of malic acid in apple plants. DETAILED DESCRIPTION

[0030] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0031] As mentioned above, malic acid is the main organic acid in apple fruit. Organic acids participate in various metabolic processes of the fruit itself and are one of the important factors affecting the flavor quality and processing quality of the fruit. Therefore, revealing the regulatory mechanism of organic acids in apple fruit is of great significance for improving and enhancing the quality of the fruit. However, there are few reports on the relevant research on the regulation of WRKY transcription factors in malic acid.

[0032] MdWRKY31 is a member of the WRKY transcription factor family, and its amino acid sequence is shown in SEQ ID NO.1 and is recorded in the NCBI database ( https: / / www.ncbi.nlm.nih.gov / ), amino acid sequence ID: XP_008364089.2. The details are as follows:

[0033] .(SEQ ID NO.1)

[0034] At present, the research on the function of MdWRKY31 is mainly as follows: MdWRKY31 interacts with MdHIR4 to inhibit the function of MdHIR4, thereby improving apple ring rot resistance ("Functional identification and mechanistic analysis of three apple WRKY transcription factors in ring rot resistance", doctoral dissertation of Northwest Agriculture and Forestry University, 2019). However, there are no reports on the role of MdWRKY31 in regulating malic acid accumulation.

[0035] Based on this, the present invention conducted in-depth research and isolated and cloned the WRKY transcription factor MdWRKY31 from Gala apple fruit. The open reading frame (ORF) of the gene is 1821 bp, the predicted protein molecular weight is about 65.35 kDa, and the isoelectric point is 7.67.

[0036] In order to study the function of WRKY transcription factor MdWRKY31, the present invention constructed an overexpression vector and a transient expression system vector of gene MdWRKY31.

[0037] The construction of the gene overexpression vector is as follows:

[0038] The forward primer and reverse primer of MdWRKY31 were designed, and then the gene sequence was cloned from the cDNA of Gala. The double restriction sites of SmaⅠ and KpnⅠ were used to construct the plant overexpression vector pRI101 to form the fusion plasmid MdWRKY31-pRI101, which was then transformed into Agrobacterium tumefaciens LBA4404 by freeze-thaw method. The primer sequences are as follows:

[0039] MdWRKY31(SmaⅠ)-F:CCCGGGATGGACAAAGGATGGGGGCT(SEQ ID NO.2)

[0040] MdWRKY31(KpnⅠ)-R:GGTACCATTTCCCGGGAAGCTGCT(SEQ ID NO.3)

[0041] The construction of the transient expression system vector is as follows:

[0042] The 200-400bp fragment of the non-conserved region of the cDNA of the gene was selected as the specific fragment, and its sequence is shown in SEQ ID NO.4. Then, using the double restriction sites of BamHⅠ and SmaⅠ, SEQ ID NO.3 was constructed into the viral silencing vector TRV2 to complete the construction of the MdWRKY31-TRV2 recombinant plasmid, and then transformed into Agrobacterium tumefaciens LBA4404 by freeze-thaw method; the full-length cDNA of the gene was constructed into the transient overexpression vector IL60-2 using the double restriction sites of HindⅢ and XbaⅠ, and the MdWRKY31-IL60-2 recombinant plasmid was constructed, and then transformed into Agrobacterium tumefaciens LBA4404 by freeze-thaw method. The primer sequences are as follows:

[0043] SEQ ID NO.4:

[0044] ATGGACAAAGGATGGGGGCTCACTCTTGATTCTGACTCCTTCGGCTACCTCCTCAACAAGCCGCCCACCGCCGCGGTTAAGCTCGACCACCACAACAAGAGAAGCAGTTTTTTTGGTGGGGAAAGGATGTTCCAGGGAATGGAATTCCCCGTCAAACTTGGCCGCCGGGAAGAGC AGGATGCATCACAGCCGTCCAATGACAACAACCGGATGGTTGTGGATGAGGTGGACTTCTTTTCCGATCGTAAGAACAAGCTCAATACCAATAGTACTGATGACCATCATCAGGATTCGAAATCCAATGGTGCAGTCAGTGTCAAGAAGGAGAATTGGACTGGTTTGGATGTTAATAC

[0045] MdWRKY31-TRV2(BamHⅠ)-F:GGATCCATGGACAAAGGATGGG(SEQ ID NO.5)

[0046] MdWRKY31-TRV2(SmaⅠ)-R:CCCGGGGTATTAACATCCAAACCAGTCC(SEQ ID NO.6)

[0047] MdWRKY31-IL60-2(HindⅢ)-F: AAGCTTATGGACAAAGGATGGGGGCT (SEQ ID NO.7)

[0048] MdWRKY31-IL60-2(XbaⅠ)-R:TCTAGAATTTCCCGGGAAGCTGCT(SEQ ID NO.8)

[0049] The transient expression system was used to prove that the MdWRKY31 gene can promote the accumulation of malic acid in apple fruit.

[0050] The stable genetic transformation of apple seedlings with this gene demonstrated that the MdWRKY31 gene can promote the accumulation of malic acid in apple plant leaves.

[0051] The discovery of the MdWRKY31 gene can not only provide a new candidate gene for maintaining the quality of apple fruit after harvest, but also provide a theoretical basis for the study of the postharvest preservation function of other fleshy fruits.

[0052] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0053] The experimental materials used in the embodiments of the present invention are all conventional experimental materials in the field and can be purchased through commercial channels; the vectors pRI101, IL60-2, IL60-1, TRV2 and TRV1 used in the present invention were purchased from Shanghai Yueyoubao Biotechnology Co., Ltd., and were propagated in large quantities in this laboratory and stored in a -80°C ultra-low temperature refrigerator in the form of glycerol bacteria for a long time for subsequent use.

[0054] Example 1: Cloning of the full-length apple MdWRKY31 gene and vector construction

[0055] (I) RNA extraction and reverse transcription from Gala leaves and apple fruits

[0056] 1. Plant Total RNA Extraction

[0057] The total RNA content of apple leaf and apple fruit samples was extracted using RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., Beijing), and the specific steps are as follows:

[0058] 1) Homogenization: 50-100 mg of plant leaves or fruit pulp are quickly ground into powder in liquid nitrogen, 500 μL of lysis buffer SL is added (please check whether β-mercaptoethanol has been added before use), and the mixture is immediately vortexed and shaken vigorously to mix.

[0059] 2) Centrifuge at 12,000 rpm (~13,400×g) for 2 min.

[0060] 3) Transfer the supernatant to the filter column CS (the filter column CS is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 2 min, and carefully pipette the supernatant in the collection tube into a new RNase-Free centrifuge tube, trying to avoid the pipette tip from contacting the cell debris precipitate in the collection tube.

[0061] 4) Slowly add 0.4 times the volume of the supernatant anhydrous ethanol, mix well (precipitate may appear at this time), transfer the resulting solution and precipitate into the adsorption column CR3, centrifuge at 12,000 rpm (~13,400×g) for 15 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0062] 5) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm (~13,400×g) for 15 sec, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0063] 6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and put it into a new RNase-Free centrifuge tube, add 70 μL of RDD buffer and mix gently.

[0064] 7) Add 80 μL of DNase I working solution to the center of adsorption column CR3 and leave at room temperature for 15 minutes.

[0065] 8) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm (~13,400×g) for 15 sec, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0066] 9) Add 500 μL of rinse solution RW to the adsorption column CR3 (please check whether ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 15 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0067] 10) Repeat step 9.

[0068] 11) Centrifuge at 12,000 rpm (~13,400 × g) for 2 min, place the adsorption column CR3 in a new RNase-Free centrifuge tube, add 30-50 μL RNase-Free ddH2O to the middle part of the adsorption membrane, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm (~13,400 × g) for 1 min to obtain RNA solution.

[0069] The samples were stored in a -80°C refrigerator and the integrity of RNA was checked by agarose gel electrophoresis before storage.

[0070] 2. RNA reverse transcription into cDNA (for qRT-PCR)

[0071] The apple leaf and fruit samples were reverse transcribed using the Evo M-MLV reverse transcription premix kit (Aicore Biotechnology Co., Ltd., Hunan). The reverse transcription products can only be used for qRT-PCR. The specific steps are as follows:

[0072] 1) Remove genomic DNA. Prepare the reaction solution according to the table below and perform the genomic DNA removal reaction.

[0073]

[0074] Reaction conditions: 42℃ for 2min, then stored at 4℃

[0075] 2) Reverse transcription reaction: Prepare RNA template solution and place it in a PCR instrument for denaturation and annealing reaction.

[0076]

[0077] Reaction conditions: 37°C for 15 min, then 85°C for 5 sec, and finally stored at -20°C.

[0078] Obtain reverse transcription products for qRT-PCR.

[0079] 3. Reverse transcription of RNA into cDNA (for gene cloning)

[0080] Using PrimeScript TM II 1st Strand cDNA Synthesis Kit (Takara Biotech Co., Ltd., Dalian) was used to reverse transcribe Gala leaf RNA. The specific steps of the 1st Strand cDNA synthesis reaction are as follows:

[0081] 1) Prepare the following reaction mixture in a Microtube.

[0082]

[0083] 2) Keep at 65℃ for 5 min and then cool rapidly on ice.

[0084] Note: The above treatment can denature the template RNA and improve the efficiency of reverse transcription.

[0085] 3) Prepare the following reverse transcription reaction solution in the above Microtube, with a total volume of 20 μL.

[0086]

[0087] 4) Mix slowly.

[0088] 5) Perform reverse transcription reaction under the following conditions: 30°C for 10 min; then 50°C for 60 min.

[0089] 6) React at 95°C for 5 min, inactivate the enzyme, cool on ice, and store the obtained reverse transcribed cDNA template at -20°C.

[0090] (II) Cloning of the full-length MdWRKY31 gene

[0091] Using the cDNA of 3 in step (i) of Example 1 as a template, the upstream and downstream gene primers of MdWRKY31 shown in SEQ ID NO. 2 and SEQ ID NO. 3 were amplified using TransTaq DNA Polymerase High Fidelity (HiFi) (Quanshijin Biotechnology Co., Ltd., Beijing) high-fidelity enzyme.

[0092] The amplification steps are as follows:

[0093] 1) 50 μl PCR system

[0094]

[0095]

[0096] 2) PCR reaction program: pre-denaturation at 95°C for 5 minutes; cycle parameters: denaturation at 95°C for 40 seconds, annealing at 56°C for 40 seconds, extension at 72°C for 90 seconds, for 34 cycles; full extension at 72°C for 10 minutes.

[0097] After the PCR reaction, the PCR product was recovered, connected to the cloning vector pMD18-T, transformed into Escherichia coli DH5α, and spread on LB solid medium with 50 mg / L ampicillin, cultured at 37°C overnight, and single colonies were selected and sent to Shanghai Bioengineering Co., Ltd. for sequencing. The plasmid was extracted from the single colony with correct sequencing to determine the full-length cDNA sequence of the MdWRKY31 gene.

[0098] (III) Construction of MdWRKY31 gene-related vector

[0099] The full-length cDNA sequence of the MdWRKY31 gene obtained in step (ii) of Example 1 was amplified using primer sequences of SEQ ID NO.2 and SEQ ID NO.3 with SmaⅠ and KpnⅠ restriction sites, respectively, and ligated to the cloning vector pMD18-T according to the gene cloning method in step (ii) of Example 1 to obtain the fusion plasmid MdWRKY31-pMD18-T (SmaⅠ, Kpn Ⅰ).

[0100] Then, the empty vector pRI101 and MdWRKY31-pMD18-T (Sma Ⅰ, Kpn Ⅰ) were digested with restriction endonucleases Sma Ⅰ and Kpn Ⅰ, respectively, subjected to agarose gel electrophoresis, gel recovery, and the linear pRI101 vector and the target gene MdWRKY31 fragment were connected with T4 DNA ligase and transformed into Escherichia coli DH5α. The fusion plasmid MdWRKY31-pRI101 was extracted from the single colonies with correct sequencing.

[0101] Similarly, the full-length cDNA sequence of MdWRKY31 was constructed on the transient overexpression vector IL60-2 using primers with HindⅢ and Xba Ⅰ restriction sites SEQ ID NO.7 and SEQ ID NO.8, respectively, to form the MdWRKY31-IL60-2 recombinant plasmid; SEQ ID NO.4 was constructed on the viral silencing vector TRV2 using primers with BamH Ⅰ and Sma Ⅰ restriction sites SEQ ID NO.5 and SEQ ID NO.6, respectively, to complete the construction of the MdWRKY31-TRV2 recombinant plasmid.

[0102] The above three recombinant plasmids were transferred into LBA4404 Agrobacterium by freeze-thaw method.

[0103] Example 2: Transient transformation of apple fruit with MdWRKY31 gene

[0104] 1) Prepare injection solution. Activate LBA4404 Agrobacterium containing MdWRKY31-TRV2, TRV2, TRV1 (auxiliary expression vector of TRV2), MdWRKY31-IL60-2, IL60-2, IL60-1 (auxiliary expression vector of IL60-2), collect the cells, and resuspend them in MMA solution (containing 10 mM MgCl2, 10 mM MES, 150 μM acetosyringone) to an OD of 5. 600 =0.6, mix the bacteria well, and then let it stand in a dark incubator at 28°C for 2-4 hours.

[0105] 2) Mixing. Four treatments were set up, namely MdWRKY31-TRV (MdWRKY31-TRV2 and TRV1 were mixed in a volume ratio of 1:1); TRV (TRV2 and TRV1 were mixed in a volume ratio of 1:1); MdWRKY31-IL60 (MdWRKY31-IL60-2 and IL60-2 were mixed in a volume ratio of 1:1); IL60 (IL60-2 and IL60-1 were mixed in a volume ratio of 1:1).

[0106] 3) Injection. Before injection, the bagged Fuji apples were unbagged and injected with a 1 ml medical syringe. Four evenly distributed points were selected along the equator of the apples. The injection depth was 5 mm, and 50 μL of bacterial solution was used in each hole. The injected apples were placed in an incubator with a photoperiod of 8 h dark / 16 h light, a light intensity of 8000 lx, and 25°C.

[0107] 4) Determination of malic acid. After the above injected apple fruits were placed for 6-8 days, samples of the injection site were taken and quickly frozen in liquid nitrogen for the purpose of testing malic acid content, gene expression, vacuolar proton pump activity and other experiments.

[0108] Example 3: Obtaining stable transgenic seedlings of MdWRKY31

[0109] 1. Infection

[0110] 1) Prepare infection solution. Activate LBA4404 Agrobacterium containing the MdWRKY31-pRI101 vector, collect by centrifugation, and suspend in MS liquid medium to a concentration of OD 600 =0.3-0.5.

[0111] 2) Take the leathery leaves at the top of Gala seedlings that have grown well after 28 days of subculture and make 2-3 cuts vertically to the veins in a clean bench, taking care not to cut through the leaves.

[0112] 3) Infection. Place the cut leaves in the Agrobacterium suspension for 5-8 minutes, remove and blot dry on sterile filter paper, then invert on co-culture medium (MS + TDZ 2.5 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + agar 7.5 g / L + acetosyringone 150 μM, pH 5.8), and incubate in the dark at 25°C for 2 days.

[0113] 4) Delayed culture: After 2 days of co-culture, the cells were placed on delay culture medium (MS + TDZ 2.5 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + agar 7.5 g / L + timentin 250 mg / L, pH 5.8) and cultured in the dark at 25°C for 3 days.

[0114] 5) Selective culture. After delaying the culture for 3 days, the cells were placed on selective culture medium (MS + TDZ 2.5 mg / L + NAA 0.5 mg / L + sucrose 30 g / L + agar 7.5 g / L + timentin 250 mg / L + kanamycin 20 mg / L, pH 5.8), and then cultured in the dark at 25°C for 3-4 weeks until white buds were observed growing from the wound site, and then cultured under light.

[0115] 6) Identification. For the buds that turned from white to green under light, subculture was performed. After two subcultures, DNA was extracted from leaves for identification. The positive seedling lines were retained and the relative expression of the MdWRKY31 gene was detected. Finally, three lines with higher relative expression levels, OVX1, OVX2, and OVX3, were retained.

[0116] 2. Expansion

[0117] The three MdWRKY31 transgenic strains OVX1, OVX2, and OVX3 and the wild-type Gala tissue culture seedlings were propagated on subculture medium (MS+6-BA 0.5 mg / L+NAA 0.1 mg / L+sucrose 30 g / L+agar 7.5 g / L+timentin 250 mg / L, pH 5.8) and placed in a light incubator with a light intensity of 2600 lx, a photoperiod of 16 h light / 8 h dark, and 25°C.

[0118] 3. Rooting and hardening

[0119] The tissue culture seedlings, which were subcultured for 30 days, were transferred to rooting medium (1 / 2MS + IBA 0.6 mg / L + sucrose 20 g / L + agar 7.5 g / L + timentin 250 mg / L, pH 5.8). The seedlings were hardened one month later and planted in square pots of 10×10×8 cm in a constant temperature and humidity growth room with a light intensity of 5000 lx, a photoperiod of 16 h light / 8 h dark, and 25°C.

[0120] Example 4: Identification of relative expression level of MdWRKY31 gene

[0121] At NCBI ( https: / / www.ncbi.nlm.nih.gov / ) website designed by MdWRKY31 The relative quantification primer sequences are as follows:

[0122] MdWRKY31-qRT-F:CCGTCCAATGACAACAACCG(SEQ ID NO.9)

[0123] MdWRKY31-qRT-R:TCCCATCGTCAACCATCGAC(SEQ ID NO.10)

[0124] The 18S gene was used as the internal reference gene, and its relative quantitative primers are as follows:

[0125] 18S-F:AGGCGCGAAATTACCAATCC(SEQ ID NO.11)

[0126] 18S-R:GCCCTCCAATTGTTCCTCGTTAAG(SEQ ID NO.12)

[0127] qRT-PCR was performed using the SYRB kit UltraSYBR Mixtures (high ROX) (CWBIO, Beijing, China) according to the instructions of the kit. The 20 μL reaction system included: 10 μL 2×SYRB, 1 μL cDNA, 7 μL ddH2O, 1 μL forward primer, and 1 μL reverse primer. PCR was performed using the qRT-PCR instrument Bio-Rad IQ5 (Hercules, CA, USA). The PCR reaction program was: 95°C, pre-denaturation for 3 minutes; 95°C, denaturation for 15 seconds, 60°C, annealing for 15 seconds, 72°C, extension for 30 seconds, and 40 cycles. Each sample was repeated 3 times, and the average Ct value of each sample was calculated by calculating 2- △△ Ct was used to obtain the relative expression level of the MdWRKY31 gene.

[0128] Figure 1 The analysis results showed that injection of MdWRKY31-IL60 into Fuji apple fruit could increase the expression level of the MdWRKY31 gene, while MdWRKY31-TRV could reduce the expression level of the MdWRKY31 gene. Figure 2 The results showed that MdWRKY31-pRI101 could increase the expression of MdWRKY31 gene in transgenic apple seedlings. The vectors involved here are of great significance in studying the function of MdWRKY31 gene, and these recombinant plasmids can also be directly involved in the application of post-harvest quality maintenance of apples.

[0129] Example 5: Determination and analysis of malic acid

[0130] 1. Malic acid determination

[0131] 1) Weigh 1 g of plant tissue material.

[0132] 2) Add 2 mL of 80% methanol, grind thoroughly, transfer to a 50 mL centrifuge tube, and adjust the volume to 15 mL.

[0133] 3) Extract at 75°C for 30 min.

[0134] 4) Centrifuge at 5000 rpm for 10 min.

[0135] 5) Transfer the supernatant to a new 50 mL centrifuge tube.

[0136] 6) Dry at 60℃ (about 1-2 days) and add 5mL ddH2O to make up to volume.

[0137] 7) After filtering with a 0.45 μm microfilter, the malic acid content was detected by HPLC.

[0138] 2. Results Analysis

[0139] The MdWRKY31 gene was expressed in Fuji apples using a transient vector system. The results showed that the malic acid concentration in the MdWRKY31-TRV treatment was lower than that in the TRV treatment, and the malic acid concentration in the MdWRKY31-IL60 treatment was higher than that in the IL60 treatment, indicating that the MdWRKY31 protein promoted the accumulation of malic acid in Fuji fruit ( Figure 1 By measuring the malic acid content of leaves of three MdWRKY31 overexpressing transgenic apple seedling lines, it was found that they all had higher malic acid content than wild-type Gala leaves, further demonstrating that MdWRKY31 protein promotes malic acid accumulation in apples ( Figure 2 The sugar-acid ratio in the fruit is an important component of apple flavor, so MdWRKY31 is important in maintaining the taste of apple fruit after harvest.

[0140] Example 6: Transient transformation of V-ATPase hydrolase activity and H in apple fruit + Analysis of transporter activity

[0141] 1. Extraction of Tonoplast

[0142] 1) Take 10 g of plant tissue material, add 20 mL of extraction buffer, grind and extract on ice. Extraction buffer composition: 0.2% bovine serum albumin (w / v), 1% defatted casein (w / v), 1% PVP (w / v), 5 mM DTT, 5 mM EDTA, 0.25 M glucose, 0.25 M fructose, 1 mM PMSF, 20 mM β-mercaptoethanol, ascorbic acid is used to adjust the pH to 8.2.

[0143] 2) Prepare a 100 μm nylon membrane, filter the extract from the previous step, and retain the supernatant.

[0144] 3) Centrifuge at 8,000g for 20 min.

[0145] 4) The supernatant was centrifuged at 100,000 g for 40 min and the precipitate was retained.

[0146] 5) The precipitate was resuspended in 20 mL of mixed solution and centrifuged at 10,000 g for 40 min. The mixed solution components: 0.3 M sorbitol, 0.2% bovine serum albumin (w / v), 0.5% PVP (w / v), 1 mM EDTA, 0.2 M KCl, 5 mM dithiothreitol, 1 mM PMSF, 25 mM BTP-Mes (pH = 7.5).

[0147] 6) Centrifuge at 100,000 g for 40 min.

[0148] 7) The precipitate was suspended in 0%, 10%, 20%, and 30% sucrose solution, respectively, and centrifuged at 100,000 g for 2 h.

[0149] 8) After stratification, collect the vacuole membrane and resuspend it in 20 ml of washing solution. The washing solution composition: 0.3 mM mannitol, 0.5 mM EDTA, 5 mM DTT, 10 mM BTP-Mes (pH 7.5).

[0150] 9) Centrifuge at 100,000 g for 40 min and save the precipitate.

[0151] 10) The precipitate was suspended in 20 mL of storage solution, snap-frozen in liquid nitrogen, and stored at -80°C. The storage solution formula was 20% glycerol (v / v), 0.5 mM EDTA and 10 mM BTP-Mes (pH = 7.5).

[0152] 2. Determination of proton pump hydrolysis activity

[0153] 1) Carry out the reaction according to the following reaction system:

[0154]

[0155] 2) Incubate in a 37°C water bath for 30 min, and add 2.5 mL of stop solution. The components of the stop solution are as follows: 0.1% SDS, 0.7 mM H2SO4 (specific gravity: 1.84 g / mL), 0.5% (NH4)2MoO4.

[0156] 3) Add 150 μL of 10% Vc (w / v), let stand for 60 min, and take the supernatant for colorimetry at 660 nm.

[0157] 3. Proton Pump H + Determination of transport activity

[0158] The enzymatic reaction was carried out according to the following reaction system:

[0159]

[0160] The reaction was initiated by adding 3 mM MgSO4, and after 4 min of reaction, 5 μM breccitin was added. Under the conditions of Ex=495 nm and Em=530 nm, fluorescence quenching was detected by a fluorescence spectrophotometer.

[0161] 4. Results Analysis

[0162] V-ATPase hydrolysis activity and H + The transport activity was consistent with the changes in malate content. Silencing the expression of the MdWRKY31 gene reduced the V-ATPase hydrolysis activity and H + transport activity, while overexpression of MdWRKY31 had the opposite effect ( Figure 1 ).

[0163] The transport process mainly passes through the malate channel and malate transporter on the vacuole membrane. The vacuolar proton pumps V-ATPase and V-PPase provide energy for transport. The vacuolar proton pump pumps protons into the vacuole to acidify it. Due to the acidic environment in the vacuole, malate will be protonated immediately after crossing the vacuole membrane, effectively capturing malate into the vacuole (Martinoia et al., 2007). V-ATPase hydrolysis activity and H + The transport activity was consistent with the change in malic acid content, indicating that MdWRKY31 protein may also promote malic acid accumulation by affecting proton pump enzyme activity. This fully demonstrates that MdWRKY31 protein positively regulates malic acid accumulation, and this gene is of great significance for maintaining the sour taste of apples after harvest.

[0164] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of apple transcription factor MdWRKY31 protein in the following (1) or (2): (1) Increase the activity of V-ATPase and V-Ppase in apples; (2) Increase the content of malic acid in apple fruit; The amino acid sequence of the apple transcription factor MdWRKY31 protein is shown in SEQ ID NO.

1.

2. Use of the gene encoding the apple transcription factor MdWRKY31 in the following (1) or (2): (1) Increase the activity of V-ATPase and V-Ppase in apples; (2) Increase the content of malic acid in apple fruit; The amino acid sequence of apple transcription factor MdWRKY31 is shown in SEQ ID NO.

1.

3. Use of a recombinant expression vector, transgenic cell line or engineered bacteria containing an apple transcription factor MdWRKY31 encoding gene in regulating malic acid accumulation; characterized in that: The amino acid sequence of the apple transcription factor MdWRKY31 is shown in SEQ ID NO.

1. The accumulation of malic acid is increased by overexpressing the gene encoding the apple transcription factor MdWRKY31.

4. A method for increasing the accumulation of malic acid in apple fruit, characterized in that: include: Steps for overexpressing the gene encoding the transcription factor MdWRKY31 in apple; The amino acid sequence of apple transcription factor MdWRKY31 is shown in SEQ ID NO.

1.

5. The method according to claim 4, characterized in that The method for overexpressing the gene encoding the transcription factor MdWRKY31 in apple comprises: exogenously introducing the gene encoding the transcription factor MdWRKY31; or upregulating the expression of the gene encoding the transcription factor MdWRKY31 in the apple genome.

6. A method for cultivating transgenic apples with increased malic acid content in the fruit, characterized in that: The following steps are involved: The coding gene of the transcription factor MdWRKY31 is transferred into a wild apple plant to overexpress the coding gene of the transcription factor MdWRKY31, thereby obtaining a transgenic apple plant; the content of malic acid in the fruit of the transgenic apple plant is higher than that of the wild apple plant; The amino acid sequence of the transcription factor MdWRKY31 is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that The methods for transferring the coding gene of the transcription factor MdWRKY31 into wild apple plants include: polyethylene glycol method, Agrobacterium-mediated method or gene gun bombardment method.

Images