Molecular markers for improving the selection of low-nicotine tobacco using nic1 locus and its application

Abstract

The present invention discloses a molecular marker for improving the breeding of low-nicotine tobacco using nic1 loci and its application. The application is to detect the genomic DNA of tobacco single plants in the separated population in the hybrid separation offspring after using the main effect regulation mutant loci nic1 of tobacco nicotine synthesis, and to improve the selection efficiency of the chromosome region where the nic1 loci are located to the recurrent parent genetic background through systematic breeding or backcross breeding while retaining the nic1 loci, thereby improving the undesirable agronomic traits of non-recurrent parents, improving the selection efficiency of the genetic background of the offspring tobacco plants, and accelerating the application of the mutant nic1 loci in the breeding of low-nicotine tobacco varieties. The molecular marker of the present invention can be used as a molecular marker-assisted application to improve the selection efficiency of the genetic background reversion of low-nicotine tobacco strains while using the mutant nic1 loci in tobacco quality breeding.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and specifically relates to a method for utilizing tobacco nicotine synthesis main effect regulation mutation site nic1 The application of codominant and dominant molecular markers to improve the genetic background recovery rate of tobacco lines. Background Art

[0002] Cultivated tobacco ( Nicotiana tabacum L.) is an annual herbaceous plant of the Solanaceae family and one of the important economic crops. Nicotine is an important characteristic alkaloid in cultivated tobacco. Depending on the genetic background of tobacco, the nicotine content in tobacco leaves accounts for 90-95% of the total alkaloid content in tobacco leaves. The nicotine content in tobacco leaves is also directly related to the quality and commercial use of tobacco. Compared with traditional cigarettes, the upcoming VLN tobacco products (such as VLN ® King, VLN ® The nicotine content in Menthol King is reduced by about 95%, and it is low in harm, low in tar, and does not cause compensatory smoking. Domestic and foreign tobacco companies and related research institutions are working to use the main regulatory gene sites of nicotine synthesis to NIC1 To regulate the nicotine content of tobacco leaves and reduce the nicotine content in tobacco products, thereby reducing the harm of tobacco to the human body. In addition, a large number of research institutions at home and abroad are using biotechnology methods such as changing tobacco cultivation measures, grafting with different Solanaceae crops, and gene editing to reduce the biosynthesis of tobacco nicotine or the nicotine transport process to achieve the purpose of regulating the nicotine content of tobacco leaves. Since American tobacco products are mixed tobacco, 22nd Century Tobacco Company is also working with North Carolina State University to develop low-nicotine tobacco varieties of burley tobacco, oriental tobacco, and sun-cured tobacco.

[0003] Tobacco mutants with different nicotine content were first discovered in cigars, and later tobacco breeders transferred these mutation sites to different strains of flue-cured tobacco and burley tobacco through hybridization and backcrossing. In burley tobacco, tobacco breeders selected four near isogenic lines (NILs) of burley tobacco nicotine synthesis through anther culture and chromosome doubling technology, named HABurley 21, HIBurley 21, LIBurley21 and LABurley 21. Classical genetic studies on these four materials found that tobacco nicotine content is regulated by two independently inherited dominant loci (named NICOTINE 1 and NICOTINE 2, abbreviated as NILs). NIC1 and NIC2) (Legg, PD,Collins, GB, 1971. Inheritance of per cent total alkaloidsin Nicotiana tabacum L.: II. Genetic effects of two loci in Burley 21 Nicotiana tabacum L.: populations derived from crosses of low alkaloid lineswith burley and flue-cured varieties. J. Hered. 60, 213-217). in, NIC1 The ability of the site to regulate nicotine synthesis is NIC2 According to relevant reports, NIC2 Ethylene response factors ERF (Ethylene Response Factor) transcription factor genes, including NtERF189 , NtERF115 , NtERF179 These transcription factor genes can bind to metabolic enzyme genes in the nicotine synthesis pathway (such as NtPMT2 and NtQPT2 ) promoter region to transcriptionally activate downstream gene expression (Shoji, T., Kajikawa, M., Hashimoto, T., 2010. Clustered transcription factor genes regulate nicotine biosynthesis in tobacco. Plant Cell 22, 3390-3409; Shoji, T., Hashimoto, T., 2012. DNA-binding and transcriptional activation properties of tobacco NIC2 -locus ERF189and related transcription factors. Plant Biotechnology 29, 35-42.). Among them, the mutant type in LA Burley 21 strain nic2 The locus is caused by the loss of the chromosome fragment where it is located (Kajikawa M., Sierro N., Kawaguchi H., et al., 2017. Genomic insights into the evolution of the nicotine biosynthesis pathway in tobacco, Plant Physiology 174, 999-1011.). On the other hand, recent studies have also found that other types of transcription factor (Transcription Factor) family genes are also involved in the transcriptional regulation of tobacco nicotine biosynthesis. For example, the basic Helix-Loop-Helix (bHLH) family transcription factor NtMYC2 , can be with NIC2 Site transcription factors (such as NtERF189 ) are synergistically regulated, and the two can respectively bind to the key metabolic rate-limiting enzyme genes in the nicotine synthesis pathway (such as NtPMT , NtQPT ) promoter to maximize the expression of these genes (Shoji T. and Hashimoto T.2011. Tobacco MYC2 regulates jasmonate-induciblenicotine biosynthesis genes directly and by way of the NIC2 -locus ERF genes, Plant Cell Physiol. 52(6):1117–1130.). On the other hand, tobacco auxin response factor NtARF6 The reduction in tobacco alkaloid content caused by transcription factor overexpression is due to the antagonism between the jasmonic acid pathway and other plant hormone signal transduction pathways (such as ethylene, salicylic acid, and abscisic acid). The inhibition of the jasmonic acid biosynthesis pathway is accompanied by the activation of ethylene, salicylic acid, abscisic acid, and pathogen infection defense responses, thereby antagonizing the secondary metabolic adjustments induced by jasmonic acid and reducing the expression of nicotine synthesis genes in tobacco (Hu et al., 2021. Transcriptomic analysis provides insights into the AUXIN RESPONSE FACTOR 6-mediated repression of nicotinebiosynthesis in tobacco ( Nicotiana tabacum L.), Plant Mol Biol. 107(1-2):21-36.). In addition, it has recently been found that the MYB transcription factor family gene NtMYB305a can bind to tobacco NtPMT1a AT-rich elements in the GAG ​​region of the promoter. At the same time, NtMYB305a also regulates the expression of other nicotine biosynthesis genes in a similar manner, thereby positively regulating the biosynthesis of nicotine in tobacco (Bian et al., 2022. NtMYB305a binds to the jasmonate-responsive GAG ​​region of NtPMT1a promoter to regulate nicotinebiosynthesis. Plant Physiol. 188(1):151-166.). Domestic and foreign scholars have discovered a new ERF in the genomes of flue-cured tobacco (Yunyan 87) and burley tobacco (HABurely 21) using bioinformatics methods. NIC2 -like) gene cluster, whose composition is similar to NIC2 The gene clusters are highly similar (Kajikawa M., Sierro N., Kawaguchi H., et al., 2017. Genomic insights into the evolution of the nicotine biosynthesis pathway in tobacco, Plant Physiology 174, 999-1011; Sui X. et al., 2019. Ethylener response factor NtERF91 positively regulates alkaloidaccumulations in tobacco( Nicotiana tabacum L.), BiochemBiophys Res Commun.517(1):164-171; Sui X. etal., 2020. Unravel the mystery of NIC1 -locus on nicotine biosynthesisregulation in tobacco, BioRxiv). Recently, genetic population mapping and gene function verification have demonstrated the above NIC2-like gene cluster is NIC1 loci, and verified the functions of multiple genes in the cluster (Sui X.et al., 2020. Unravel the mystery of NIC1 -locus on nicotine biosynthesisregulation in tobacco, Biorxiv). At the same time, several NIC1 The SNP (Single Nucleotide Polymorphism) molecular marker of the gene has been patented (PCT / US2018 / 038679). nic1 The reason why the expression of nicotine synthesis genes in mutants is reduced has also been basically clarified. nic1 Two chromosome segments flank the chromosomal region where the gene cluster is located ( nic1 -S and nic1 -B) missing, eventually leading to NIC1 The chromosome where the gene cluster is located undergoes structural variation, thus affecting the normal expression of genes in the gene cluster (Sui X. et al., 2020. Unravel the mystery of NIC1 -locus on nicotinebiosynthesis regulation in tobacco, Biorxiv).

[0004] However, using mutant nic1 Gene clusters are still facing some problems in developing low nicotine tobacco varieties as a common breeding method. According to relevant literature reports, mutant nic1Compared with normal tobacco, the tobacco line (LA Burley 21) has many disadvantages in agronomic traits, such as slow yellowing, difficulty in curing, low yield, and poor quality of flue-cured tobacco leaves (Chaplin, JF, & Burk, LG (1983). Agronomic, chemical, and smoke characteristics of flue-cured tobacco lines with different levels of total alkaloids. CropScience, 75, 133–136. Chaplin, JF, & Weeks, WW (1976). Association between percent total alkaloids and other traits in flue-cured tobacco. CropScience, 16, 416–418.; Legg, PD, Collins, GB, & Littion, CC (1970). Registration of LA Burley 21 tobacco germplasm. CropScience, 10, 212.). Therefore, in the process of breeding low-nicotine tobacco varieties by backcrossing using LAFC53 as germplasm material, it is necessary to retain nic1 At the same time, it is best to retain the chromosome fragments of the recurrent parent in the systematic selection or backcross generation. Therefore, whole genome resequencing technology is used to compare the genome of the recurrent parent (such as NC95 HA) and the non-recurrent parent (LAFC53). nic1 Finding differences in the areas surrounding the chromosome region and developing specific (co-dominant or dominant) molecular markers that can distinguish the differences between the two parental genomes are of great significance for the use of molecular markers to assist in the selection of tobacco varieties with low nicotine content.

[0005] To date, the synthesis of tobacco nicotine NIC1 Although there are reports on the development of molecular markers for loci, the existing research results are all based on nic1 The genetic prospect of the mutant locus is selected, that is, only the mutant loci that cause nic1 Deletion fragments with downregulated gene expression levels within the gene cluster ( nic1 -S and nic1 -B) for marker selection (Sui X. et al., 2020. Unravel the mystery of NIC1-locus on nicotine biosynthesis regulation intobacco, Biorxiv). For example, nic1 The marker reports of gene cluster linkage are dCAPS markers and SSR markers developed based on SNP variant sites. There are some shortcomings in tobacco breeding practice and tobacco leaf production: 1) There are serious limitations on the scope of use, that is, the detection and identification that have been reported and patented nic1 The dCAPS marker of the gene has a narrow application scope and is only applicable to burley tobacco. In addition to burley tobacco, cultivated tobacco also includes flue-cured tobacco, aromatic tobacco, cigar tobacco, air-cured tobacco, sun-cured tobacco and yellow tobacco. The above tobacco types or species cannot be detected and identified by the dCAPS marker. 2) The molecular markers currently developed are only based on nic1 Marker-assisted selection (i.e., prospect selection) of the mutant gene cluster itself, but selection of the genetic background of the recurrent parent or non-recurrent parent (such as LAFC53) is not possible. In the process of using LAFC53 as a non-recurrent parent to breed low-nicotine tobacco varieties through systematic selection or backcrossing, it is impossible to retain the gene to the greatest extent. nic1 While removing the mutant site, the chromosome fragments of the recurrent parent in the backcross generation are retained to the greatest extent, thereby effectively improving the mutant nic1 The agronomic disadvantages of the tobacco non-recurrent parent (LAFC53) (slow yellowing, difficult to cure, low yield, and poor tobacco leaf quality).

[0006] The present invention utilizes two near-isogenic line materials NC95 HA ( NIC1 NIC1 NIC2 NIC2 ) and low nicotine content tobacco material LAFC53 ( nic1 nic1 nic2 nic2 ) were used as experimental materials. The tobacco genome resequencing technology was used to compare the two near-isogenic lines. nic1 The structural variation in the chromosomal region where the locus is located was used to develop specific (co-dominant and dominant) molecular markers that can distinguish the differences between the two parental genomes. By constructing a self-fertilized second-generation (F2) segregating population, the genotype of the selected population was ( nic1 nic1 nic2 nic2 ) individuals, and then keep the individual plants for seed. The individual plant lines kept for seed were subjected to genetic background selection and agronomic trait comparison tests in the F3 generation using specific markers, and low-nicotine tobacco lines with higher genetic background recovery and significantly improved agronomic traits than the non-recurrent parent (LAFC53) in the F3 generation were screened out, accelerating the use of molecular marker-assisted selection (MAS) in the breeding of low-nicotine tobacco varieties, thereby achieving convenient, fast, stable and reliable breeding of tobacco varieties with low nicotine content and high quality. Summary of the invention

[0007] The first object of the present invention is to provide a method for regulating the synthesis of nicotine in tobacco nic1 The second purpose is to provide the main effect regulation of tobacco nicotine synthesis. nic1 Mutant loci are then used to improve the selection efficiency of the genetic background of backcross offspring to improve the non-recurrent parent (carrying the mutant nic1 The adverse agronomic traits of the parent at the locus are accelerated by the mutant nic1 Application of loci in breeding low-nicotine tobacco varieties.

[0008] Utilizing tobacco nicotine synthesis main effect regulatory mutation site nic1 The application of co-dominant and dominant molecular markers that can improve the genetic background recovery rate of tobacco lines is to detect the genomic DNA of tobacco individual plants in tobacco segregation populations in the presence of retained mutants. nic1 While increasing the number of loci, systematic selection or backcross breeding can be used to improve nic1 The chromosomal region where the locus is located is restored to the selection efficiency of the reincarnated parent genetic background, and ultimately the mutant type is effectively improved. nic1 Agronomic disadvantages introduced by non-recurrent tobacco parents.

[0009] A method for utilizing tobacco nicotine synthesis main effect regulation mutation site nic1 The co-dominant and dominant molecular markers of the present invention can detect the main regulatory mutation site of tobacco nicotine synthesis. nic1 The chromosome structural variation produced in the region surrounding the chromosome region, the specific co-dominant molecular markers are numbered as Target1~Target3 and the dominant molecular markers are numbered as Target4~Target6; the nucleotide sequences of the PCR amplification products are shown as SEQ ID No.1 and SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9 respectively; the primer sequences of the six regions corresponding to the specific molecular markers are respectively:

[0010] The Target1 sequence is:

[0011] Target1F: 5'- GACTTATGGCAATTCAAAGATAAGA -3';

[0012] Target1R: 5'- CAGTTTCTGGAAATGTTTGTTAAGT -3';

[0013] The Target2 sequence is:

[0014] Target2F: 5'- AGTTCAACTATTGTTTTCTCGACAT -3';

[0015] Target2R: 5'-ATTTAGGCACTGTTATTACTTGTGG-3';

[0016] The Target3 sequence is:

[0017] Target3F: 5'-GCACCATCCAAACACAAGGTTAAAC -3';

[0018] Target3R: 5'- CCTAATCCTCTTCGAATCTTAAATC -3';

[0019] The Target4 sequence is:

[0020] Target4F: 5'- TACTACTGTGCAGCAGATGATTTAG -3';

[0021] Target4R: 5'- TACCTTGCATATGTTCCTATATGGT -3';

[0022] The Target5 sequence is:

[0023] Target5F: 5'-TTTAAGTCTTGTTTTTCTCCTTGA-3';

[0024] Target5R: 5'-AATCAGTTCCTTCCTCACACTAAC -3';

[0025] The Target6 sequence is:

[0026] Target6F: 5'- AAATTCAGAGAGATTTTTGGAAAGT -3';

[0027] Target6R: 5' - ATAAAGAAGCAGAAATAGGGAAAT -3'.

[0028] The application of the co-dominant and dominant molecular markers of the present invention is to improve the genetic background recovery rate of tobacco lines.

[0029] The above application of the present invention is specifically to detect the presence of genomic DNA of individual tobacco plants in a tobacco separation population. nic1While increasing the number of loci, systematic selection or backcross breeding can be used to improve nic1 The chromosomal region where the locus is located is restored to the selection efficiency of the recurrent parent genetic background, thereby improving the non-recurrent parent (carrying the mutant nic1 The adverse agronomic traits of the locus parents (such as yellowing, low yield, and short plants) are improved to improve the selection efficiency of the genetic background of the offspring tobacco plants and accelerate the mutant nic1 Application of loci in breeding low-nicotine tobacco varieties.

[0030] The application of the present invention is: using primers of Target1 sequence, primers of Target2 sequence, primers of Target3 sequence or primers of Target4 sequence, primers of Target5 sequence and primers of Target6 sequence respectively to amplify tobacco genome DNA to be detected, detecting PCR amplification products, and analyzing according to the amplification product results.

[0031] If the PCR amplification product of the present invention contains three nucleotide sequences as shown in SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 5 at the same time, it means that the tobacco genetic background has the homozygous recurrent parent.

[0032] In the present invention, if the PCR amplification product contains three nucleotide sequences as shown in SEQ ID No. 2, SEQ ID No. 4 and SEQ ID No. 6 at the same time, it is a homozygous mutant. nic1 genetic background of non-recurrent parents.

[0033] If the PCR amplification product results of the present invention contain six nucleotide sequences as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQID No.6 at the same time, the genetic background of the tobacco is heterozygous, that is, the tobacco plant has the genetic background of the recurrent parent and the non-recurrent parent.

[0034] If the PCR amplification product of the present invention contains three nucleotide sequences as shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9 at the same time, it has a heterozygous tobacco genetic background of the recurrent parent or both the recurrent parent and the non-recurrent parent.

[0035] If the PCR amplification product result of the present invention is no PCR amplification product, it means that the gene has a homozygous mutant. nic1 Tobacco plants with the genetic background of the non-recurrent parent.

[0036] In order to simply and efficiently select tobacco varieties with low nicotine content and good agronomic traits, targeted and specific selection of homozygous genotypes nic1 nic1 The offspring material, while replacing the low nicotine parent (carrying nic1 Mutation sites, such as LAFC53 nic1 The present invention provides a method for utilizing tobacco nicotine synthesis main effect regulation mutation site nic1 The co-dominant and dominant molecular markers Target1, Target2, Target3, Target4, Target5 and Target6 were used to improve the genetic background recovery rate of tobacco lines. The molecular markers were analyzed by Tobacco Whole Genome Resequencing. The results were compared with two near-isogenic lines NC95HA ( NIC1 NIC1 NIC2 NIC2 ) and LAFC53 ( nic1 nic1 nic2 nic2 ) in mutant nic1 The structural variation in the chromosome region where the locus is located has been used to develop specific molecular markers that can distinguish the differences in the genomes of the two parents. This molecular marker can be used as an auxiliary means for the breeding of low-nicotine tobacco varieties, so as to use molecular marker-assisted selection to improve the efficiency of genetic background selection of backcross breeding offspring and improve agronomic traits, thereby accelerating the breeding process of low-nicotine tobacco varieties.

[0037] The present invention uses two near-isogenic lines with different nicotine contents as materials: NC95 HA (high nicotine content: NIC1 NIC1 NIC2 NIC2 ) and LAFC53 (low nicotine content: nic1 nic1 nic2 nic2 ) as the parent, the tobacco genome resequencing analysis method was used to analyze the mutant nic1 The chromosome structural variation (SV) in the flanking region of the chromosome is developed and designed to effectively distinguish the specific molecular markers of chromosome fragments from the recurrent parent and the non-recurrent parent (such as NC95 HA and LAFC53). At the same time, through hybridization and self-pollination, the genotypes in the second generation (F2) population of self-pollination can be screened. nic1 nic1 nic2 nic224 individual plants were selected and bagged for seed. After extracting the genomic DNA of each individual plant of the F2 generation, the genetic background of each strain was screened using the developed specific markers. On the other hand, the agronomic traits and statistical analysis of each strain of the 24 self-pollinated individual plants (i.e., F3) were investigated in the field to obtain tobacco strains with significantly improved agronomic traits (one or more) compared with the non-recurrent parents. The results showed that the use of these markers can improve the selection efficiency of molecular marker-assisted selection (MAS) in the breeding of low-nicotine content tobacco varieties.

[0038] The present invention discloses a method for utilizing tobacco nicotine synthesis main effect regulation mutation site nic1 The co-dominant and dominant molecular markers that can improve the genetic background recovery rate of tobacco lines are stable, reliable, simple, fast and low-cost. Therefore, this molecular marker can be used as a mutant in the breeding of low-nicotine tobacco varieties. nic1 Application of molecular markers to improve the selection efficiency of genetic background while adjusting loci. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a mutant of the main regulatory site of tobacco nicotine synthesis nic1 Gel electrophoresis of PCR amplification products of specific molecular markers for detecting chromosomal structural variation in the flanking region of the chromosome in two near-isogenic line materials; among them, co-dominant marker Target1; co-dominant marker Target2; co-dominant marker Target3; dominant marker Target4; dominant marker Target5; dominant marker Target6; LA, low nicotine content parent LAFC53; HA, high nicotine content parent NC95 HA; 1000bp DNA ladder, length fragments are: 100bp, 200bp, 300bp, 400bp, 500bp respectively;

[0040] Figure 2 This is the alkaloid content of four genotypes A_B_, A_bb, aaB_, and aabb in the F2 population of NC95 HA × LAFC53 (where A: NIC1 ; B: NIC2 ; a: nic1 ; b: nic2 ).

[0041] Figure 3 The co-dominant markers Target1, Target2 and Target3 and the dominant markers Target4, Target5 and Target6 were found in 8 F2 generations (genotype nic1 nic1 nic2 nic2) Statistical chart of PCR amplification product bands in each individual strain, where A represents the chromosome fragment derived from the recurrent parent NC95 HA, and B represents the chromosome fragment derived from nic1 The chromosome segment of the non-recurrent parent LAFC53 of the mutant locus;

[0042] Figure 4 It is a statistical analysis chart of the agronomic traits of the F3 tobacco strains obtained from the screened F2 generation plants and the control variety LAFC53, including natural plant height, natural leaves, topping plant height, stem girth, waist leaf length, waist leaf width, effective leaf number, and internode distance. DETAILED DESCRIPTION

[0043] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product instructions. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased.

[0044] The present invention discloses a method for utilizing tobacco nicotine synthesis main effect regulation mutation site nic1 The co-dominant and dominant molecular markers that can improve the genetic background recovery rate of tobacco lines are numbered as Target1, Target2, Target3 Target4, Target5 and Target6, and the nucleotide sequences of their PCR amplification products are shown in SEQ ID No.1 and SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9, respectively.

[0045] The primer sequences of the six sites corresponding to the molecular markers are:

[0046] The Target1 sequence is:

[0047] Target1F: 5'-GACTTATGGCAATTCAAAGATAAGA-3' (SEQID No.1),

[0048] Target1R: 5'-CAGTTTCTGGAAATGTTTGTTAAGT-3' (SEQID No. 2);

[0049] The Target2 sequence is:

[0050] Target2F: 5'-AGTTCAACTATTGTTTTCTCGACAT-3' (SEQ ID No.3),

[0051] Target2R: 5'-ATTTAGGCACTGTTATTACTTGTGG-3' (SEQID No. 4);

[0052] The Target3 sequence is:

[0053] Target3F: 5'-GCACCATCCAAACACAAGGTTAAAC-3' (SEQID No.5),

[0054] Target3R: 5'-CCTAATCCTCTTCGAATCTTAAATC-3' (SEQID No. 6);

[0055] The Target4 sequence is:

[0056] Target4F: 5'-TACTACTGTGCAGCAGATGATTTAG-3' (SEQID No.7),

[0057] Target4R: 5'- TACCTTGCATATGTTCCTATATGGT -3';

[0058] The Target5 sequence is:

[0059] Target5F: 5'-TTTAAGTCTTGTTTTTCTCCTTGA-3' (SEQID No.8),

[0060] Target5R: 5'-AATCAGTTCCTTCCTCACACTAAC -3';

[0061] The Target6 sequence is:

[0062] Target6F: 5'-AAATTCAGAGAGATTTTTGGAAAGT-3' (SEQID No.9),

[0063] Target6R: 5' - ATAAAGAAGCAGAAATAGGGAAAT -3';

[0064] The main regulatory site mutant of tobacco nicotine synthesis according to the present invention nic1The application of specific molecular markers for detecting chromosomal structural variations in the flanking regions of the chromosomes is characterized by detecting whether there is a mutant genotype in tobacco genomic DNA nic1 At the same time, by utilizing systematic breeding and backcross breeding methods, the selection efficiency of tobacco genetic background in breeding offspring can be improved, the field agronomic traits of the selected tobacco plants can be improved, thereby accelerating the application of low nicotine tobacco varieties in breeding.

[0065] The said tobacco nicotine synthesis main effect regulation site mutant nic1 The application of specific molecular markers for detecting chromosomal structural variations in the flanking regions of the chromosomes is to amplify the genomic DNA of the tobacco to be detected using primers of Target1 sequence, primers of Target2 sequence and primers of Target3 sequence respectively, and detect the PCR amplification products. If the PCR amplification products contain three nucleotide sequences as shown in SEQ ID No.1, SEQ ID No.3 and SEQ ID No.5 at the same time, it is a tobacco genetic background with the recurrent parent NC95 HA; if the PCR amplification products contain three nucleotide sequences as shown in SEQ ID No.2, SEQ ID No.4 and SEQID No.6 at the same time, it is a tobacco genetic background with the non-recurrent parent LAFC53 tobacco; if the PCR amplification products contain six nucleotide sequences as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQID No.6 at the same time, the genetic background of the tobacco is a tobacco plant with a heterozygous genetic background of the recurrent parent and the non-recurrent parent. If the Target4 sequence primer, the Target5 sequence primer and the Target6 sequence primer are used to amplify the tobacco genomic DNA to be tested respectively, and the PCR amplification product is detected, if the PCR amplification product contains the three nucleotide sequences shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9 at the same time, it is a tobacco genetic background with homozygous HA of the recurrent parent NC95 or heterozygous HA of the recurrent parent and the non-recurrent parent; if there is no PCR amplification product, it is a tobacco genetic background with homozygous mutant nic1 Tobacco plants with the non-recurrent parent LAFC53 genetic background.

[0066] The present invention is further described below with specific implementation cases:

[0067] Example 1

[0068] Using the tobacco whole genome resequencing method, two near-isogenic lines of high nicotine content tobacco lines NC95HA (genotype NIC1 NIC1 NIC2 NIC2 ) and low nicotine tobacco LAFC53 strain (genotype nic1 nic1 nic2 nic2 ) for deep resequencing. Detection and comparison by sequence read alignment nic1 Whether there is a chromosomal structural variation between the two parents in the flanking region of the chromosome, and obtaining the relevant chromosome fragment sequence information according to the variation type. The visualization of tobacco whole genome resequencing analysis results was performed on the IGV (Integrative Genomics Viewer) software, and the design of relevant specific markers (primers) was completed using the Primer3 online tool (https: / / bioinfo.ut.ee / primer3-0.4.0 / ).

[0069] 1. Experimental Materials

[0070] Two near-isogenic lines of high-nicotine tobacco strain NC95 HA ( NIC1 NIC1 NIC2 NIC2 ) as the female parent, and the low nicotine content tobacco LAFC53 strain ( nic1 nic1 nic2 nic2 ) as the male parent. In 2017, high and low nicotine content parent materials were planted and hybridized to obtain the F1 generation. The hybrid generation (F1) was planted in the winter of 2018 and obtained in early 2019. nic1 , nic2 Genetic segregation population (F2 generation). In 2019, the two parents, F1 and F2 generation materials were planted, and the genotype obtained in the F2 generation material was ( nic1 nic1 nic2 nic2 ) and bagged to obtain F3 strains. In 2021, high and low nicotine content parental materials and F3 strains were planted to obtain field agronomic trait survey data of parents and F3 generations.

[0071] 2. Determination of nicotine content in parental and F2 segregating populations

[0072] After the test materials were grown into seedlings, they were transplanted to the field with a row spacing of 100 cm × 50 cm. Conventional cultivation and field management were adopted. The F2 population was topped after budding. Two weeks after topping, the fresh tobacco leaves of each individual plant were harvested and cured. After harvesting and curing, the leaves of each plant were ground and the nicotine content was measured. The nicotine content data of the leaves of each individual plant in the parent and F2 population were analyzed. The basis for genotype data analysis was: data statistics were performed according to the band type of each individual plant, that is, the individual plant with two loci consistent with the NC95 HA parent band type was recorded as "A_" or "B_"; the individual plant band with two loci consistent with the LAFC53 parent band type was marked as "aa" or "bb", and the band was unclear or there was no amplified band as "U".

[0073] 3. Specific marker design

[0074] Before topping, fresh leaves of each individual plant of the parents and F2 population were collected in the field. The whole genome DNA of the test materials can be extracted by conventional CTAB method or plant tissue DNA extraction kit. The method can refer to existing literature or the instructions in the kit. The preparation of PCR reaction system, product amplification and 2% agarose gel electrophoresis detection of amplified products can refer to Sui et al. (Sui X., Huang Y., et al. 2011, Molecular authentication of anethnomedicinal plant Sabia parviflora and its adulterants by DNA barcoding technique. Planta Medica 2011, 77(5): 492-496.)

[0075] The PCR reaction system is: 30-50ng / µL DNA, 1.0µmol / L forward and reverse primers, 1.5mmol / L dNTPs, 2µL 10× PCR Buffer (Mg 2+ plus), 0.75~1.0 U Q5 High-fidelity DNA polymerase (Q5 ® High-Fidelity DNA Polymerase, NEB), add double distilled water to 20µL.

[0076] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 30 sec, and after 30 cycles, extension at 72°C for another 5 min.

[0077] The gel electrophoresis detection refers to the use of 2% agarose gel, 1×TBE electrophoresis buffer, separation at 100V constant voltage electrophoresis for 45 minutes, and finally development using the ethidium bromide method.

[0078] 4. Based on nic1 Parental verification of site-specific markers for chromosome structural variation

[0079] At the seedling stage, according to the method described in Example 1, the primers designed based on the resequencing data analysis results were used to PCR amplify the NC95 HA ( NIC1 NIC1 NIC2 NIC2 ) and the low-nicotine parent LAFC53 ( nic1 nic1 nic2 nic2 ) PCR amplification of the two materials was performed to screen and verify that the two parents could be distinguished in the mutant type nic1Specific markers (dominant or co-dominant) of the chromosome fragment in the chromosome region where the locus is located. The screening results are as follows Figure 1 As shown: Co-dominant specific markers Target1, Target2 and Target3 can distinguish the two parents in nic1 The chromosome fragments around the chromosome region where the site is located, that is, the banding patterns of markers Target1, Target2 and Target3 in the high-nicotine content parent NC95 HA are completely consistent, with only one specific band of 776bp (sequence such as SEQ ID NO.1), 716bp (sequence such as SEQID NO.3) and 1458bp (sequence such as SEQ ID NO.5) appearing; the banding patterns in the low-nicotine content parent LAFC53 are completely consistent, with only one specific band of 457bp (sequence such as SEQID NO.2), 396bp (sequence such as SEQ ID NO.4) and 420bp (sequence such as SEQID NO.6) appearing. Among them, the lengths of the sequences shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 are 776 bp, 716 bp and 1458 bp respectively, which are the specific PCR amplified nucleotide sequences of the co-dominant specific markers Target1, Target2 and Target3 in the tobacco parent NC95HA with high nicotine content; the lengths of the sequences shown in SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.6 are 457 bp, 369 bp and 420 bp respectively, which are the specific PCR amplified nucleotide sequences of the co-dominant specific markers Target1, Target2 and Target3 in the tobacco parent NC95HA with high nicotine content. nic1 Specific PCR amplified nucleotide sequence of the mutant site in the low nicotine content tobacco parent LAFC53.

[0080] Dominant specific markers Target4, Target5 and Target6 can also distinguish the two parents in nic1The chromosome fragments around the chromosome region where the site is located, that is, the banding patterns of markers Target4, Target5 and Target6 in the high nicotine content parent NC95 HA are completely consistent, with only a specific band of 1051bp (sequence such as SEQ ID NO.7), 675bp (sequence such as SEQIDNO.8) and 1317bp (sequence such as SEQ ID NO.9); while the corresponding specific bands could not be successfully amplified in the low nicotine content parent LAFC53. Among them, the sequence lengths shown in SEQ ID NO.6, SEQ ID NO.7 and SEQID NO.8 are 1051bp, 675bp and 1317bp respectively, which are the specific PCR amplified nucleotide sequences of dominant specific markers Target4, Target5 and Target6 in the high nicotine content tobacco parent NC95 HA; while the dominant specific markers Target4, Target5 and Target6 in the low nicotine content parent LAFC53 nic1 No specific PCR band could be amplified in the low nicotine content tobacco parent LAFC53 at the mutant site.

[0081] The above results show that markers Target1, Target2 and Target3 can distinguish the mutant types of the two parents. nic1 The chromosome fragment of the chromosome region where the site is located, and the marker is a co-dominant marker. If the PCR amplification product contains three nucleotide sequences as shown in SEQ ID No.1 (776bp), SEQ ID No.3 (716bp) and SEQ ID No.5 (1458bp), it is a chromosome fragment with the cyclic parent NC95HA chromosome background; if the PCR amplification product contains three nucleotide sequences as shown in SEQ ID No.2 (457bp), SEQ ID No.4 (396bp) and SEQ ID No.6 (420bp), it is a chromosome fragment with the non-cyclic parent LAFC53 chromosome background; if the PCR amplification product contains six nucleotide sequences as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, it is a heterozygous chromosome fragment with the cyclic parent and the non-cyclic parent.

[0082] At the same time, markers Target4, Target5 and Target6 can also distinguish the mutants of the two parents. nic1The site is located in the chromosome region of the chromosome fragment source, the marker is a dominant marker. If the PCR amplification product contains three nucleotide sequences such as SEQID No.7 (1051bp), SEQID No.8 (675bp) and SEQ ID No.9 (1317bp), it means that it has at least a chromosome fragment from the recurrent parent NC95HA; if the markers Target4, Target5 and Target6 cannot successfully amplify the corresponding specific bands, it means that it has a chromosome fragment from the non-recurrent parent LAFC53. nic1 The segment of the chromosome where the genotype is located.

[0083] Example 2

[0084] Improving the utilization of mutants of the main regulatory sites of nicotine synthesis in tobacco nic1 Specific molecular markers for detecting chromosomal structural variations in the flanking regions of chromosomes are used in molecular marker-assisted selection to improve the efficiency of genetic background selection of backcross breeding offspring and improve agronomic traits and their verification in F3 lines.

[0085] Data analysis

[0086] Tobacco genomic DNA was extracted and purified according to the method described in Example 1, and the nicotine content of the F2 population was determined after topping. NIC1 and NIC2 Second, we used the resequencing method to screen the mutants at the main regulatory sites of tobacco nicotine synthesis. nic1 The specific molecular markers Target1, Target2, Target3, Target4, Target5 and Target6 obtained from the analysis of the chromosome structural variation in the flanking region of the chromosome were used to perform genotyping analysis on 23 plants in the F2 population. Finally, the banding patterns of the selected 8 plants were statistically analyzed, that is, the plants with the same banding pattern as the NC95HA parent were marked as "A"; the bands of the plants with the same banding pattern as the LAFC53 parent were marked as "B".

[0087] The results of nicotine content of individual plants in the F2 population are as follows: among the 377 individual plants, there are 224 plants with genotype A_B_, 36 plants with genotype A_bb, 94 plants with genotype aaB_, and 23 plants with genotype aabb. Figure 2 shown.

[0088] Example 3

[0089] Using mutants of the main regulatory site of tobacco nicotine synthesis nic1Specific molecular markers for detecting chromosomal structural variations in the flanking regions of the chromosomes improve the field agronomic traits of the F3 generation low-nicotine content lines in the hybrid offspring of the parent NC95 HA and the parent LAFC53.

[0090] 1. Experimental Materials

[0091] The markers used are Target1, Target2, Target3, Target4, Target5 and Target6. nic1 Specific molecular markers for detecting chromosomal structural variations in the flanking regions of the chromosomes. The plant material was HA NC95 (genotype NIC1 NIC1 NIC2 NIC2 ), LAFC53 (genotype nic1 nic1 nic2 nic2 ), the genotype in the F2 segregating population (NC95 HA×LAFC53) was nic1 nic1 nic2 nic2 8 individual plants and their corresponding 8 F3 generation lines.

[0092] 2. Data Processing

[0093] First, the tobacco genomic DNA was extracted and purified from the tobacco material according to the method described in Example 1. nic1 The genotype analysis of the above tobacco plants was performed using specific molecular markers for detecting chromosomal structural variations in the flanking regions of the chromosomes. Finally, data analysis was performed on the banding patterns of each plant, that is, the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 that appeared simultaneously in the PCR amplification product were specific PCR amplification nucleotide sequences with a high nicotine content tobacco recurrent parent NC95 HA genetic background; if the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO.6 appeared simultaneously in the PCR amplification product, it was a specific PCR amplification nucleotide sequence with a recurrent parent and a non-recurrent parent (carrying nic1 If the nucleotide sequences shown in SEQ ID NO.2, SEQ ID NO.2 and SEQ ID NO.4 appear simultaneously in the PCR amplification product, it is a heterozygous chromosome fragment containing nic1 Specific PCR amplified nucleotide sequence of the non-recurrent parent LAFC53 genetic background of the mutant site.

[0094] Depend on Figure 3 It can be seen that among the 8 candidate F3 tobacco strains to be tested, the strain NC95 HA × LAFC53 F3-72 is the one that guarantees the low nicotine trait ( nic1 nic1 nic2 nic2) prospects, the strains with the most NC95 HA parental genetic background had no significant differences in agronomic traits from the parent NC95 HA, and the main agronomic traits were greatly improved; while the strain NC95 HA × LAFC53 F3-112 was selected to ensure the low nicotine trait ( nic1 nic1 nic2 nic2 ) prospect, and the lines with the closest genetic background to the parent LAFC53, except for slightly higher stem girth and lower number of effective leaves than the parent LAFC53, had no significant differences in other agronomic traits (such as natural plant height, natural leaf number, and topping plant height) from the parent LAFC53, and the overall agronomic traits were poor; while other F3 lines (such as NC95 HA × LAFC53 F3-112, NC95 HA × LAFC53 F3-12, NC95 HA × LAFC53 F3-151, and NC95 HA × LAFC53 F3-308) nic1 The chromosomal regions around the locus were replaced by chromosome segments of the parent (NC95 HA) to varying degrees (homozygous or heterozygous), and its overall agronomic traits were also improved to varying degrees compared with the parent LAFC53, such as Figure 3 These candidate lines can be further accelerated through systematic breeding to homozygous lines or through backcrossing with the parent NC95HA to accelerate the genetic background selection efficiency of different individual plants in the F3 candidate lines, ultimately improving their agronomic traits and ultimately breeding tobacco varieties with low nicotine content through molecular-assisted selection.

[0095] Conclusion: The above six specific (dominant or co-dominant) markers can be used to detect tobacco in a simple, rapid and stable manner. nic1 The replacement of chromosome fragments around the chromosome where the site is located can clearly identify the homozygous or heterozygous status of chromosome fragments from different parents. At the same time, targeted and specific selection of low-nicotine tobacco intermediate materials with high genetic background recovery rate and greatly improved agronomic traits can greatly improve the breeding efficiency of tobacco varieties with low nicotine content.

[0096] The above are only some specific embodiments of the present invention. The well-known specific contents or common sense in the scheme are not described in detail here (including but not limited to abbreviations, abbreviations, and units commonly used in the art). It should be pointed out that the above embodiments do not limit the present invention in any way. For those skilled in the art, all technical solutions obtained by equivalent replacement or equivalent transformation fall within the protection scope of the present invention. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A method for regulating the main effect of tobacco nicotine synthesis mutation site nic1 Codominant and dominant molecular markers, characterized in that The molecular marker can detect the main regulatory mutation site of tobacco nicotine synthesis nic1 The chromosome structural variation produced in the surrounding areas of the chromosome region, the specific co-dominant molecular markers are numbered as Target1~Target3 and the dominant molecular markers are numbered as Target4~Target6; The molecular markers correspond to The primers for Target1 were: Target1F: 5′-GACTTATGGCAATTCAAAGATAAGA-3′; Target1R: 5′-CAGTTTCTGGAAATGTTTGTTAAGT-3′; Target2 primers were: Target2F: 5′-AGTTCAACTATTGTTTTCTCGACAT-3′; Target2R: 5′-ATTTAGGCACTGTTATTACTTGTGG-3′; Target3 primers were: Target3F: 5′-GCACCATCCAAACACAAGGTTAAAC-3′; Target3R: 5′-CCTAATCCTCTTCGAATCTTAAATC-3′; The primers for Target4 were: Target4F: 5′-TACTACTGTGCAGCAGATGATTTAG-3′; Target4R: 5′-TACCTTGCATATGTTCCTATATGGT-3′; The primers for Target5 were: Target5F: 5′-TTTAAGTTCTTGTTTTTCTCCTTGA-3′; Target5R: 5′-AATCAGTTCCTTCCTCACACTAAC-3′; The primers for Target6 were: Target6F: 5′-AAATTCAGAGAGATTTTTGGAAAGT-3′; Target6R: 5′-ATAAAGAAGCAGAAATAGGGAAAAT-3′; The specific co-dominant molecular markers corresponding to the Target1 primers are SEQ ID No.1 and SEQ ID No.2; The specific co-dominant molecular markers corresponding to the Target2 primers are SEQ ID No.3 and SEQ ID No.4; The specific co-dominant molecular markers corresponding to the Target3 primers are SEQ ID No.5 and SEQ ID No.6; The dominant molecular marker corresponding to the Target4 primer is SEQ ID No.7; The dominant molecular marker corresponding to the Target5 primer is SEQ ID No.8; The dominant molecular marker corresponding to the Target6 primer is SEQ ID No.

9.

2. The use of co-dominant and dominant molecular markers as claimed in claim 1, characterized in that: The application is to improve the genetic background recovery rate of tobacco strains; the specific application is to detect the presence of genomic DNA of tobacco individual plants in tobacco separation groups nic1 While increasing the number of loci, systematic selection or backcross breeding can be used to improve nic1 The chromosome region where the locus is located is restored to the selection efficiency of the genetic background of the recurrent parent, thereby improving the undesirable agronomic traits of the non-recurrent parent, improving the selection efficiency of the genetic background of the offspring tobacco plants, and accelerating the mutant nic1 Application of loci in breeding low-nicotine tobacco varieties.

3. The use of co-dominant and dominant molecular markers as claimed in claim 1, characterized in that: The application is: using primers of Target1, Target2, Target3 or Target4, Target5 and Target6 to amplify the tobacco genome DNA to be detected, and detecting the PCR amplification product; Analyze PCR amplification products; If the PCR amplification product contains three nucleotide sequences as shown in SEQ ID No.1, SEQ ID No.3 and SEQ ID No.5 at the same time, it is a tobacco genetic background with the homozygous recurrent parent; If the PCR amplification product contains three nucleotide sequences as shown in SEQ ID No. 2, SEQ ID No. 4 and SEQ ID No. 6 at the same time, it is a homozygous mutant. nic1 The genetic background of the non-recurrent parent; If the PCR amplification product contains six nucleotide sequences as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 at the same time, the genetic background of the tobacco is heterozygous, that is, the tobacco plant has the genetic background of the recurrent parent and the non-recurrent parent; If the PCR amplification product contains three nucleotide sequences as shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9 at the same time, it means that the plant has a heterozygous tobacco genetic background of the recurrent parent or both the recurrent parent and the non-recurrent parent; If the PCR amplification product result is no PCR amplification product, it means that the mutation is homozygous. nic1 Tobacco plants with the genetic background of the non-recurrent parent.

Images