A lytic polysaccharide monooxygenase and its application

Abstract

The present invention belongs to the field of genetic engineering and biotechnology. Specifically, the present invention relates to a method for improving the ability of Aspergillus to degrade starch, specifically to the genetic modification of Aspergillus, and more specifically to the use of the lytic polysaccharide monooxygenase CospAA13 of the Coniochaeta sp. PMI_546 fungus and its gene in improving the ability of Aspergillus to degrade starch. The strain of recombinant expression of CospAA13 provided by the present invention, the CospAA13 in the strain synergizes with the saccharifying enzyme to significantly improve the starch hydrolysis ability. The saccharifying enzyme activity is increased by 22.8% compared with the starting strain, which has a high application value.

Description

Technical field:

[0001] The present invention belongs to the field of genetic engineering and biotechnology. Specifically, the present invention relates to a method for improving the ability of Aspergillus to degrade starch, specifically to genetic modification of Aspergillus, and more specifically to the application of the lytic polysaccharide monooxygenase CospAA13 of the genus Coniochaetasp.PMI_546 and its gene in improving the ability of Aspergillus to degrade starch. Background technology:

[0002] The filamentous fungus protein production system has great development potential and broad application prospects. As a cell factory, it can efficiently express and secrete extracellular proteins and is widely used as a cell factory to produce many valuable products. Aspergillus niger is a common filamentous fungus of the genus Aspergillus, which has strong vitality and fast strain reproduction. It has high secretion efficiency and strong post-translational modification ability. It is widely used as a cell factory for protein production and is the main strain for industrial production of enzyme preparations, producing industrial enzymes and organic acids.

[0003] Glucoamylase (Glucoamylase, EC 3.2.1.3) is called glucoamylase, which is one of the most important industrial enzymes, and is widely used in many fields such as sugar production, fermentation and food processing. my country's saccharifying enzyme is mainly produced by Aspergillus niger strains through deep fermentation. The industrial production of saccharifying enzymes in my country started late, and after decades of continuous development, significant progress has been made. At present, it is possible to independently produce bulk enzymes such as saccharifying enzymes. For example, Chinese patent document CN105255741A has announced a strain with Aspergillus niger G131 and F285 as starting strains, and the strain-Aspergillus niger CGMCC 10788 of high-yield saccharifying enzymes obtained by multi-round protoplast electrofusion breeding selection, and the average fermentation enzyme activity of the strain is 99.3% higher than that of the starting strain. The invention patent with publication number CN103937766 A discloses a method for improving saccharifying enzymes by integrating a saccharifying enzyme expression cassette and a selection marker gene into the Aspergillus niger An12g08830 locus. The invention patent with publication number CN113061539A discloses a method for improving the saccharifying enzyme production capacity of Aspergillus niger by overexpressing genes in the fatty acid metabolism pathway.

[0004] Although these studies have reached a high level, the current research mainly focuses on the screening and breeding of high-yield saccharifying enzyme strains using traditional strain selection methods, or increasing the copy number of saccharifying enzyme genes or removing certain genes in the original Aspergillus niger strains. In recent years, the discovery of lytic polysaccharide monooxygenase (LPMO) has provided a new way for starch degradation. Therefore, it is necessary to develop a strain that uses the synergistic effect of lytic polysaccharide monooxygenase and saccharifying enzyme to improve the activity of saccharifying enzyme, significantly improve the starch degradation ability of the recombinant strain, so as to meet the fermentation application of saccharifying enzyme in the industrial field in my country, which is of great innovation. Summary of the invention:

[0005] After extensive and in-depth research, the present application aims to provide a strain modification method for improving the saccharification activity of strains by utilizing the synergistic effect of lytic polysaccharide monooxygenase and saccharification enzyme, and improving the saccharification activity of filamentous fungal strains through genetic modification. The present invention randomly inserts and integrates the lytic polysaccharide monooxygenase gene into the genome of the Aspergillus niger strain, exerts the synergistic effect of the lytic polysaccharide monooxygenase and saccharification enzyme, and significantly improves the saccharification activity of the recombinant strain. On this basis, the present invention is completed.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] One of the technical solutions provided by the present invention is a recombinant Aspergillus bacterium, wherein the recombinant bacterium is obtained by expressing a lytic polysaccharide monooxygenase CospAA13 in an Aspergillus starting bacterium having a saccharifying enzyme;

[0008] Furthermore, the Aspergillus is Aspergillus niger;

[0009] Furthermore, the lytic polysaccharide monooxygenase CospAA13 is derived from the fungus Coniochaetasp.PMI_546, and has an amino acid sequence shown in SEQ ID No.1;

[0010] Furthermore, the coding gene of the lytic polysaccharide monooxygenase CospAA13 has a nucleotide sequence shown in SEQ ID No. 2;

[0011] Furthermore, the expression of the lytic polysaccharide monooxygenase CospAA13 can be achieved by integrating the CospAA13 encoding gene or an expression cassette containing the CospAA13 encoding gene into the host genome, or by transferring an expression vector containing the CospAA13 encoding gene expression cassette into the host cell;

[0012] Preferably, the recombinant bacteria is obtained by recombinantly expressing the lytic polysaccharide monooxygenase CospAA13 in the saccharifying enzyme-producing Aspergillus niger industrial strain UN1636 through the pAN52-TN vector, and the recombinant bacteria is named CospAA13-2 strain;

[0013] Furthermore, the Aspergillus niger strain UN1636 has a deposit number of CGMCC NO.20725;

[0014] The above-mentioned recombinant bacteria is a strain in which the lytic polysaccharide monooxygenase and the saccharifying enzyme play a synergistic role. Compared with the starting strain, the recombinant bacteria has stronger saccharifying enzyme activity and starch degradation ability.

[0015] The second technical solution provided by the present invention is the application of the recombinant bacteria described in the first technical solution, especially in the degradation of starch.

[0016] The present invention achieves the following beneficial effects:

[0017] Genetic manipulation of Aspergillus cells is performed to achieve recombinant expression of lytic polysaccharide monooxygenase, and the resulting recombinant bacteria is a strain in which lytic polysaccharide monooxygenase and saccharifying enzyme act synergistically, and compared with the starting strain, it obtains stronger saccharifying enzyme activity and starch degradation ability, and significantly improves the saccharification activity of the recombinant strain. The present invention uses genetic recombination technology to express lytic polysaccharide monooxygenase CospAA13 to obtain a recombinant Aspergillus mutant strain, which can significantly improve the starch degradation ability, and the saccharifying enzyme activity is increased by 22.8% compared with the starting strain, and has great application value. Description of the drawings:

[0018] Figure 1 This is the nucleic acid electrophoresis diagram of PCR identification of transformants obtained by transforming Aspergillus niger strains with the CospAA13 gene recombinant expression cassette. M, marker; 1-4 are transformants screened on antibiotic plates; 5, starting strain control; 6, negative control.

[0019] Figure 2 The saccharifying enzyme activity in the supernatant of 6-day fermentation shake flasks of the CospAA13 recombinant expression strain CospAA13-2 and the starting strain Aspergillus niger UN1636 was determined. Specific implementation method:

[0020] To further explain the technical means and effects of the present invention, the technical solution of the present invention is further described below in conjunction with the preferred embodiments of the present invention. These embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0021] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: "Molecular Cloning: A Laboratory Manual" (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0022] The methods for obtaining various biological materials described in the examples are only provided as an experimental method to achieve the specific disclosed purpose, and should not be construed as limiting the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological material that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0023] The Aspergillus niger starting strain UN1636 used in the examples is prior art, with a deposit number of CGMCCNO.20725.

[0024] If the specific technology or conditions are not specified in the embodiments, the technology or conditions described in the literature in the field or the product instructions shall be followed. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased through regular channels. Among them, the percentage concentrations that appear are all mass percentage concentrations unless otherwise specified. The primers used and nucleic acid sequencing were completed by Suzhou GENEWIZ Biotechnology Co., Ltd. GENEWIZ. Among them, KAH8904799.1 is the protein number of the lytic polysaccharide monooxygenase of Coniochaeta sp.PMI_546 (i.e., SEQ ID NO.1), and its gene number is not given in the public sequence database. We named it CospAA13.

[0025] In the present invention, the meanings of the terms used are explained.

[0026] When "recombinant" is used to refer to a strain, cell, nucleic acid, protein or vector, it means that the strain, cell, nucleic acid, protein or vector has been modified by introducing a heterologous nucleic acid or protein or by altering a native nucleic acid or protein. For example, a recombinant strain expresses genes that are not found in the native (non-recombinant) form of the strain, or expresses native genes.

[0027] "Host strain" or "host cell" or "starting strain" refers to a suitable host for an expression vector or DNA construct, specifically, the host strain is preferably Aspergillus, most preferably Aspergillus niger. The host cell can be an Aspergillus host cell or a genetically modified host cell.

[0028] "Sequence" refers to a nucleotide sequence of any suitable length, which may be DNA or RNA; may be linear, circular or branched, and may be single-stranded or double-stranded. The term "donor DNA sequence" refers to a nucleotide sequence that is inserted into a genome. The donor sequence may be of any length.

[0029] The present invention is further explained below by means of specific examples.

[0030] Example 1. Construction of CospAA13 recombinant expression vector

[0031] (1) Construction of recombinant expression vector of lytic polysaccharide monooxygenase CospAA13

[0032] The expression vector was constructed with plasmid pAN52-TN as the backbone (the pAN52-TN vector has been disclosed in Chinese invention patent application 201510129876.0). The sequence of Myceliophthora thermophila lytic polysaccharide monooxygenase (MYCTH_2313229) was used as a reference, and biological information analysis and comparison were performed in the NCBI database to find the lytic polysaccharide monooxygenase (KAH8904799.1) of Coniochaeta sp. PMI_546. The amino acid sequence and nucleotide sequence of KAH8904799.1 are shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence table, respectively.

[0033] The nucleotide sequence of the gene corresponding to KAH8904799.1 (SEQ ID No. 2) was synthesized by Suzhou Jinweizhi Company and amplified using primers cosp-amp-F (SEQ ID No. 3) and cosp-amp-R (SEQ ID No. 4). The pAN52-TN vector was digested with restriction endonuclease EcoRV, and the amplified product was connected with the digested pAN52-TN using the Gibson Assembly method to construct a recombinant expression vector pAN52-TN-CospAA13.

[0034] The PCR reaction system was: 10 μL of 5× phusion HF buffer, 1 μL of 10 mM dNTPs, 2.5 μL of upstream / downstream primers, 1 μL of template DNA, 0.5 μL of Phusion DNA polymerase, and 32.5 μL of ddH2O.

[0035] The PCR reaction conditions were as follows: first 98°C for 30 s; then 98°C for 15 s, 60°C for 15 s, 72°C for 1 min, 34 cycles; finally 72°C for 10 min, 4°C for 10 min.

[0036] Example 2: Recombinant expression of lytic polysaccharide monooxygenase in Aspergillus niger

[0037] 10 μg of the recombinant expression vector pAN52-TN-CospAA13 linearized by restriction endonuclease was transformed into the protoplast cells of Aspergillus niger strain UN1636, and then positive transformants were screened by geneticin resistance.

[0038] (1) Aspergillus niger protoplast transformation

[0039] A. Mycelium Preparation

[0040] The mature Aspergillus niger spores were collected with 0.05% Tween-80 sterilized water, filtered through lens paper to remove the hyphae, and then inoculated into MM liquid culture and cultured at 30°C and 200 rpm for 16 hours.

[0041] MM medium: 50×Vogel's salt 20mL, sucrose 20g, agar 15g, make up to 1L, autoclave. 50×Vogel's salt (1L): trisodium citrate (1 / 2H2O) 150g, anhydrous KH2PO4 250g, anhydrous NH4NO3 100g, MgSO4·7H2O 10g, CaCl2·2H2O 5g, trace element salt solution 5mL, biotin (0.1mg / mL) 2.5mL, make up to 1L.

[0042] B. Protoplast Preparation

[0043] After collecting the mycelium by filtration, place it in 30mL lysis solution (formula: 0.15g lysis enzyme, 30mL solution A, filter sterilization; solution A: 1.0361g potassium dihydrogen phosphate, 21.864g sorbitol, dissolved in 90mL deionized water, pH adjusted to 5.6, quantitative to 100mL, high temperature sterilization), lyse at 30℃ for 2h, and shake gently every 30min. Then filter with cellophane, centrifuge at 4℃ 2000rpm for 10min, discard the supernatant, add 4mL solution B (formula: 0.735g calcium chloride, 18.22g sorbitol, 1mL Tris-HCl (1M, pH 7.5), dissolved in 90mL deionized water, pH adjusted to 7.6, quantitative to 100mL, high temperature sterilization), centrifuge at 2000rpm 4℃ for 10min; discard the supernatant, and add 200μL solution B.

[0044] C. Protoplast transformation

[0045] In a precooled 15mL centrifuge tube, add 50μL precooled PEG (12.5g PEG6000, 0.368g calcium chloride, 500μL Tris HCl (1M pH 7.5) in sequence, and add the DNA fragment to be transformed to 200μL protoplasts. After placing on ice for 20min, add 2mL precooled PEG liquid, place at room temperature for 5min, and then add 4mL solution B and mix gently. Pour the melted MM medium into a centrifuge tube to make the geneticin concentration 250mg / L, spread it on a plate, and culture at 30℃. After 5 days, pick a single mycelium and grow it on the corresponding resistance plate.

[0046] (2) Verification of Aspergillus niger transformants

[0047] A. Extraction of Aspergillus niger genome

[0048] The genomic DNA was extracted from the transformants selected in the above transformation process using the phenol-chloroform method, which specifically included the following operations:

[0049] 1) Add 200 mg of zirconium beads and 1 mL of lysis solution (formula: 0.2 M Tris-HCl (pH 7.5), 0.5 M NaCl, 10 mM EDTA, 1% SDS (w / v)) to a 2.0 mL sterile DNA extraction tube, and pick the Aspergillus niger hyphae grown on the plate into the DNA extraction tube;

[0050] 2) Place all DNA extraction tubes on the grinding machine and oscillate at the maximum speed for 30 seconds, repeat twice;

[0051] 3) Incubate in a 65°C water bath for 30 min, vortexing every few minutes during the water bath;

[0052] 4) After the water bath, take out the tubes and add 80 μL of 1M Tris·HCl (pH 7.5) to each tube for neutralization;

[0053] 5) Add 400 μL of phenol:chloroform (1:1) and centrifuge at 13000 rpm for 5 minutes;

[0054] 6) Take 300 μL of supernatant and put it into a new 1.5 mL EP tube, add 600 μL of 95% ethanol (DNA grade);

[0055] 7) Incubate on ice for one hour, then centrifuge at 4°C and 13,000 rpm. White DNA precipitate can be seen at the bottom of the EP tube.

[0056] 8) Wash with 400 μL of 75% alcohol (DNA grade), centrifuge at 13,000 rpm at 4°C, and gently remove the supernatant;

[0057] 9) Place the EP tube in a vacuum concentrator to remove residual alcohol;

[0058] 10) Add 50 μL ddH2O to dissolve the DNA, measure the DNA concentration with NanoDrop, and store the extracted DNA in a -20°C refrigerator for PCR verification in the next step.

[0059] B. PCR verification of transformants

[0060] The above-extracted genomic DNA was used as a template, and the transformants were verified by gene PCR using primers PAN52-seq-F1 (SEQ ID No. 5) and PAN52-seq-R1 (SEQ ID No. 6). PCR reaction reagents were purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0061] The primer sequences are as follows:

[0062] PAN52-seq-F1:CATCTTTCCCATCATCATCTC(SEQ ID No.5)

[0063] PAN52-seq-R1:CTGACATCGACACCAACGATC(SEQ ID No.6)

[0064] The PCR reaction system was: 2 μL of 10× Taq Buffer, 0.2 μL of 10 mM dNTP Mix, 0.4 μL of each 10 μM upstream / downstream primer, 1 μL of DNA template, 0.2 μL of Taq DNA Polymerase, and 15.8 μL of water.

[0065] The PCR reaction conditions were: 94°C for 5 min, then 94°C for 30 s, 55°C for 30 s, 72°C for 1.2 min, 30 cycles, and finally 72°C for 10 min, 4°C for 10 min.

[0066] Experimental results: The PCR amplification products were subjected to 1% agarose gel electrophoresis (130V voltage, 20 minutes), and obvious gene amplification bands were shown under the gel imaging system. The PCR amplification band of the CospAA13 overexpression strain was 1376bp, while no band was amplified by the wild-type strain. The results are as follows: Figure 1 As shown, it was shown that CospAA13 was inserted into the genome of Aspergillus niger UN1636 by random insertion, thereby obtaining the recombinant Aspergillus niger strain CospAA13-2.

[0067] Example 3: Phenotypic analysis of recombinant gene strains producing saccharifying enzymes

[0068] The CospAA13 gene recombinant expression strain (CospAA13-2) obtained above and the starting strain Aspergillus niger UN1636 were inoculated into 50 mL of fermentation medium in a 250 mL Erlenmeyer flask. The spore inoculation amount was 5×10 4 / mL, 30℃, 240rpm culture for 6 days, centrifuge the sample and take the supernatant as the crude enzyme solution, and measure the saccharifying enzyme activity.

[0069] Determination of saccharifying enzyme activity: dilute the crude enzyme solution with 0.05M pH 4.6 sodium acetate buffer to an appropriate multiple to a final volume of 0.25mL, preheat in a 40℃ water bath, take out, add 0.25mL of 1% soluble starch substrate solution preheated in a 40℃ water bath, mix well, react at 40℃ for 10min, terminate the reaction with 0.5mL DNS solution, boil for 10min, cool on ice, add distilled water to make up to 2.5mL, shake up and down, and determine the amount of glucose released by the DNS method. Determine the OD value at a wavelength of 540nm. The blank group uses the inactivated enzyme solution as a control.

[0070] The results are as follows Figure 2 As shown, compared with the starting strain UN1636, the saccharifying enzyme activity of the gene overexpression strain was significantly improved, and its saccharifying enzyme activity was increased by 22.8% compared with the starting strain.

[0071] Since the monooxygenase used in the present invention needs certain reaction conditions to exert its activity of oxidatively degrading starch, a reducing agent such as ascorbic acid that provides the electrons required for the oxidation reaction, a slightly acidic reaction environment (pH 6.0), and a long reaction time (2-4 hours). Under the reaction conditions for measuring the activity of the saccharifying enzyme in the present invention (pH 4.6, reaction time 10 minutes), the oxidative cleavage of the monooxygenase itself produces very little reducing sugar. Therefore, it is determined that the significant improvement in the saccharifying enzyme activity of the gene overexpression strain is due to the effect produced by the synergistic effect between the monooxygenase and the saccharifying enzyme.

Claims

1. A recombinant Aspergillus bacterium, characterized in that: The recombinant bacteria are obtained by expressing the lytic polysaccharide monooxygenase CospAA13 in the Aspergillus niger starting bacteria having saccharifying enzymes; The amino acid sequence of the lytic polysaccharide monooxygenase CospAA13 is shown in SEQ ID No.

1.

2. The recombinant Aspergillus according to claim 1, characterized in that The nucleotide sequence of the gene encoding the lytic polysaccharide monooxygenase CospAA13 is shown in SEQ ID No.

2.

3. The recombinant Aspergillus according to claim 1, characterized in that The expression of the lytic polysaccharide monooxygenase CospAA13 is achieved by integrating the CospAA13 encoding gene or an expression cassette containing the CospAA13 encoding gene into the host genome, or by transferring an expression vector containing the CospAA13 encoding gene expression cassette into the host cell.

4. The use of the recombinant Aspergillus bacteria according to any one of claims 1 to 3, characterized in that: It is used in producing saccharifying enzyme or degrading starch.

Images