Application of has-miR-129-5p in the preparation of anti-aging drugs

Abstract

The present invention belongs to the field of biomedicine technology, and relates to the application of has-miR-129-5p small molecule reagent in delaying aging. The nucleotide sequence of the has-miR-129-5p is shown in SEQ ID NO.1, and the drug inhibits its expression by binding to the 3'UTR region of ITPR2 (binding region such as SEQ ID NO.2), thereby regulating the signal transduction of intracellular calcium ions from the endoplasmic reticulum to mitochondria, and calcium ion transfer leads to a decrease in mitochondrial membrane potential, a decrease in the accumulation of reactive oxygen species (ROS), and a decrease in DNA damage, and finally delays the aging of cells and organisms. The present invention provides a new source of drugs for preventing, diagnosing, protecting, delaying and studying the aging of cells and organisms, and the drugs for controlling the aging of cells and organisms provided by the present invention are safe, have strong pharmacological effects, are less side effects, and have clear efficacy.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and relates to the application of has-miR-129-5p in preparing a drug for delaying cell aging. Background Art

[0002] Cellular senescence refers to a stable proliferation inhibition of cells accompanied by a senescence-associated secretory phenotype (SASP). Its occurrence is mainly due to the consumption of telomerase during cell replication and external aging-related stimuli such as oncogene activation, reactive oxygen species (ROS) accumulation, DNA damage, etc. Cellular senescence is mainly manifested by cell cycle inhibition and morphological changes of cells such as flattening, enlargement, and nuclear condensation; as well as senescence-associated-β-galactosidase activity (SA-β-GAL) and secretion of senescence or inflammatory-related factors. Senescent cells still maintain metabolic activity and can survive for more than several years. In the short term, the generation of senescent cells contributes to the embryonic development, damage repair, and tumor suppression of the body; while the long-term accumulation of senescent cells in the body can lead to the occurrence of tumors, body aging, and aging-related diseases. Therefore, more and more research is devoted to discovering, identifying, and trying to master the mechanism of cell senescence; however, the molecular and cellular mechanisms that regulate aging are still not completely clear. In addition, due to the lack of specific markers of aging and limitations in research on the mechanisms of aging, it is urgent to screen new aging regulators and study their regulatory networks.

[0003] In recent years, the function of intracellular calcium signaling pathways in cell aging has received increasing attention and has gradually been recognized as an important factor in regulating aging. Our previous studies have found that the nuclear receptor RXRA regulates intracellular calcium signals and regulates cell aging through inositol 1,4,5-triphosphate receptor type 2 (ITPR2). In addition, ITPR2 knockout mice show the effect of extending the lifespan of mice by reducing the contact between mitochondria and endoplasmic reticulum. However, the specific role of intracellular calcium signals in cell aging has not yet been fully understood. Therefore, further clarifying the route mechanism of intracellular calcium signals regulating cell aging is of great significance for further understanding the occurrence and development mechanism of cell and organism aging.

[0004] The regulation of aging-related gene expression by conservative small noncoding RNA (about 22 bp) (miRNA) has been studied for decades. Studies have shown that miRNA-24 (miR-24) inhibits cell replicative senescence by binding to the 3'UTR of p16 mRNA. Another study showed that miR-124, miR-34a, and miR-29a / b / c, as downstream senescence regulators of p53, regulate cell senescence by inhibiting cyclin A2 (CCNA2). However, there are currently no studies on the effects of miRNA on ITPR2.

[0005] The function of has-miR-129-5p in the process of cell aging is still unknown. Currently, there is no existing technology reporting the inhibitory effect of has-miR-129-5p on ITPR2 in cell aging and its therapeutic effect on delaying cell aging. Therefore, finding has-miR-129-5p for the treatment of cell aging and aging-related diseases will greatly promote the development of the drug. Summary of the invention

[0006] In order to overcome the shortcomings of the above-mentioned prior art, the purpose of the present invention is to provide the use of has-miR-129-5p in the preparation of drugs for preventing and / or treating cell senescence and aging-related diseases. The present invention provides a new source of drugs for preventing, diagnosing, protecting, treating and studying cell senescence. The drugs for improving bleomycin-induced lung aging and natural aging provided by the present invention are safe, have strong pharmacological effects, clear therapeutic effects, and few side effects.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] The use of has-miR-129-5p in the preparation of a drug for preventing or treating cell aging-related diseases, wherein the nucleotide sequence of has-miR-129-5p is shown in SEQ ID NO.1, and the drug prevents or treats cell aging-related diseases by inhibiting ITPR2 expression. The drug inhibits its expression by binding to the 3'UTR region of ITPR2, thereby regulating the signal transduction of intracellular calcium ions from the endoplasmic reticulum to mitochondria, and the calcium ion transfer leads to a decrease in mitochondrial membrane potential, a decrease in the accumulation of reactive oxygen species (ROS), and a decrease in DNA damage, ultimately delaying the aging of cells and organisms. The sequence of the 3'UTR region is shown in SEQ ID NO.2, and the binding region sequence is GCAAAAAA.

[0009] SEQ ID NO.1

[0010] 3'-CGUUCGGGUCUGGCGUUUUUC-5'.

[0011] SEQ ID NO.2

[0012] TAAATATTTCTGAGTTGTATTTTTAATGCCTCTTTCTTTTCTGCCTAAATGCTTAGAAATTATAAA(GCAAAAAA)AAAAAAAACAGCAACAAAAAATCGAAGCAGACAAAAAAGGCACTTTTCAGAACATCAAATTCCTA ATGAAGAAGAGGAAGATAATGGGGAAATTTGACATTTGATATAAATTTATATTTGTTATGTGTATGTTTGTTAATGCAACTGGAATATTTGACTTAGGTGAGTATCAGTTAACATCCTTGTATTTATATAGTGACATC.

[0013] Furthermore, the application includes any of the following:

[0014] Delaying fibroblast senescence;

[0015] Improve aging symptoms and delay natural aging in mice;

[0016] Delay the occurrence or development of diseases related to cell aging.

[0017] Furthermore, the application includes improving bleomycin-induced lung aging and natural aging.

[0018] Furthermore, the drug inhibits the aging of senescence-related cells, which include fibroblasts, naive CD4+T cells, memory CD8+T cells and other cells.

[0019] Furthermore, the drug reduces bleomycin-induced lung aging in mice and aging-related β-galactosidase staining and naive T cell exhaustion, memory T cell accumulation, and the expression levels of aging markers CDKN1A and CDKN2A in lung tissue of naturally aged mice.

[0020] Furthermore, the drug is introduced into body tissues via intraperitoneal injection.

[0021] Furthermore, the drug includes an active ingredient has-miR-129-5p and a pharmaceutically acceptable carrier.

[0022] Furthermore, the drug is an injection, which is prepared by dissolving has-miR-129-5p in PBS buffer.

[0023] Furthermore, the concentration of the has-miR-129-5p is 5 mg / kg.

[0024] Furthermore, the intraperitoneal injection is performed more than twice.

[0025] Furthermore, the present invention discloses the use of has-miR-129-5p in the preparation of drugs for preventing and / or treating cell senescence and senescence-related diseases.

[0026] The hsa-miR-129-5p is a conservative small non-coding RNA (about 22 bp).

[0027] The drug is a drug for controlling the aging of cells and organisms, and the aging-related cells include fibroblasts, naive CD4+T cells, memory CD8+T cells and other cells.

[0028] The drug is a drug that inhibits the expression of ITPR2.

[0029] The present invention also discloses a product, the active ingredient of which is has-miR-129-5p, and the uses of the product include at least one of the following uses:

[0030] a) Delaying the senescence of fibroblasts;

[0031] b) improve bleomycin-induced lung aging;

[0032] c) Delay natural aging.

[0033] The present invention also discloses a drug, which can be used to prevent / treat chemotherapy-induced senescence (TIS) that often occurs clinically. The drug is composed of an active ingredient has-miR-129-5p and pharmaceutically addable excipients.

[0034] The drug can be absorbed by injection, introduced into body tissues by physical or chemical methods, or introduced into the body after being mixed or encapsulated by other substances.

[0035] Beneficial Effects

[0036] The present invention provides the use of has-miR-129-5p in the preparation of drugs for delaying cell aging and body aging. The present invention simulates the drug-induced aging (TIS) model and the natural aging model that often occur in clinical treatment: the lung aging model induced by intratracheal instillation (ii) of bleomycin (1.875 mg / kg) in C57BL / 6 mice; the natural aging model of 20-month-old C57BL / 6 mice. Experiments have shown that intraperitoneal injection of has-miR-129-5p into mice can significantly improve the occurrence and development of the above-mentioned lung aging and natural aging. At the same time, the in vitro cell aging model used in the present invention: primary human embryonic lung fibroblasts MRC5, bleomycin (1μg / ml) was used to construct a cell aging model, and has-miR-129-5p was transfected to inhibit its expression by binding to the 3'UTR region of ITPR2, thereby regulating the signal transduction of intracellular calcium ions from the endoplasmic reticulum to mitochondria. The calcium ion transfer leads to a decrease in mitochondrial membrane potential, a decrease in the accumulation of reactive oxygen species (ROS), and a decrease in DNA damage response, ultimately delaying cell aging. Therefore, the present invention proposes for the first time that has-miR-129-5p can be used in the development and preparation of drugs for the prevention / treatment of drug-induced senescence (TIS) that often occurs in clinical practice.

[0037] The drug for controlling cell and organism aging provided by the present invention is safe, has strong pharmacological effects, clear therapeutic effects, and small side effects. The present invention provides a new source of drugs for preventing, detecting, protecting, treating, and studying cell and organism aging. The drug for controlling cell and organism aging provided by the present invention is safe, has strong pharmacological effects, has small side effects, and clear therapeutic effects; and is easy to promote and apply clinically, and can generate huge clinical application prospects and social benefits in a relatively short period of time. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The mechanism by which has-miR-129-5p regulates cell senescence through the ITPR2-intracellular calcium signal-mitochondrial membrane potential-reactive oxygen species-DNA damage axis.

[0039] Figure 2 To clarify that has-miR-129-5p is a direct inhibitor of ITPR2. (a) is a miRNA small molecule that may inhibit ITPR2 screened from four miRNA databases; (bd) is the confirmation that has-miR-129-5p inhibits ITPR2 mRNA expression after overexpression and knockdown of miRNA in different fibroblasts; (ef) is a dual luciferase reporter experiment confirming that has-miR-129-5p can directly target the 3'UTR region of ITPR2.

[0040] Figure 3Has-miR-129-5p regulates the intracellular calcium signal-mitochondrial membrane potential-reactive oxygen species-DNA damage axis. MRC5 cells were transfected with miR-Ctrl / miR-129 (has-miR-129-5p analog (miR-129, the same below)) or imiR-Ctrl / imiR-129 (has-miR-129-5p inhibitor (imiR-129, the same below)) + / - siITPR2 or siMCU (small interfering RNA, provided by Guangzhou Ruibo Biotechnology Co., Ltd.). Four days after transfection, cells were incubated with cytoplasmic calcium indicator Fluo4 (a) or mitochondrial calcium indicator Rhod2 (b) or mitochondrial membrane potential decrease indicator Rhodamine123 (c) or mitoSOX REDmitochondrial (mitoROS) (d) or Dihydroethidium (ROS) (e) for 30 minutes, and their frequency deviations were analyzed by flow cytometry. The left panel shows an example of deviation, the middle panel shows the mean ± SEM of three independent experiments, and the right panel shows the mean ± SEM of six biological replicates. Cells were fixed 4 days after transfection and immunofluorescence stained with anti-53BP1 antibody. Representative images and relative percentages of nuclei with ≥5 53BP1 dots (3 independent replicates for overexpression experiments and 4 replicates for inhibitor experiments, ± SEM) are shown (f, g).

[0041] Figure 4 Calcium signaling and antioxidants are involved in reactive oxygen species and DNA damage regulated by has-miR-129-5p. MRC5 cells were transfected with miR-Ctrl or miR-129 and treated with IP3 (5 μM) or imiR-Ctrl or imiR-129 every 2 days with BAPTA (5 μM) or NAC (5 μM). Four days after transfection, cells were incubated with mitoSOX RED mitochondrial (mitoROS) (a, c) or Dihydroethidium (ROS) (b, d) for 30 min, respectively. Representative frequency deviation photos and mean values ​​of three biological replicates are plotted with ± SEM. Cells were fixed 4 days after transfection and immunofluorescently stained with an antibody against 53BP1. (e, f) Representative images of nuclei with more than or equal to 5 53BP1 dots (± SEM 3 independent replicates) and relative percentage of nuclei quantification are shown.

[0042] Figure 5hs-miR-129-5p regulates cell senescence through ITPR2 and MCU. MRC5 cells were transfected with miR-Ctrl or miR-129. Six days after transfection, cells were stained with crystal violet (a) or SA-β-GAL solution, and the percentage of SA-β-GAL-positive cells under each condition (left) and representative images (right) (mean ± SEM of 3 independent replicates) (b). (cf) Three days after transfection, the mRNA levels of ITPR2 (c), Ki67 (d), CDKN1A (e), and CDKN2A (f) were detected by RT-qPCR (mean ± SEM of 5 biological replicates). MRC5 cells were transfected with imiR-Ctrl or imiR-129 and siITPR2 or siMCU. Six days after transfection, cells were stained with crystal violet (g) or SA-β-GAL solution, and representative images of the percentage of SA-β-GAL-positive cells under each condition (left) (mean ± SEM of 3 independent replicates on the right) (h). (im) Three days after transfection, the mRNA levels of ITPR2 (i), MCU (j), Ki67 (k), CDKN1A (l), and CDKN2A (m) were detected by RT-qPCR (mean ± SEM of five independent replicates).

[0043] Figure 6 Has-miR-129-5p delays bleomycin-induced cell senescence. MRC5 cells were transfected with miR-Ctrl or miR-129 and treated with bleomycin (1 μg / ml). Four days after transfection, cells were collected and incubated with cytoplasmic calcium indicator Fluo4 (a) or mitochondrial calcium indicator Rhod2 (b) or mitochondrial membrane potential decrease indicator Rhodamine123 (c) or mitoSOX REDmitochondrial (mitoROS) (d) or Dihydroethidium (ROS) (e) for 30 min, and flow cytometry was performed; the left figure is a representative image, and the right figure is the mean ± SEM of three independent replicates. (f) Cells were fixed 4 days after transfection and immunofluorescence stained with 53BP1 antibody. Representative images of nuclei with more than or equal to 5 53BP1 dots (± SEM, 3 independent replicates) and relative percentage of nuclei quantification. Six days after transfection, cells were stained with crystal violet (g) or SA-β-GAL solution, and representative images (left) and the percentage of SA-β-GAL-positive cells under each condition (right panel is the mean of three independent replicates ± SEM) (h). (il) Three days after transfection, RT-qPCR was used to detect the mRNA levels of ITPR2 (i), Ki67 (j), CDKN1A (k), and CDKN2A (l) (mean of five independent replicates, ± SEM).

[0044] Figure 7 hs-miR-129-5p delays bleomycin-induced aging and natural aging in mice. (a) Linear regression analysis between miR-129 and ITPR2 mRNA levels in lung tissues of 8-week-old female mice (N=8). (b) Experimental timeline of mice: mice were intraperitoneally instilled with bleomycin (1.875 mg / kg) on ​​the first day, and intraperitoneally injected with miR-NC or miR-129agomir twice (250 nM / kg) on ​​the second and fifth days, respectively; they were killed on the eighth day. (c) Representative images of SA-β-GAL staining levels in lung tissues and the percentage of SA-β-GAL-positive cells under each condition (N=6, mean ± SEM). (d) Immunophenotypes of naive or memory CD4+ and CD8+ T cells in lung tissues (N=6, mean ± SEM). (f) RT-qPCR detection of CDKN1A mRNA levels (N=6, mean ± SEM). (g) Experimental timeline of mice: 8-week-old or 20-month-old mice were intraperitoneally injected with miR-NC or miR-129agomir three times a week at a dose of 250 nM / kg and were killed on the 21st day. (h) SA-β-GAL staining levels and representative images (left) of lung tissues and the percentage of SA-β-GAL positive cells under each condition (right) (N=5, mean ± SEM). (ij) Immunophenotype of naive or memory CD4+ and CD8+ T cells in lung tissues (N=4, mean ± SEM). RT-qPCR was used to detect CDKN2A mRNA levels in lung (k), liver (l) and kidney (m) (N=4, mean ± SEM). DETAILED DESCRIPTION

[0045] In order to make the technical personnel in the technical field better understand the scheme of the present invention, the technical scheme in the embodiment of the present invention will be clearly and completely described in conjunction with the drawings in the embodiment of the present invention. Obviously, the described embodiment is only an embodiment of a part of the present invention, not all embodiments. Based on the embodiment of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work should belong to the scope of protection of the present invention. It should be noted that the terms "first", "second", etc. in the specification and claims of the present invention and the above-mentioned drawings are used to distinguish similar objects, and are not necessarily used to describe a specific order or sequence. It should be understood that the data used in this way can be interchangeable where appropriate, so that the embodiments of the present invention described here can be implemented in an order other than those illustrated or described here. In addition, the terms "including" and "having" and any of their variations are intended to cover non-exclusive inclusions, for example, a process, method, system, product or device containing a series of steps or units is not necessarily limited to those steps or units clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or devices.

[0046] The present invention is further described in detail below in conjunction with the accompanying drawings:

[0047] The experimental methods used in the embodiments of the present invention are conventional methods unless otherwise specified.

[0048] The reagents and materials used in the examples can all be purchased conventionally. The quantitative experiments involved in the examples were repeated at least three times, and the results were averaged.

[0049] The C57BL / 6 mice used were purchased from the Comparative Medicine Center of Yangzhou University.

[0050] The bleomycin used was purchased from MCE Company with the product number HY-17565.

[0051] The miR-129 used was purchased from Guangzhou Ruibo Biotechnology Co., Ltd.

[0052] The human primer sequences used are shown in Table 1, and the mouse primer sequences are shown in Table 2.

[0053] The sequences of siRNAs and miRNAs used are shown in Table 3.

[0054] The information of antibodies and probes used is shown in Table 4.

[0055] Table 1

[0056]

[0057]

[0058] Table 2

[0059]

[0060] Table 3

[0061]

[0062]

[0063] Table 4

[0064]

[0065] Example 1: miR-129 directly targets and inhibits the expression of ITPR2

[0066] like Figure 2 As shown in the figure, to screen endogenous miRNAs that regulate ITPR2 expression, we used Venny analysis to preliminarily screen the regulation of ITPR2 based on four miRNA databases (Targetscan, miRDB, mirDIP and miRanda). This method preliminarily screened out 8 miRNAs that inhibit ITPR2 transcription. We further retested the regulation of ITPR2 by these miRNAs in two ways: (1) the mimics of these 8 miRNAs were transfected into primary human lung fibroblasts MRC5, and 4 of them could significantly inhibit the expression of ITPR2; (2) we again transfected the inhibitors (imiRNAs) of these 4 miRNAs into MRC5, and finally determined that imiR-129 was the most significant one that induced the upregulation of ITPR2 mRNA levels. To further verify our observations, we transfected miR-129 and imiR-129 into two other primary human lung fibroblasts (IMR90 and WI38), and obtained similar results to MRC5. Since miRNAs generally control the expression of target genes by targeting the 3'-UTR region, we queried the miRbase database and found that there were three potential binding sites for miR-129 in the 3'-UTR region of ITPR2. Then, we constructed three recombinant plasmids: the wild type (wt) contained all three binding peaks, two mutants, one of which mutated all three binding sites (mut1), and the other mutated only the longest one (mut2). Luciferase assays showed that miR-129 preferentially binds to region 1 of ITPR2. Taken together, these data support that miR-129 directly binds to ITPR2 and inhibits its expression.

[0067] Example 2: miR-129 regulates the calcium signal-membrane potential-reactive oxygen species-DNA damage signaling pathway

[0068] ITPR2 is known to be a calcium release channel located in the endoplasmic reticulum. Figure 3 As shown in Figure 2, we investigated whether miR-129 could control ITPR2-mediated intracellular calcium signals. Using the cytosolic calcium indicator Fluo4, we observed by flow cytometry that intracellular calcium levels decreased after transfection with miR-129 analogs, while intracellular calcium levels increased after transfection with miR-129, and this increased intracellular calcium level could be reversed by knocking down ITPR2. Similarly, we used the Rhod2 indicator to detect mitochondrial calcium levels and found the same trend.

[0069] Mitochondrial calcium accumulation triggers a decrease in mitochondrial membrane potential, leading to excessive production of mitochondrial ROS (mitoROS) and total intracellular ROS. Therefore, we applied Rhodamine123 as a reporter for decreased mitochondrial membrane potential and used mitoSOX RED mitochondrial and Dihydroethidium indicators to measure mitoROS and total intracellular ROS levels. Compared with the miRNA control group (miR-Ctrl), miR-129 analogs increased mitochondrial membrane potential and decreased mitoROS and total ROS levels; while imiR-129 had the opposite effect. In addition, the effects of miR-129 inhibitors could be partially reversed when ITPR2 or MCU were knocked down simultaneously.

[0070] The accumulation of ROS can trigger DNA damage. Therefore, we introduced the DNA damage marker 53BP1. The miR-129 analog significantly reduced DNA damage, but its inhibitor significantly increased 53BP1. In addition, the effect of imiR-129 could be reduced by knocking down ITPR2 or MCU. Taken together, these findings suggest that miR-129 regulates the intracellular calcium signaling-mitochondrial membrane potential-reactive oxygen species-DNA damage signaling pathway through ITPR2 and MCU.

[0071] Example 3: miR-129-regulated ROS-DNA damage is regulated by calcium signaling and antioxidants

[0072] like Figure 4To verify whether miR-129-regulated ROS accumulation and DNA damage can be mediated by calcium signaling and antioxidants, we used inositol 1,4,5-triphosphate (IP3), an ITPR ligand, to activate ITPRs. The reduction in mitoROS, ROS, and DNA damage levels induced by miR-129 mimics was partially upregulated after IP3 treatment. In addition, we used the calcium chelator BAPTA and the antioxidant N-acetyl-L-cysteine ​​(NAC) in imiR-129-transfected cells. The results showed that both calcium chelators and antioxidants could prevent the increase in mitoROS, ROS, and DNA damage caused by imiR-129. These observations support that miR-129 controls ROS and corresponding DNA damage through upstream calcium signaling pathways.

[0073] Example 4: has-miR-129-5p inhibits cell senescence in vitro.

[0074] like Figure 5-6 shown.

[0075] (I) miR-129 delays cell senescence by inhibiting ITPR2

[0076] Human embryonic lung fibroblasts MRC5 were cultured and seeded in 12-well plates (crystal violet or SA-β-GAL staining: 2.5 × 10 5 cells / well; IF staining: 4× 10 5 The cells were cultured in DMEM (containing 10% FBS) medium (10 cells / well) at 37°C and 5% CO2 in a cell culture incubator. The following grouping treatments were performed:

[0077] Each well was transfected with imiR-Ctrl or imiR-129+ / -siITPR2 or siMCU (small interfering RNA, provided by Guangzhou Ruibo Biotechnology Co., Ltd., the same below) (80nM per well) and cultured for 4 days; 3 days after transfection, the mRNA levels of ITPR2, Ki67, CDKN1A and CDKN2A were detected by RT-qPCR (mean ± SEM of five independent repeats); 4 days after transfection, cells in each group were collected and flow cytometry was used to detect cytoplasmic calcium indicator Fluo4 (a) or mitochondrial calcium reporter Rhod2 (b) or mitochondrial membrane potential decrease indicator Rhodamine123 (c) or mitoSOX RED mitochondrial (mitoROS) (d) or Dihydroethidium (ROS) (e). In addition, cells were fixed in 12-well plates and immunofluorescence stained with anti-53BP1 antibody; 6 days after transfection, cells were stained with crystal violet (g) or SA-β-GAL solution. The results showed that imiR-129 combined with siITPR2 or siMCU could significantly delay imiR-129-induced cell senescence.

[0078] (II) Construction of cell senescence model induced by bleomycin

[0079] Human embryonic lung fibroblasts MRC5 were cultured and seeded in 12-well plates (crystal violet or SA-β-GAL staining: 2.5 × 10 5 cells / well; IF staining: 4× 10 5 The cells were cultured in DMEM (containing 10% FBS) medium (10 cells / well) at 37°C and 5% CO2 in a cell culture incubator.

[0080] Cells were treated with bleomycin (1 μg / ml) for three days to construct a cell senescence model; after bleomycin treatment, a significant increase in intracellular calcium accumulation, increased mitochondrial calcium levels, decreased mitochondrial membrane potential, and a large accumulation of reactive oxygen species in mitochondria and cytoplasm were observed. DNA damage, cell proliferation inhibition, increased SA-β-GAL activity, Ki67 proliferation factor inhibition, and significant upregulation of senescence markers CDKN1A and CDKN2A occurred. The above results indicate that bleomycin can induce senescence of human embryonic lung fibroblasts MRC5.

[0081] (III) miR-129 delays bleomycin-induced cell senescence

[0082] Model group: Each well was transfected with miR-Ctrl and cultured for 4 days, then bleomycin (1 μg / ml) was added and cultured for 3 days, and the same detection as the control group was performed.

[0083] Control group + miR-129 group: Each well was transfected with miR-129 and cultured for 4 days, and the same tests as the control group were performed.

[0084] Model group + miR-129 group: Each well was transfected with miR-129 and cultured for 4 days, then bleomycin (1 μg / ml) was added and cultured for 3 days, and the same detection as the control group was performed.

[0085] The results are as follows Figure 6 As shown in Figure 2, after bleomycin treatment, a large increase in intracellular calcium levels and subsequent increase in mitochondrial calcium levels, a decrease in mitochondrial membrane potential, and accumulation of mitochondrial reactive oxygen species and intracellular reactive oxygen species were observed. These phenomena were significantly reduced when miR-129 mimics were added to bleomycin-treated cells ( Figure 6 a-6e). In addition, bleomycin-induced DNA damage, proliferation arrest, increased SA-β-GAL staining levels, and Ki67 inhibition, ITPR2, CDKN1A, and CDKN2A upregulation were all ameliorated by miR-129 ( Figure 6 f-6l). The above results indicate that bleomycin can induce senescence of MRC5 cells, and miR-129 alleviates bleomycin-induced cell senescence through the calcium signal-Δψ(m)-ROS-DDR axis.

[0086] Example 5: Application of miR-129 in bleomycin-induced lung senescence

[0087] (I) Bleomycin-induced lung aging model

[0088] Experimental animals: 8-week-old female C57BL / 6J mice (average weight 20 g).

[0089] The experimental animals were divided into a normal control group and a model group. The model group mice were given intratracheal instillation (ii) of bleomycin (10 mg / kg) to establish a lung aging model. The control group mice were given a strict PBS control instillation. On the 8th day, the mice underwent in vivo cardiac perfusion to remove the circulating blood. Lung cells were extracted for immune aging index detection. At the same time, lung tissues were extracted and frozen to prepare frozen sections for immunohistochemical staining. The results are shown in Figure 7 In bleomycin-induced lung aging, SA-β-GAL staining and the level of aging indicator CDKN1A in the lungs of mice in the model group were significantly higher than those in the control group, proving that bleomycin can indeed induce lung aging. The model group showed naive T cell exhaustion and memory T cell accumulation, which is a typical manifestation of immune aging, and immune aging is considered an important feature of aging.

[0090] (ii) Intraperitoneal injection of has-miR-129-5p

[0091] Has-miR-129-5p (miR-129) was dissolved in PBS buffer. The model group mice were randomly divided into model group, miR-NC group, and miR-129 group (8 mice in each group). MiR-NC or miR-129 (5 mg / kg) (containing PBS solvent) was intraperitoneally injected on the 2nd and 5th day after bleomycin modeling. The model group was intraperitoneally injected with only PBS solvent buffer. After the mice were killed on the 8th day, in vivo cardiac perfusion was performed to remove the circulating blood, and lung cells were extracted for immune aging index detection. At the same time, the lung tissue was extracted and frozen to make frozen sections for immunohistochemical staining. The results are shown in Figure 7 As shown in the figure, it can be seen that miR-129 significantly reduced the proportion of SA-β-GAL staining in the lungs of the model group mice, while the miR-NC group did not change significantly. miR-129 can reverse the bleomycin-induced naive T cell exhaustion and memory T cell accumulation, especially the memory CD8+T cells decreased to a level close to that of the normal control group. Suggestion: miR-129 can improve bleomycin-induced lung aging.

[0092] Example 6: Application of has-miR-129-5p in natural aging

[0093] The experimental animals were divided into a young group (8 weeks old) and an old group (20 months old) according to age. The two groups were intraperitoneally injected with miR-NC or miR-129 (250nM / kg) (containing PBS solvent) once a week for a total of 3 times, with 5 mice in each group. A total of 4 groups of mice were perfused in vivo on the 21st day to remove the circulating blood, and lung cells were extracted for immune aging index detection; at the same time, lung tissues were extracted and frozen to prepare frozen sections for immunohistochemical staining.

[0094] Results Figure 7 The SA-β-GAL staining ratio in the lungs of the old mice was significantly higher than that in the young mice, indicating that the lungs of the old mice had obvious aging. After intraperitoneal injection of miR-129, the SA-β-GAL staining in the lungs of the old mice was significantly reduced, while there was basically no change in the young group, indicating that miR-129 can alleviate natural lung aging. The changes in naive T cell exhaustion were basically consistent with this, proving that miR-129 can alleviate natural immune aging. The changes in the mRNA expression levels of cyclin-dependent kinase 2A (CDKN2A) in the lungs, liver, and kidneys were also consistent, indicating that miR-129 can partially reverse natural aging.

[0095] These in vivo data support that miR-129 can improve aging phenotypes in natural aging models.

[0096] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. Application of has-miR-129-5p in the preparation of anti-aging drugs, characterized in that: The nucleotide sequence of the has-miR-129-5p is shown in SEQ ID NO.

1. The drug inhibits the expression of ITPR2 by binding to the 3'UTR region, thereby regulating the signal transduction of intracellular calcium ions from the endoplasmic reticulum to the mitochondria. The calcium ion transfer leads to a decrease in mitochondrial membrane potential, a decrease in the accumulation of reactive oxygen species, and a decrease in DNA damage response, ultimately delaying the aging of cells and organisms. The sequence of the 3'UTR region is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The drug improves bleomycin-induced lung aging and natural aging.

3. The use according to claim 1, characterized in that: The drug is introduced into the body tissues by intraperitoneal injection.

4. The use according to claim 1, characterized in that: The medicine comprises an active ingredient has-miR-129-5p and a pharmaceutically acceptable carrier.

5. The use according to claim 1, characterized in that: The drug is an injection, which is prepared by dissolving has-miR-129-5p in PBS buffer.

6. The use according to claim 1, characterized in that: The concentration of the has-miR-129-5p is 5 mg / kg.

Images