Application of Rice Ospep5 Gene and Its Encoded Peptide in Regulating Plant Salt Tolerance

Abstract

The present invention discloses the application of rice Ospep5 gene and its encoded small peptide in regulating plant salt tolerance. The small peptide is 34 amino acids in length and belongs to an unknown gene in rice. Its nucleotide sequence is shown in SEQ ID NO: 1. The present invention can significantly improve the salt tolerance of rice and Arabidopsis by exogenously applying Ospep5 small peptide in rice and Arabidopsis. The relevant biological material of the present invention is an expression cassette, recombinant vector, recombinant bacteria or transgenic cell line capable of expressing the Ospep5 nucleic acid molecule or containing the nucleic acid molecule. The present invention shows that knocking out the Ospep5 gene in rice using the CRISPR / Cas9 gene editing method significantly reduces the salt tolerance of rice; while the transgenic rice overexpressing Ospep5 has significantly improved salt tolerance, proving that the Ospep5 gene positively regulates the salt tolerance of rice, which is of great significance for breeding new salt-tolerant plant varieties.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to the application of rice Ospep5 gene and its encoded small peptide in regulating plant salt tolerance. Background Art

[0002] my country currently has 100 million hectares of inland saline-alkali land and 2.34 million hectares of tidal flats. Soil salinization has caused the destruction of arable land resources and huge losses in agricultural production, and has become a global ecological problem. Developing and utilizing coastal tidal flats and inland saline-alkali land resources is one of the effective ways to ensure the area of ​​arable land. Rice is one of the most important food crops in my country and even in the world. Planting salt-alkali-tolerant rice on saline-alkali land has become the first choice for the improvement and utilization of saline-alkali land and tidal flats. Therefore, studying the mechanism of rice salt-alkali tolerance, improving its salt-alkali tolerance, and cultivating new salt-alkali-tolerant rice varieties are important measures to ensure my country's food security. This project intends to study the new mechanism of rice salt tolerance and create new salt-tolerant germplasm. The expected research results have important theoretical value and broad application prospects.

[0003] Peptide molecules, especially small peptides (proteins with a length of less than 100 amino acids), are involved in regulating many biological processes such as plant growth and development, absorption of mineral elements, and stress resistance. Similar to traditional plant hormones, small peptides act as signaling molecules, and their concentrations at which they exert their physiological functions are very low. Unlike traditional hormones, small peptides are essentially composed of amino acids, and exogenous application does not pose a risk to the environment. Therefore, small peptides can be used as a new, risk-free "plant hormone" to increase crop stress resistance and yield, and provide a new idea for breaking through the existing technical bottleneck of rice cultivation in saline-alkali land.

[0004] Rice is one of the most important food crops in my country, and more than 70% of the country's population relies on rice as their staple food. It is widely planted and has many main varieties. However, most rice cultivars are sensitive to salt stress, and their salt tolerance has huge room for improvement and potential. Studies have shown that rice salt tolerance is a quantitative trait controlled by multiple genes, and its genetic basis is very complex. Therefore, the progress of improving rice salt tolerance using traditional breeding methods is relatively slow. By discovering the key major effect genes that control rice salt tolerance and using genetic engineering methods, it is expected to accelerate the breeding process of new salt-tolerant rice varieties. However, there are currently few key rice salt tolerance genes identified, and the molecular mechanism of salt tolerance regulation is still unclear, which has become a huge bottleneck in the molecular breeding of salt-tolerant rice.

[0005] Therefore, it is necessary to further explore the key genes of rice salt tolerance to provide a theoretical basis and potential genetic manipulation targets for breeding salt-tolerant rice. Summary of the invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide an application of a novel rice peptide Ospep5 and its gene having a significant positive regulatory effect on regulating rice salt tolerance.

[0007] The technical problem that the present invention also aims to solve is to provide an application of a method of exogenously applying Ospep5 or overexpressing transgenic rice to improve the salt tolerance of plants, and it is found that they all show obvious salt tolerance, that is, the chlorophyll content is significantly higher than that of the wild type and the sodium ion content is significantly lower than that of the wild type. The survival rate of these materials after salt stress is also significantly higher than that of the wild type.

[0008] The technical problem that the present invention also aims to solve is to provide an application of using a CRISPR mutant to inhibit the expression of the gene, which is more sensitive to salt than the wild type.

[0009] The technical problem that the present invention also solves is to provide a method for obtaining plants with high salt tolerance or low salt tolerance.

[0010] The final technical problem to be solved by the present invention is to provide a method for identifying the high salt-tolerant plants or low salt-tolerant plants.

[0011] Technical solution: In order to solve the above technical problems, the present invention provides a rice salt-tolerant Ospep5 gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0012] The present invention also provides a protein or small peptide encoding the rice salt-tolerant Ospep5 gene, and the amino acid sequence of the protein or small peptide is shown in SEQ ID NO.2.

[0013] The present invention also includes that the amino acid sequence of the protein encoded by the Ospep5 gene is selected from one of the homologous sequence, conservative variant, allelic variant, natural mutant and induced mutant of SEQ ID NO.2.

[0014] The present invention also provides an expression cassette, a recombinant vector or a recombinant strain, which comprises the rice salt-tolerant Ospep5 gene.

[0015] The expression cassette of the present invention contains a DNA fragment having a nucleotide sequence as shown in SEQ ID NO: 1 or a DNA fragment having at least 90% homology to SEQ ID NO: 1.

[0016] The recombinant vector contains a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1 or a recombinant vector containing a DNA fragment with at least 90% homology to SEQ ID NO: 1. Preferably, the recombinant vector is a knockout vector, a knockdown vector or an overexpression vector.

[0017] The present invention also provides the use of the rice salt-tolerant Ospep5 gene, the protein or small peptide, the recombinant vector or recombinant strain, or transgenic plant tissue or transgenic plant containing the rice salt-tolerant Ospep5 gene, or tissue culture or protoplasts produced by regenerative cells of the transgenic plant in regulating plant salt tolerance.

[0018] Among them, the application in regulating plant salt tolerance includes a method of increasing the expression amount and / or activity of Ospep5 protein in plants to improve plant salt tolerance; and / or a method of reducing the expression amount and / or activity of Ospep5 protein in plants to reduce plant salt tolerance.

[0019] Wherein, the primers for amplifying the Ospep5 gene are primers for amplifying the coding region of the gene Ospep5; preferably, the sequences of the primers for amplifying the coding region of the Ospep5 gene are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0020] Wherein, the method for increasing the activity of Ospep5 protein in plants is preferably to chemically synthesize Ospep5 peptides in vitro according to the amino acid sequence of rice Ospep5 protein or peptides, and to exogenously apply Ospep5 peptides to plants, wherein the plants are rice or Arabidopsis thaliana.

[0021] Specifically, the present invention synthesizes Ospep5 by an in vitro chemical synthesis method, and sprays it on rice leaves or adds it to a solid culture medium, which can significantly improve the salt tolerance of rice; at the same time, Ospep5 is applied to an Arabidopsis solid culture medium, and it is found that Ospep5 can also significantly improve the salt tolerance of Arabidopsis.

[0022] Among them, the method for increasing the expression level of Ospep5 protein in plants is to overexpress Ospep5 in plants. Preferably, an overexpression box, overexpression recombinant vector, or overexpression recombinant bacteria of the gene Ospep5 is introduced into the plant to overexpress the gene Ospep5 in the plant.

[0023] Among them, the method for reducing the expression of Ospep5 protein in plants is to inhibit the expression of rice Ospep5 gene; preferably, CRISPR / Cas9 technology is used to create an Ospep5 gene knockout mutant, and the Ospep5 gene knockout mutant is prepared by the following steps:

[0024] 1) Designing sgRNA and target sequence primer pairs, the sgRNA is designed according to the nucleotide sequence shown in SEQ ID NO: 1, the target sequence is shown in SEQ ID NO.5, and the primer pair sequences of the target sequence are shown in SEQ ID NO.6 and SEQ ID NO.7.

[0025] 2) The sgRNA expression cassette was constructed by cutting and ligating and overlapping extension PCR and inserted into the linearized pYLsgRNA-OsU3 vector, and then transformed with Agrobacterium and screened.

[0026] The present invention also provides a method for obtaining a highly salt-tolerant plant, the method comprising increasing the expression level and / or activity of the Ospep5 protein in the plant by exogenously applying Ospep5 to the plant or introducing an overexpression box, an overexpression recombinant vector, or an overexpression recombinant bacterium of the Ospep5 gene into the plant, thereby overexpressing the Ospep5 gene in rice.

[0027] The present invention also provides a method for obtaining a low salt-tolerant plant, the method comprising a method for reducing the expression amount and / or activity of the Ospep5 protein in rice, or a method for inhibiting the expression of a nucleic acid molecule capable of expressing the Ospep5 protein in a plant; preferably, the expression of the rice Ospep5 gene is inhibited by using the CRISPR / Cas9 technology; preferably, when the expression of the rice Ospep5 gene is inhibited by using the CRISPR / Cas9 technology, the target sequence is shown in SEQ ID NO: 5.

[0028] The present invention also provides a nucleotide sequence of a down-regulated or inhibited rice Ospep5 gene as shown in SEQ ID NO.8 or SEQ ID NO.9.

[0029] The present invention also provides a method for identifying the plant obtained by the method, comprising the following steps:

[0030] 1) determining whether the plant contains the Ospep5 gene; or,

[0031] 2) Determining whether the plant expresses the protein or peptide.

[0032] In some of the embodiments, the breeding method is: constructing the recombinant vector as described above, and cultivating transgenic rice containing the recombinant vector, wherein the recombinant vector is an overexpression vector.

[0033] In some of the embodiments, the transgenic rice overexpresses the protein encoded by the Ospep5 gene.

[0034] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0035] (1) The present invention is the first to discover a new Ospep5 gene that affects rice salt tolerance. Exogenous application or overexpression of this gene can lead to increased salt tolerance of rice; knocking out this gene can reduce rice salt tolerance. Compared with the wild type, the chlorophyll content of the overexpressed rice is significantly higher than that of the wild type, while the sodium ion content is significantly lower than that of the wild type. The survival rate of these materials after salt stress is also significantly higher than that of the wild type. Compared with the wild type, the chlorophyll content of the knockout mutant of Ospep5 is significantly lower than that of the wild type, while the sodium ion content is significantly higher than that of the wild type. The survival rate of these materials after salt stress is also significantly lower than that of the wild type, indicating that salt tolerance decreases after Ospep5 is knocked out.

[0036] (2) The present invention also uses the Ospep5 gene to improve the salt tolerance of rice through molecular marker-assisted breeding, genetic transformation and gene editing, and cultivates and creates intermediate materials and production varieties with improved salt tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Agarose gel electrophoresis of the PCR product of the target gene Ospep5;

[0038] Figure 2 The application of the small peptide Ospep5 can improve the salt tolerance of rice;

[0039] Figure 3 Adding Ospep5 to the culture medium treatment can improve the salt tolerance of rice;

[0040] Figure 4 The application of small peptide Ospep5 can improve the salt tolerance of Arabidopsis;

[0041] Figure 5 Comparison of salt tolerance between wild type and transgenic rice overexpressing Ospep3-OX3 and Ospep3-OX5;

[0042] Figure 6 This is a diagram for the identification of genes knocked out by Ospep5;

[0043] Figure 7 is the sequencing map of Ospep5 mutant;

[0044] Figure 8 Salt tolerance assay for Ospep5 mutants sensitive to salt. DETAILED DESCRIPTION

[0045] The embodiments of the present invention will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific conditions are specified in the examples, they are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0046] Example 1: Obtaining rice peptide Ospep5

[0047] 1. Seedling cultivation

[0048] Salt-tolerant rice variety Yandao No. 10 (Jiangsu Coastal Agricultural Science Institute) was placed at 30°C for germination for 48 hours and then sown in a greenhouse. When the seedlings grew to two leaves and one heart, salt stress was applied. 125 mM NaCl was added to the Hoagland nutrient solution (Beijing Coolaibo Technology Co., Ltd.) and replaced every 3 days. Samples were taken 12 hours after salt treatment and RNA was extracted.

[0049] 2. RNA Isolation and Extraction

[0050] The sample was frozen with liquid nitrogen in a mortar and ground into powder, added to a 2 mL EP tube containing 1 mL TRNzol-A reagent, and allowed to stand at room temperature for 5 min after sufficient shaking. Then, 0.2 mL chloroform was added, and after vigorous shaking for 15 s, it was allowed to stand at room temperature for 3 min. After centrifugation at 4 °C and 12000 rpm for 10 min, the supernatant was transferred to a new 2 mL EP tube, and an equal volume of isopropanol was added to precipitate RNA. 100 μL RNase-free ddH 2 The total RNA was dissolved in 4% paraformaldehyde and then the quality of the total RNA was determined by electrophoresis, and the RNA content (200 ng / uL) was measured on a spectrophotometer.

[0051] 3. Ribosome Sequencing

[0052] The cell lysate of the above sample was treated with RNase to degrade the RNA not protected by ribosomes, and then the mRNA fragments protected by ribosomes were separated by sucrose density gradient centrifugation. After lysing the cells, the cell lysate was pre-centrifuged at 4°C, 10000-13000rpm for 10min, and then the supernatant was loaded into a 10-45% sucrose density gradient solution containing 20mM Tris-HCl (pH 7.5), 5mM MgCl 2, 100mM NaCl and 50ug / ml cycloheximide. The separation of ribosomes is mostly based on the different sedimentation coefficients of each component, so the speed zone centrifugation method is used. Place the centrifuge tube in the Beckman ultracentrifuge, rotate at 36000-40000rpm, and centrifuge at 4℃ for 2-3h to separate the ribosomal subunits and polyribosomes in the gradient solution. Then use the Biocomp fully automatic density gradient separation system to collect, combine with the ultraviolet detector, detect the absorption of the sample at 260nm, and draw the absorption peak graph in real time. Use the fraction collector to collect samples in different tubes, and the RNA on each ribosomal subunit or polyribosome can be directly obtained by the centrifuge tube number corresponding to the absorption peak graph. The collected RNA is sequenced to obtain sequencing data.

[0053] The data obtained by sequencing were compared with the rice genome, and the data were analyzed by RiboTaper software to obtain ribosome-bound transcripts, among which Ospep5 came from an unknown transcript. The RNA of Salt Rice No. 10 was reverse transcribed to obtain cDNA. According to the sequence of Ospep5, primers Ospep5-F (ATGCTTGATCCAACGCACAT) and Ospep5-R (TCATGATGGTTTCTCGTAGC) were designed for amplification. The reaction conditions were as follows:

[0054]

[0055] The PCR amplification reaction procedure adopted a two-step method, combining annealing and extension at 68 degrees.

[0056] The program was as follows: pre-denaturation: 98°C for 3 min; 35 cycles: denaturation at 98°C for 10 sec; extension at 68°C for 10 sec; insulation at 72°C for 10 min.

[0057] Take 2 μL of PCR product and perform 1% agarose gel electrophoresis to detect the expected size fragment ( Figure 1 ), the remaining PCR products were cleaned and recovered by PCR cleaning kit (purchased from Axygen), cloned into pMD19-T vector (purchased from Takara), and then transformed into E. coli DH5a. Twelve E. coli monoclones were randomly selected for PCR detection in each transformation, and 6 monoclones with positive PCR results were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing to obtain the Ospep5 gene sequence. The gene fragment length was 105 bp, and the sequence was shown in SEQ ID NO: 1.

[0058] Example 2: Rice peptide Ospep5 improves rice salt tolerance

[0059] The Ospep5 small peptide with the amino acid sequence of SEQ ID NO: 2 was synthesized by in vitro chemical synthesis and then treated with ddH 2 O was dissolved. The seeds of salt-sensitive rice variety Lianjing 15 (provided by Lianyungang Agricultural Science Institute in Xuhuai, Jiangsu) were placed in a 45°C oven for one week to break dormancy, and then the surface was disinfected and rinsed and soaked at 28°C for 3 days. The seeds with uniform germination were sown in a 96-well PCR plate with the bottom removed and cultured in an artificial climate chamber with deionized water. The culture conditions were: 14 hours of light (28°C) / 10 hours of darkness (24°C), and the light intensity was 800 μmol·m -2 ·s -1 , relative humidity 70%. After one week, the seedlings were transferred to rice culture medium (Hoagland) for continued cultivation, and the culture medium was replaced every 3 days.

[0060] When the seedlings grew to the two-leaf and one-heart stage, salt stress was applied by adding 125 mM NaCl and 125 mM NaCl + 100 nM Ospep5 peptide to the rice culture medium for 6 to 8 days. During this period, the phenotype was observed and photographed. Figure 2 As shown, after treatment with 125 mM NaCl, the wild type showed an obvious salt-sensitive phenotype, namely yellowing and wilting, and significantly inhibited growth, while the rice treated with the small peptide Ospep5 showed strong salt tolerance, and was significantly better than the rice without the small peptide in terms of survival rate, fresh weight, chlorophyll content, MDA content and other indicators.

[0061] At the same time, we conducted salt treatment experiments in 1 / 2MS solid culture medium and found that the growth of rice seedlings with the addition of small peptide Ospep5 was significantly better than that of rice seedlings without small peptide. The small peptide Ospep5 concentration was effective between 10pM-1nM. At a concentration of 1nM, the survival rate, fresh weight, chlorophyll content and root length of rice seedlings were better than those without the addition of small peptide ( Figure 3 ).

[0062] Example 3: Rice peptide Ospep5 improves salt tolerance in Arabidopsis

[0063] Take wild-type Arabidopsis seeds and wash them with 75% ethanol solution for 3 minutes. Discard the ethanol and add 1 mL of a mixed solution of 35% NaClO solution and 0.05% Tween 20 by volume. Gently shake and mix for 5 minutes, and discard the mixed solution. Finally, add 1 mL of sterile ultrapure water, wash 5 times, and place at 4°C away from light for vernalization for 2 days.

[0064] The sterilized and vernalized seeds were spotted on 1 / 2MS medium and cultured vertically at 22°C, 16h light / 8h dark for 5 days. They were then transplanted to 1 / 2MS medium supplemented with 125mM NaCl and different concentrations of Ospep5 peptide (10pM, 100pM, 1nM) and cultured for 7 more days to evaluate their growth. Figure 4 As shown, Arabidopsis thaliana was sensitive to salt in 125mM NaCl. After adding different concentrations of the small peptide Ospep5, it showed a certain salt tolerance, among which the small peptide at a concentration of 100pM had the highest salt tolerance. The fresh weight, root length and chlorophyll content of Arabidopsis thaliana seedlings were better than those without the addition of the small peptide.

[0065] Example 4: Construction of transgenic rice overexpressing the small peptide Ospep5 and detection of salt tolerance

[0066] 1. Construction of transgenic rice overexpressing the small peptide Ospep5

[0067] According to the sequences at the 5' and 3' ends of the Ospep5 coding region, the forward and reverse primers gttacttctgcactaggtaccATGCTTGATCCAACGCACAT (SEQ ID NO.3) and the reverse primer tcttagaattcccggggatccTCATGATGGTTTCTCGTAGC (SEQ ID NO.4) were designed, and the full length of Ospep5 was obtained by amplification using the DNA of rice Nipponbare as a template. The reaction conditions are as follows:

[0068]

[0069] The PCR amplification reaction procedure adopted a two-step method, combining annealing and extension at 68°C.

[0070] The program was as follows: pre-denaturation: 98°C for 3 min; 35 cycles: denaturation at 98°C for 10 sec; extension at 68°C for 10 sec; insulation at 72°C for 10 min.

[0071] After the PCR product was recovered and purified, the amplified product was connected to the binary vector pCAMBIA1309 containing an overexpression promoter (CMV 35S) by infusion, transformed into Escherichia coli DH5α, and the positive plasmid was extracted and sequenced. The positive transgenic seedlings were screened by the method of Agrobacterium transformation of rice embryonic callus. After two generations of self-pollination, two single-copy pure transgenic lines were obtained, named Ospep5-OX3 and Ospep5-OX5.

[0072] 2. Salt tolerance test

[0073] Referring to the salt tolerance detection method in Example 2, the salt tolerance of wild type and transgenic rice overexpressing Ospep5-OX3 and Ospep5-OX5 was compared. The results showed that after 6 days of 125mM NaCl treatment, the salt tolerance of the two transgenic rice lines overexpressing Ospep5, Ospep5-OX3 and Ospep5-OX5, was improved compared with the wild type, and the survival rate of the seedlings was improved. The fresh weight, root length and chlorophyll content of Ospep5-OX3 and Ospep5-OX5 after salt treatment were significantly higher than those of the wild type. + The content was significantly lower than that of wild type ( Figure 5 These results suggest that overexpression of Ospep5 can significantly improve the salt tolerance of rice.

[0074] Example 5: Construction of CRISPR mutant of Ospep5 and detection of salt tolerance

[0075] 1. Construction of CRISPR mutants

[0076] The PAM sequence in Ospep5 was selected, and the 17-36 bp (CATGTTCGTCCAGCCTCACG) (SEQ ID NO. 5) of Ospep5 was determined as the target sequence. The adapter primers were as follows:

[0077] Ospep5-Spacer-F: 5'-TGTGcatgttcgtccagcctcacg-3' (SEQ ID NO.6)

[0078] Ospep5-Spacer-R: 5'-AAACcgtgaggctggacgaacatg-3' (SEQ ID NO.7)

[0079] The target sequence is driven by the U3 promoter.

[0080] 2. Construction of pYLCRISPR / Cas9-Ospep5 gene editing vector

[0081] (1) Target linker preparation

[0082] 10 μL of each target sequence adapter primer (Ospep5-Spacer-F and Ospep5-Spacer-R) was mixed and denatured at 90°C for 30 seconds, and then slowly annealed at a rate of 0.1°C / min to prepare the target adapter Ospep5 Spacer

[0083] (2) Preparation of sgRNA expression cassette

[0084] The connection reaction was carried out according to the following reaction system:

[0085]

[0086]

[0087] After mixing, the mixture was incubated at 37°C for 5 min and 20°C for 5 min for 5 cycles to obtain a template for preparing the sgRNA expression cassette.

[0088] pYLsgRNA-OsU3a is an intermediate vector, which is the sgRNA expression cassette promoter and guide sequence skeleton, and was developed by the team of Academician Liu Yaoguang of South China Agricultural University, referring to Ma et al. (2016), Mol Plant. 9(7): 961-74.

[0089] (3) Amplification of sgRNA expression cassette

[0090] (a) First round of amplification:

[0091] PCR amplification was performed using primer combination 1: forward primer: CTCCGTTTTACCTGTGGAATCG and target sequence adapter reverse primer: AAACcgtgaggctggacgaacatg according to the following reaction system:

[0092]

[0093] The PCR reaction program was: 94°C for 1 min; 98°C for 10 s, 60°C for 15 s, 68°C for 20 s, and 28 cycles; the product 1 for preparing the Spacer expression cassette was obtained and was directly used in subsequent experiments or stored at -20°C.

[0094] PCR amplification was performed using primer combination 2: reverse primer: CGGAGGAAAATTCCATCCAC and target sequence adapter forward primer: TGTGcatgttcgtccagcctcacg according to the following reaction system:

[0095]

[0096]

[0097] The PCR reaction program was: 94°C for 1 min; 98°C for 10 s, 60°C for 15 s, 68°C for 20 s, and 28 cycles; the product 2 for preparing the Spacer expression cassette was obtained and was directly used in subsequent experiments or stored at -20°C.

[0098] (b) Second round of amplification: Using Uctcg-B1' and gRcggt-B2 as amplification primers, a second round of PCR was performed on the products 1 and 2 obtained from the first round of PCR to obtain the Spacer expression cassette;

[0099]

[0100] The PCR reaction program was: 94°C for 2 min; 98°C for 10 s, 58°C for 15 s, 68°C for 20 s, and 25 cycles; the obtained Spacer expression cassette was directly used in subsequent experiments or stored at -20°C.

[0101] Uctcg-B1':TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG

[0102] gRcggt-B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC

[0103] (4) sgRNA expression cassette connection

[0104] Connect the sgRNA expression cassette according to the following reaction system

[0105]

[0106] After mixing, incubate at 37°C for 10 min, add 0.5 μL T4 buffer and 0.1 μL T4 enzyme (5 U / μL), and incubate at 37°C for 2 min; 10°C for 3 min, 20°C for 5 min, 15 cycles, and then incubate at 37°C for 2 min.

[0107] (5) E. coli transformation and verification

[0108] The ligation product was transformed into E. coli DH5α by heat shock method, and the bacterial solution was spread on LB plate containing 50 mg / L kanamycin and cultured for 12 hours. Single colonies grown on the plate were picked and propagated by shaking. PCR verification was performed using the bacterial solution as a template.

[0109] The PCR reaction system is:

[0110]

[0111] The PCR reaction program was: 95℃10min; 95℃30s, 51℃30s, 72℃45s, 28 cycles; 72℃5min. The amplified product was photographed and recorded by agarose electrophoresis. The bacterial solution containing the target band was sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were consistent with expectations, and the plant expression final vector plasmid CRISPR / Cas9-Ospep5 was obtained.

[0112] (6)T 0 Obtaining the first generation of Ospep5 gene-edited plants

[0113] The CRISPR / Cas9-Ospep5 plasmid was transferred into the Agrobacterium strain EHA105. The rice variety Nipponbare was transformed using the Agrobacterium-mediated method.

[0114] Example 6: Obtaining plants without T-DNA insertion and analysis of Ospep5 gene knockout

[0115] The T0-generation genome-edited plants of Nipponbare were planted in an incubator, self-pollinated, and seeds were harvested. After the seeds broke dormancy, they were soaked, sown in seedling trays, and placed in a culture room. When the seedlings grew to two leaves and one heart, the genomic DNA of the plants was extracted by the CTAB method. The Hpt gene primers encoding hygromycin (35S-NTF1: 5'-ACAATCCCACTATCCTTCGCAAG-3', HYG-TR2: 5'-GTACTTCTACACAGCCATCGGTC-3'), the Cas9 gene primers encoding Cas9 nuclease (UBI-F1-NEW: 5'-tttccccaacctcgtgttgttc-3', CL-R2-NEW: 5'-gaggttcttcttgatggagtgg-3') and the Ospep5 encoding gene primers (Ospep5-F and Ospep5-R) were used for detection.

[0116] The PCR reaction system is 2.6 μL of sterile water, 2.0 μL of primers (10 pM), 1.0 μL of each of the front and rear primers, 1.0 μL of diluted DNA template (100 ng / uL), 0.4 μL of DNA polymerase, 10 μL of dedicated buffer, and 4 μL of dNTPs.

[0117] The PCR reaction conditions were as follows: pre-denaturation at 96°C for 3 min; denaturation at 98°C for 100 sec, annealing at 60°C for 30 sec, and extension at 68°C for 30 sec, for 32 cycles; and finally extension at 68°C for 5 min.

[0118] The PCR reaction was carried out in an Eppendorf Mastercycle thermal cycler. The amplified products were separated by agarose gel electrophoresis, photographed in a gel imager, and the results were recorded. The amplification results of Ospep5 gene, Hpt gene, and Cas9 gene are shown in Figure 6 . Figure 6 This indicates that both Ospep5-2 and Ospep5-3 have mutations.

[0119] To further determine the base mutation of Ospep5 gene in Ospep5-2 and Ospep5-3, primers Ospep5-F and Ospep5-R were used to amplify the target site and sequence analysis was performed. The results showed that compared with wild-type Ospep5, the Ospep5 gene sequences of Ospep5-2 and Ospep5-3 lacked 2bp (SEQ ID NO: 8) and 24bp (SEQ ID NO: 9). Figure 7 shown.

[0120] Example 7 Salt tolerance test of Ospep5 mutants

[0121] Referring to the salt tolerance detection method in Example 2, the salt tolerance of the wild type and the knockout mutants Ospep5-2 and Ospep5-3 was compared. The results showed that after 6 days of 125mM NaCl treatment, the salt tolerance of the two knockout mutants Ospep5-2 and Ospep5-3 was lower than that of the wild type, and the survival rate of the seedlings was reduced. The fresh weight, root length, and chlorophyll content of Ospep5-2 and Ospep5-3 after salt treatment were significantly lower than those of the wild type. + The content was significantly lower than that of wild type. These results showed that knocking out Ospep5 could reduce the salt tolerance of rice ( Figure 8 ).

Claims

1. A rice salt-tolerant Ospep5 gene, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A protein or small peptide encoded by the rice salt-tolerant Ospep5 gene according to claim 1, characterized in that: The amino acid sequence of the protein or small peptide is shown in SEQ ID NO.

2.

3. An expression cassette, a recombinant vector or a recombinant strain, characterized in that: It comprises the rice salt-tolerant Ospep5 gene according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The recombinant vector is a knockout vector, a knockdown vector or an overexpression vector.

5. Use of the rice salt-tolerant Ospep5 gene according to claim 1, the protein or small peptide according to claim 2, the expression cassette, recombinant vector or recombinant strain according to claim 3, or transgenic plant tissue or transgenic plant containing the rice salt-tolerant Ospep5 gene according to claim 1, or tissue culture or protoplasts produced by regenerative cells of the transgenic plant in regulating plant salt tolerance, wherein the use in regulating plant salt tolerance is a method for increasing the expression amount of Ospep5 protein in plants to improve the salt tolerance of plants; the plant is rice or Arabidopsis thaliana, and the recombinant strain is Agrobacterium.

6. The use according to claim 5, characterized in that: The primers for amplifying the Ospep5 gene are primers for amplifying the coding region of the Ospep5 gene. The sequences of the primers for amplifying the coding region of the Ospep5 gene are shown in SEQ ID NO. 3 and SEQ ID NO.

4.

7. The use according to claim 5, characterized in that: The method for increasing the expression level of Ospep5 protein in plants is to chemically synthesize Ospep5 protein or small peptide in vitro according to the amino acid sequence of rice Ospep5 protein or small peptide, and apply Ospep5 protein or small peptide to plants exogenously.

8. The use according to claim 5, characterized in that: The method for increasing the expression level of Ospep5 protein in plants is to overexpress Ospep5 protein in plants.

9. The use according to claim 8, characterized in that: The method for increasing the expression level of Ospep5 protein in plants is to introduce an overexpression box, an overexpression recombinant vector or an overexpression recombinant bacterium of the Ospep5 gene into the plants to overexpress the Ospep5 gene in the plants.

10. A method for obtaining a plant with high salt tolerance, characterized in that: The method comprises increasing the expression level of the Ospep5 protein according to claim 2 in the plant or exogenously applying the Ospep5 protein or small peptide according to claim 2 in the plant or introducing the overexpression box, overexpression recombinant vector, overexpression recombinant bacteria of the Ospep5 gene according to claim 1 into the plant to overexpress the Ospep5 gene in rice, wherein the plant is rice or Arabidopsis thaliana.

Images