Method for improving AAV packaging efficiency using IRES gene and its functional gene

Abstract

The present invention relates to a method for improving the packaging efficiency of AAV by using IRES gene and its functional gene. The method comprises: constructing a functional gene sequence into a predetermined expression vector; constructing the obtained expression vector and transfecting it into a target cell to obtain AAV by culturing and expressing. The functional gene sequence is derived from or similar to the IRES gene, and its sequence is a sequence shown in one of SEQ ID NO.1, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6 or its complementary sequence. The present invention can effectively adjust the expression ratio of Cap and Rep by utilizing a functional gene sequence derived from or similar to the IRES gene; applying the functional gene sequence to the expression vector can effectively improve the production efficiency of AAV.

Description

Technical Field

[0001] The present invention relates to a method for improving AAV packaging efficiency by utilizing IRES gene and its functional gene, belonging to the technical field of biomedicine. Background Art

[0002] Adeno-associated virus (AAV) is a subtype of adenovirus discovered during adenovirus research. It mainly uses some genomic elements of adenovirus as its components. It differs from adenovirus in that it is a single-stranded DNA virus and cannot proliferate in healthy cells without adenovirus genes. By removing or splitting the genetic elements of the virus itself to ensure the safety of vector applications, AAV vectors have been used to develop gene therapy drugs. In addition, AAV has a variety of serotypes to adapt to different treatment targets, which is more flexible in application; and compared with retroviruses, it can provide better safety for patients at the level of genetic stability.

[0003] With the development of cell and gene therapy, several AAV viral vector applications have entered the late clinical stage and obtained drug approval. However, due to the extremely high titer of the viral vectors required by patients, the industrial production efficiency of AAV viral vectors is still an important issue that must be solved. The production efficiency must be improved to effectively reduce the burden on the demanders.

[0004] One of the conventional methods of AAV vector packaging is to use the HEK293 cell line with three nucleic acid vectors; among them, because HEK293 uses the genome of adenovirus during its establishment, the E1 element left in the HEK293 cells can provide the ability to package AAV vectors. At the same time, the three nucleic acid vectors are respectively involved in some functions of vector packaging, including (1) some gene elements of adenovirus (Helper plasmid), (2) viral replication and packaging capsid protein (Rep / Cap plasmid), and (3) identification sequence of virus package containing target gene (ITRs-GOI plasmid). The applicant of the present invention mainly optimizes the nucleic acid vector (Rep / Cap plasmid) for viral replication and packaging capsid protein.

[0005] The original Rep / Cap plasmid mainly uses the promoters (P5, P19, P40) on its genome to sequentially express Rep and Cap proteins. The Rep / Cap plasmid mainly uses the P5 and P19 promoters to express Rep proteins, and the main function of Rep proteins is to replicate the viral genome, thereby providing viral nucleic acid elements and assisting in the integration of nucleic acid elements into the capsid of the viral vector. The expression of Cap protein is regulated by the P40 promoter, and the messenger RNA of Cap can be translated into three major secondary proteins, VP1, VP2 and VP3, to form the main external structural proteins of the viral vector. The element structure diagram of the Rep / Cap plasmid is shown inFigure 1 .

[0006] The general Rep / Cap plasmid mainly regulates virus production by expressing Rep and Cap proteins through the promoters (P5, P19, P40) in the genome, which can ensure the co-expression of Rep and Cap. However, some studies have pointed out that under this expression mechanism, a high amount of Rep protein will accumulate in the late stage of viral vectors, and Rep protein has the characteristics of interfering with cell growth, thus affecting the production of viral vectors.

[0007] In order to reduce the impact of Rep protein on host cells, constructing an expression vector and using promoters with different expression strengths to regulate the expression ratio of Rep and Cap genes can be used as a strategy for vector optimization. Although the promoters that can be used in mammalian cells include CMV, Ef1a, SV40 and PGK, these elements cannot ensure the simultaneous expression of Rep and Cap genes. IRES and 2A peptides are currently commonly used elements in expression vectors and can ensure the co-expression of upstream and downstream genes during the RNA translation stage or protein post-modification stage.

[0008] The internal ribosome entry site (IRES) is a genetic element found in viruses. Later, researchers used it in eukaryotic expression vectors based on its characteristics, and it is widely used in eukaryotic protein expression for experiments and pharmaceuticals. Generally speaking, messenger RNA (mRNA) mainly relies on its 5' end capping modification to allow ribosomes to bind and initiate gene translation. Adding an IRES element to the 5' end of mRNA allows mRNA to allow ribosomes to bind and initiate gene translation without relying on the 5' end capping modification of mRNA. This function is different from the splicing of mRNA, but allows multiple genes to share a promoter. Because this function mainly occurs in the translation stage, it can also ensure the simultaneous transcription of genes upstream and downstream of IRES. The applicant of the present invention optimized the Rep / Cap plasmid with IRES as the research direction.

[0009] After searching, it was found that the invention patent application with application number CN201980069110.4 and application publication number CN112888426A disclosed a plasmid system for the production of recombinant adeno-associated virus vector rAAV, and mentioned the internal ribosome entry site (IRES) in its specification. The invention patent application with application number CN202080022021.7 and application publication number CN113631225A disclosed a method and system for producing AAV particles, and mentioned in its specification the use of the IRES sequence to ensure the co-expression of genes before and after the IRES, although the sequence after the IRES can be transcribed and translated at a lower level than the sequence before the IRES sequence. However, the above patent documents do not mention how to use IRES to optimize the Rep / Cap plasmid in more depth, so as to maximize the production efficiency of AAV. Summary of the invention

[0010] The main purpose of the present invention is to overcome the problems existing in the prior art and provide a method for improving the packaging efficiency of AAV using IRES gene, which can effectively improve the production efficiency of AAV. At the same time, functional genes applied to the method and their uses are provided.

[0011] The technical solution of the present invention to solve the technical problem is as follows:

[0012] A method for improving AAV packaging efficiency by using IRES gene, characterized in that it comprises the following steps: constructing a functional gene sequence into a predetermined expression vector; transfecting the constructed expression vector into target cells and obtaining AAV through culture and expression; the functional gene sequence is derived from or similar to the IRES gene, and its sequence is one of the sequences shown in SEQ ID NO.1, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or its complementary sequence.

[0013] In practical research, the inventors used different transcription start sites of IRES to further optimize the Rep / Cap plasmid, and finally found that the above-mentioned functional gene sequence can effectively adjust the expression ratio of Cap and Rep. Applying this functional gene sequence to the expression vector can effectively improve the production efficiency of AAV.

[0014] Preferably, the functional gene sequence is a sequence shown in one of SEQ ID NO.5 and SEQ ID NO.6 or a complementary sequence thereof.

[0015] By adopting the above preferred scheme, the specific sequence of the functional gene can be further optimized.

[0016] Preferably, the constructed expression vector contains the viral replication protein gene AAV-Rep of the adeno-associated virus and the viral packaging capsid protein gene AAV-Cap of the adeno-associated virus; the viral packaging capsid protein gene AAV-Cap of the adeno-associated virus is located upstream of the functional gene sequence, and the viral replication protein gene AAV-Rep of the adeno-associated virus is located downstream of the functional gene sequence; the viral packaging capsid protein gene AAV-Cap of the adeno-associated virus is as shown in SEQ ID NO.2; the viral replication protein gene AAV-Rep of the adeno-associated virus is as shown in SEQ ID NO.3.

[0017] Preferably, the predetermined expression vector is an expression vector for expressing viral replication protein and viral packaging capsid protein of adeno-associated virus; and the functional gene sequence is derived from or similar to the IRES gene of EMCV.

[0018] By adopting the above preferred scheme, the specific structure of the expression vector and the specific location of the functional gene sequence therein can be further optimized.

[0019] Preferably, the target cells also contain an AAV-ITR-EGFP expression vector and an AAV-Helper helper vector; the target cells include but are not limited to HEK293 cells.

[0020] By adopting the above preferred scheme, the specific detailed characteristics of the target cells can be further optimized.

[0021] The present invention also provides:

[0022] A functional gene for improving AAV packaging efficiency, characterized in that the functional gene sequence is derived from or similar to the IRES gene, and its sequence is one of SEQ ID NO.1, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or its complementary sequence.

[0023] Preferably, the functional gene sequence is a sequence shown in one of SEQ ID NO.5 and SEQ ID NO.6 or a complementary sequence thereof.

[0024] The present invention also provides:

[0025] An expression vector containing the functional gene described above.

[0026] Preferably, the expression vector is a PSC-CMV vector.

[0027] The present invention also provides:

[0028] The functional gene or expression vector described above is used for preparing AAV or for preparing drugs or for pharmaceutical production.

[0029] Compared with the prior art, the present invention can effectively adjust the expression ratio of Cap and Rep by utilizing a functional gene sequence from or similar to the IRES gene; applying the functional gene sequence to an expression vector can effectively improve the production efficiency of AAV. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a diagram of the component architecture of the Rep / Cap plasmid mentioned in the background technology of the present invention.

[0031] Figure 2 This is the structure of the expression vector constructed in Example 1 of the present invention.

[0032] Figure 3 Schematic diagram of different endings of IRES0, IRES1, IRES2 and IRES3 in Example 1 of the present invention.

[0033] Figures 4 to 7 The maps of the expression vectors constructed in Example 1 of the present invention are respectively shown.

[0034] Figure 8 This is a map of the AAV-ITR-EGFP expression vector of Example 2 of the present invention.

[0035] Fig. 9 This is the AAV-Helper helper vector map of Example 2 of the present invention.

[0036] Fig.10 This is a graph showing the evaluation results of AAV production capacity of Example 2 of the present invention, wherein Figure A shows the results of using the first Sipeng 293 culture medium, and Figure B shows the results of using the second Sipeng 293 culture medium. DETAILED DESCRIPTION

[0037] The present invention will be described in further detail below with reference to the accompanying drawings and in combination with embodiments, but the present invention is not limited to the examples given.

[0038] Example 1

[0039] according to Figure 2 The structure shown in the figure is used to construct an expression vector, which contains genes for viral replication and packaging capsid protein of adeno-associated virus; wherein IRES is derived from EMCV (encephalomyocarditis virus), i.e., sequence 1, as shown in SEQ ID NO.1; Cap is derived from AAV, as shown in SEQ ID NO.2; Rep is derived from AAV, as shown in SEQ ID NO.3.

[0040] Sequence 1: SEQ ID NO.1:

[0041] cgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctcccctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgcttttcatgtgtttagtcgaggttaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatatggccacaaccatg

[0042] AAV-Cap:SEQ ID NO.2:

[0043]

[0044] AAV-Rep:SEQ ID NO.3:

[0045]

[0046] The inventors explored the effects of different transcription start sites of IRES on the expression ratio of Cap to Rep in Rep / Cap plasmids. Figure 3 The sequence 1 with different AT(U)G start sites (i.e., IRES0, IRES1, IRES2, and IRES3 with different endings, wherein IRES1 is modified based on the original sequence) is combined with AAV-Cap (SEQ ID NO.2) and AAV-Rep (SEQ ID NO.3), and the expression vectors are constructed using PSC-CMV vectors. The resulting vector maps are shown in FIG. Figures 4 to 7 As shown, "EMCV-IRES" in each figure refers to the corresponding IRES0, IRES1, IRES2, and IRES3.

[0047] IRES0: SEQ ID NO.4:

[0048] cgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggt ctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggt gcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctcccctcaagcgtattcaacaaggggctgaagga tgcccagaaggtaccccattgtatggggatctgatctggggcctcggtgcacatgcttttcatgtgtttagtcgaggttaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaacacgatg

[0049] IRES1: SEQ ID NO.5:

[0050] cgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctcccctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgcttttcatgtgtttagtcgaggttaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataataccatg

[0051] IRES2:SEQ ID NO.6:

[0052] cgttatactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtct ttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcct ctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctcccctcaagcgtattcaacaaggggctgaaggatgccca gaaggtaccccattgtatggggatctgatctggggcctcggtgcacatgcttttcatgtgtttagtcgaggttaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatatg

[0053] The IRES3 sequence is SEQ ID NO.1.

[0054] Example 2

[0055] In this example, each expression vector constructed in Example 1 is matched with an AAV-ITR-EGFP expression vector (the prior art vector, see the diagram). Figure 8 ) and AAV-Helper help vector (existing technology vector, map see Fig. 9 ), and the AAV production capacity was evaluated in HEK293 cells. The specific experimental process is shown in the last part of this example.

[0056] Experimental data such as Fig.10 As shown in Figures A and B, these results indicate that good expression effects can be achieved by using IRES0, IRES1, IRES2, and IRES3, among which IRES-1 and IRES-2 are more prominent. That is, using IRES-1 or IRES-2 to regulate the viral replication of adeno-associated virus and the expression of packaging capsid protein genes can more effectively improve AAV production capacity.

[0057] The specific experimental process involved in this embodiment is as follows:

[0058] (I) AAV expression test

[0059] HEK293 cells (VPC2.0 cell line) were cultured and expanded using two commercially available 293 culture media with 4mM L-Glutamine. Note: Since the amino acid, organic salt and inorganic salt ratios of each commercially available 293 culture medium are different, two commercially available 293 culture media were used to verify whether the function of IRES0-IRES3 would be deviated due to differences in culture medium components. The final results showed that the function of IRES0-IRES3 was not affected by differences in culture medium components and maintained a high degree of consistency.

[0060] AAV vectors (including: each expression vector of Example 1, AAV-ITR-EGFP expression vector, AAV-Helper helper vector) were transfected into HEK293 cell line using PolyPlus transfection reagent. Cells were collected 3 days after transfection and lysed with acidic solution to recover AAV viral vectors. To detect the amount of AAV viral vectors, DNase was used to remove residual DNA in host cells and then alkaline lysis solution was used to release AAV genomic nucleic acid.

[0061] The number of AAV genome nucleic acid copies released was detected by Q-PCR, and the number of AAV viral vectors was inferred, and the degree of improvement in AAV production capacity was evaluated by comparison.

[0062] (II) Sipeng Bio 293 Medium AAV Transfection Guide: FectoVIR-AAV

[0063] 1. Culture medium and reagents:

[0064] (1) Sipeng 293 culture medium

[0065] (2)FectoVIR-AAV Transfection Reagent(PolyPlus,Ref#120-101)

[0066] (3) Nucleic acid carrier: 260 / 280 ratio is between 1.8 and 2.0. Concentration is greater than 1 μg / μL.

[0067] (4) Dilution medium: the same Sipeng 293 medium as (1)

[0068] 2. Cells: HEK293 cell line

[0069] ① 18 to 24 hours before transfection, use 2 to 2.5 × 10 6 Cells were inoculated at a viable cell density of cells / mL.

[0070] ② On the day of transfection, the cell density was adjusted to 3.0×10 6 cells / mL viable cell density for transfection.

[0071] 3. Transfection:

[0072] (1) Prepare the Reagent-DNA mixture

[0073] ① Evenly mix the transfection reagent and add it to the polypropylene tube (tube 1) for later use.

[0074] ② Prepare a dilution of 10% of the final culture volume in a polypropylene tube (tube 2).

[0075] ③ Add DNA to the diluent (tube 2) and mix well (shake or oscillate up and down).

[0076] ④ Add the DNA diluent (tube 2) to the tube with transfection reagent (tube 1) and mix immediately (shake up and down or vortex for 5 seconds).

[0077] ⑤ Let the Reagent-DNA mixture stand at room temperature for 10 to 15 minutes.

[0078] (2) Transfection

[0079] ① Add the incubated Reagent-DNA mixture evenly to the cells.

[0080] (3) Cultivation

[0081] ① Add 3g / L glucose 18 to 22 hours after transfection.

[0082] ② Harvest the virus 3 days after transfection.

[0083] Note: After optimizing transfection conditions, cell viability should be higher than 70% 3 days after transfection.

[0084] Recommended transfection conditions:

[0085]

[0086] Note: The above table shows the requirements for each mL of transfection system.

[0087] Recommended carrier ratio:

[0088] Expression vector Molar Ratio Vector size (kbp) μg DNA / mL culture medium AAV-Rep / Cap 2 Exp:9 0.95 AAV-Helper 0.5 Exp:11 0.29 AAV-ITR-EGFP 1 Exp:5 0.26

[0089] Note: The above table is calculated based on a total amount of 1.5 μg DNA.

[0090] (III) AAV preparation process

[0091] Cells were lysed in acidic solution, cleared from debris by centrifugation, and the pH was neutralized with HEPES buffer.

[0092] Reagents:

[0093] (1) AAV release solution (110 mM citric acid buffer pH 4.2):

[0094] 55mM citric acid, 55mM sodium citrate, 800mM sodium chloride

[0095]

[0096] (2) AAV neutralization solution: 2M HEPES; pH 8.0

[0097] Chemical substances Molecular weight Final concentration g / L 10mL Hepes 238.3 2M 476.6 4.766g

[0098] Note: Dissolve Hepes using 2 mL of ddH2O. Then, adjust the pH to 8.0 using 2-3 mL of sodium hydroxide (10N). Finally, adjust the volume to 10 mL with ddH2O.

[0099] Operating procedures:

[0100] 1. Take 0.5 mL of cells and remove the culture medium by centrifugation at 750-800 × g, 4°C for 15 min.

[0101] 2. Discard the supernatant.

[0102] 3. Tap to loosen the cell pellet and add 1 mL of PBS to wash the cells.

[0103] NOTE: Extraction efficiency may be reduced if the cell pellet is not adequately suspended.

[0104] 4. Disperse the cells by vortexing and remove the PBS by centrifugation at 1000 × g, 4°C for 15 min.

[0105] 5. Loosen the cell pellet by tapping and add an appropriate volume (0.5 mL) of AAV release solution.

[0106] Note: Make sure to completely remove PBS; residual PBS will affect the acidity of the citrate buffer and thus affect the extraction efficiency of viral particles.

[0107] 6. Resuspend the cells by vortexing for 15 seconds and let stand at room temperature for 10 minutes.

[0108] 7. Vortex for 15 seconds and remove cell debris by centrifugation at 14,000 × g, 4°C for 15 minutes.

[0109] 8. Collect the supernatant into a new tube.

[0110] Note: Phenol red is added to facilitate observation during further titration.

[0111] 9. Measure the volume of the supernatant and add ~1 / 2 volume of AAV Neutralization Solution (0.1 mL) with continuous mixing. The final pH should be around 8.0.

[0112] Note: If phenol red is added, the solution should change from yellow (acid pH) to pink (pH ~ 8.0); the mixture can be stored at -80°C. Thaw quickly in a 37°C water bath for the next experiment.

[0113] (IV) AAV titration qPCR process

[0114] Reagents:

[0115] (1) DNaseI: DNaseI, RNase-free (1 U / μl); reaction buffer (10×).

[0116] (2) 2× capsid lysis buffer:

[0117] 0.5M NaOH, 0.2M EDTA

[0118] Chemical substances Molecular weight Final concentration g / L 10mL Sodium hydroxide 40.00 0.5 M 20 0.2g Tetrasodium salt: hydrate 380.17 0.2M 76.034 0.76g

[0119] (3) 0.5M trihydrochloride (pH 8.0)

[0120] Chemical substances Molecular weight Final concentration L / L 20mL 1M Tris-HCl, pH 8.0 N / A 0.5M 0.5 10mL

[0121] (4) Premixed Pre-Taq TM II (TliRNaseHPlus)

[0122] (5) Primers:

[0123] ①ITR-Fwd: Forward ITR sequence primer (5'-GGAACCCCTAGTGATGGAGTT-3')

[0124] ②ITR-Rev: Reverse ITR sequence primer (5'-CGGCCTCAGTGAGCGA-3')

[0125] ③EGFP-F498: Forward EGFP sequence primer (5'-CAAGATCCGCCACAACATCG-3')

[0126] ④EGFP-R617: Reverse EGFP sequence primer (5'-GACTGGGTGCTCAGGTAGTG-3')

[0127] Note: Although using primer pairs to amplify ITR sequences may be a universal approach to characterize different AAV genomes, it may overestimate the true potency of the preparation. It is recommended to use specific primers for the region of interest (e.g., short hairpin cassette).

[0128] Operating procedures:

[0129] 1. Use DNaseI to digest and remove DNA outside the virus.

[0130] a. Mix 2 μL of virus suspension, 2 μL of 10× DNaseI reaction buffer, 2 μL of DNaseI, and 14 μL of nuclease-free water.

[0131] b. Incubate at 37°C for 20 min.

[0132] 2. Release of viral DNA by alkaline lysis.

[0133] a. Add 20 μL of 2× capsid lysis buffer and mix well.

[0134] b. Incubate at 95°C for 10 min.

[0135] c. Add 10 μL 0.5 M Tris-HCl (pH 8.0) to stop the cleavage reaction.

[0136] d. Prepare a 50-fold dilution of the lysis reaction with nuclease-free water.

[0137] 3. Quantify viral DNA using qPCR method.

[0138] a. Using a plasmid containing an ITR sequence, prepare a 5-fold serial dilution ranging from 4 ng / μL (~1×10 9 dsDNA molecules / μL).

[0139] (1) To determine the number of dsDNA molecules per ng, open the plasmid sequence using SnapGeneViewer software (free for Windows and Mac platforms). Select "Show DNA Calculations" from the "Tools" drop-down menu. A pop-up window will provide the conversion of molecular weight and ng to plasmid copies. Since the viral genome is composed of ssDNA, the detection of one plasmid DNA (dsDNA) molecule is equivalent to two AAV vector genome (vg) copies.

[0140] (2) In a final volume of 10 μL, mix 1.5 μL of template (standard dilution or 100-fold sample dilution), 0.5 μL of 10 μM ITR-Fwd, 0.5 μL of 10 μM ITR-Rev, and 5 μL of Premix ExTaq TM II.

[0141] (3) PCR reaction was performed on LC480II under the following conditions:

[0142] 1 st feature:

[0143] 95°C for 30 s (ramp rate 4.4°C / s): 1 cycle.

[0144] 2 nd PCR (analysis method: quantitative):

[0145] 95°C for 5 s (ramp rate 4.4°C / s), 60°C for 30 s (ramp rate 2.2°C / s, acquisition mode: single): 40 cycles.

[0146] 3 rd Melting (analysis method: melting curve):

[0147] 95℃5s (ramp rate 4.4℃ / s), 60℃1m (ramp rate 0.11℃ / s, acquisition mode: continuous, acquisition method: 5 / ℃): 1 cycle.

[0148] 4 th cool down

[0149] 50°C for 30 s (ramp rate 2.2°C / s): 1 cycle.

[0150] To obtain the final titer of the sample (expressed in vg / μL), multiply 5000 by the interpolated quantified viral genome copy value from the standard curve.

[0151] Based on the above embodiments, according to AAV-related literature and viral vector production mechanism, it is speculated that the expression requirement of Cap protein is higher than that of Rep protein. Therefore, the present invention uses IRES to connect Cap and Rep to ensure the co-chaperone effect of transcription and relatively reduce the expression of Rep. On this basis, the inventors experimentally explored and verified the influence of different starting ATG (AUG) in the IRES element used for downstream genes on the AAV production efficiency, and then obtained the appropriate downstream gene translation start point to achieve the highest possible production efficiency of AAV.

[0152] In addition to the above embodiments, the present invention may also have other implementation modes. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A method for improving AAV packaging efficiency using IRES gene, characterized in that: The following steps are involved: The functional gene sequence is constructed into a predetermined expression vector; the constructed expression vector is transfected into target cells and cultured to express to obtain AAV; the functional gene sequence is a sequence shown in one of SEQ ID NO.5 and SEQ ID NO.6 or a complementary sequence thereof.

2. A method for improving AAV packaging efficiency using IRES gene according to claim 1, characterized in that: The constructed expression vector contains the viral replication protein gene AAV-Rep of the adeno-associated virus and the viral packaging capsid protein gene AAV-Cap of the adeno-associated virus; the viral packaging capsid protein gene AAV-Cap of the adeno-associated virus is located upstream of the functional gene sequence, and the viral replication protein gene AAV-Rep of the adeno-associated virus is located downstream of the functional gene sequence; the viral packaging capsid protein gene AAV-Cap of the adeno-associated virus is shown in SEQ ID NO.2; the viral replication protein gene AAV-Rep of the adeno-associated virus is shown in SEQ ID NO.

3.

3. The method of improving AAV packaging efficiency by using IRES gene according to claim 2, characterized in that: The predetermined expression vector is an expression vector for expressing viral replication protein and viral packaging capsid protein of adeno-associated virus.

4. The method of claim 2 for improving AAV packaging efficiency using IRES gene, characterized in that: The target cells also contain an AAV-ITR-EGFP expression vector and an AAV-Helper helper vector; the target cells include HEK293 cells.

5. A functional gene for improving AAV packaging efficiency, characterized by: The functional gene sequence is a sequence shown in one of SEQ ID NO.5 and SEQ ID NO.6 or a complementary sequence thereof.

6. An expression vector containing the functional gene according to claim 5.

7. The expression vector according to claim 6, characterized in that: The expression vector adopts PSC-CMV vector.

8. Use of the functional gene according to claim 5 or the expression vector according to claim 6 or 7 for preparing AAV or for preparing drugs or for pharmaceutical production.

Images