Primers, probes, kits and applications for detecting Vibrio parahaemolyticus

Abstract

The present application relates to the field of microbial detection technology, and in particular to a primer and probe for detecting Vibrio parahaemolyticus, as well as a kit and application. The present application provides the use of a reagent for detecting the CG3 gene in the preparation of a kit for detecting Vibrio parahaemolyticus; wherein the nucleotide sequence of the CG3 gene is shown in SEQ ID NO.1. The present application discovered that there is a specific sequence, namely the CG3 gene, in the pandemic clone group CG3 of Vibrio parahaemolyticus. Therefore, the reagent for detecting the CG3 gene provides a basis for rapidly identifying the pandemic clone group CG3 of Vibrio parahaemolyticus and establishing a fluorescent PCR technology for rapidly identifying the pandemic clone group CG3 of Vibrio parahaemolyticus. This provides a reference for tracing and investigating the source of high-risk factors of the pandemic clone group CG3 of Vibrio parahaemolyticus, which is of great significance for further carrying out the work of preventing and controlling the population infected by Vibrio parahaemolyticus.

Description

Technical Field

[0001] The present application belongs to the technical field of microbial detection, and in particular relates to a primer and a probe for detecting Vibrio parahaemolyticus, as well as a kit and an application thereof. Background Art

[0002] Vibrio parahaemolyticus is a Gram-negative, halophilic marine bacterium that is widely found in marine, coastal and estuarine environments. It has become the world's leading source of foodborne bacterial poisoning. Vibrio parahaemolyticus enters the human body mainly through contaminated seafood and related products. Typical clinical manifestations are acute gastroenteritis, with the main clinical symptoms being vomiting, abdominal pain, diarrhea, vomiting and fever. It is susceptible to people with impaired immune function, such as hepatitis, cancer and diabetes patients, and patients recovering from intestinal surgery. In rare cases, it may also cause wound infection, otitis media and sepsis. Globally, Vibrio parahaemolyticus has become the main cause of seafood-related gastroenteritis.

[0003] Vibrio parahaemolyticus sequence type-ST3 is a pandemic clone group dominated by serotype O3:K6. It was discovered in Kolkata, India in 1996 and caused a mass infection epidemic. This type of pandemic clone group can spread rapidly across continents. Unlike other previously reported serotype epidemics, this type of epidemic strain can quickly become the dominant serotype and replace other serotypes of Vibrio parahaemolyticus in the local area. In the past two decades, Vibrio parahaemolyticus poisoning has rapidly increased in reports of foodborne diseases in various countries around the world, specifically the incidence of gastroenteritis caused by the O3:K6 serogroup has continued to increase. At present, 27 pandemic clinical serotypes and 4 environmental serotypes have been identified in my country, and serotype O3:K6 has been proven to be a pandemic clone.

[0004] Therefore, rapid identification of pandemic clones of Vibrio parahaemolyticus can provide a reference for tracing and investigating the source of Vibrio parahaemolyticus, and is of great significance for further prevention and control of Vibrio parahaemolyticus infection in the population; however, currently there are limited methods for accurately identifying pandemic clones of Vibrio parahaemolyticus. Summary of the invention

[0005] The purpose of the present application is to provide a primer and a probe as well as a kit and an application for detecting Vibrio parahaemolyticus, aiming to solve the technical problem of how to quickly and accurately identify the pandemic clone group CG3 of Vibrio parahaemolyticus.

[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0007] In a first aspect, the present application provides an application of a reagent for detecting the CG3 gene in the preparation of a kit for detecting Vibrio parahaemolyticus; wherein the nucleotide sequence of the CG3 gene is shown in SEQ ID NO.1.

[0008] In a second aspect, the present application provides a primer and a probe for detecting Vibrio parahaemolyticus, comprising:

[0009] The first upstream primer, the nucleotide sequence is shown in SEQ ID NO.2,

[0010] The first downstream primer, the nucleotide sequence is shown in SEQ ID NO.3,

[0011] The first molecular beacon probe, the nucleotide sequence is shown in SEQ ID NO.4.

[0012] In a third aspect, the present application provides a kit for detecting Vibrio parahaemolyticus, the kit comprising the above-mentioned primers and probes of the present application.

[0013] The application provided in the first aspect of the present application is based on the discovery that there is a specific sequence, namely the CG3 gene, in the pandemic clone group CG3 of Vibrio parahaemolyticus. Therefore, the reagent for detecting the above-mentioned CG3 gene provides a basis for quickly identifying the pandemic clone group CG3 of Vibrio parahaemolyticus and establishing a fluorescent PCR technology for quickly identifying the pandemic clone group CG3 of Vibrio parahaemolyticus. This provides a reference for tracing and investigating the source of high-risk factors of the pandemic clone group CG3 of Vibrio parahaemolyticus, which is of great significance for further carrying out the work of preventing and controlling the population infected by Vibrio parahaemolyticus.

[0014] The second aspect of the present application provides primers and probes for detecting Vibrio parahaemolyticus, including a first upstream primer, a first downstream primer and a first molecular beacon probe with specific sequences. The primers and probe can specifically identify and amplify the CG3 gene unique to the pandemic clone group CG3 of Vibrio parahaemolyticus, thereby quickly and accurately identifying the pandemic clone group CG3 of Vibrio parahaemolyticus.

[0015] The kit provided in the third aspect of the present application uses the primers and probes for detecting Vibrio parahaemolyticus that are unique to the present application. Based on the primers and probes, the kit can specifically identify and amplify the CG3 gene that is unique to the pandemic clone group CG3 of Vibrio parahaemolyticus. Therefore, the kit of the present application can quickly and accurately identify the pandemic clone group CG3 of Vibrio parahaemolyticus. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0017] Figure 1 It is a gradient amplification curve diagram of the target gene CG3 provided in the examples of the present application;

[0018] Figure 2 It is a gradient amplification curve diagram of the target gene TDH provided in the examples of the present application;

[0019] Figure 3 It is a gradient amplification curve diagram of the target gene TOXR provided in the examples of the present application;

[0020] Figure 4 It is a gradient amplification curve diagram of the target gene TRH provided in the examples of the present application;

[0021] Figure 5 It is a standard curve diagram of the target gene CG3 provided in the examples of the present application;

[0022] Figure 6 It is a standard curve diagram of the target gene TDH provided in the examples of the present application;

[0023] Figure 7 It is a standard curve diagram of the target gene TOXR provided in the examples of the present application;

[0024] Figure 8 It is a standard curve diagram of the target gene TRH provided in the examples of the present application. DETAILED DESCRIPTION

[0025] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0026] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0027] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0028] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0029] The research team of the applicant on the epidemiology of the genome of Vibrio parahaemolyticus in Shenzhen from 2002 to 2018 found that the prevalence of Vibrio parahaemolyticus in Shenzhen remains high. The pandemic clone group CG3 (Clonal Group 3, CG3) based on whole genome sequencing analysis causes the greatest clinical burden. Its serotype is mainly O3:K6, accounting for 72% of the total 2,686 strains collected from clinical pathogenic strains, causing approximately 61% to 88% of cases each year, and has been prevalent in Shenzhen for a long time. Therefore, the applicant sequenced the whole genome of the strains in Shenzhen over the past 20 years, and obtained a specific sequence through bioinformatics analysis and comparison. The specific sequence was named CG3 gene, which is unique to the pandemic clone group CG3 of Vibrio parahaemolyticus. The specific sequence of the CG3 gene was found to be located on the Vibrio parahaemolyticus genomic island 3 (VPal-3) through bioinformatics comparison. The specific sequence of the CG3 gene is as follows:

[0030] RIMD_2210633:1139380-1143600(SEQ ID NO.1)

[0031]

[0032] Therefore, a first aspect of an embodiment of the present application provides a use of a reagent for detecting the above-mentioned CG3 gene in the preparation of a kit for detecting Vibrio parahaemolyticus.

[0033] The embodiments of the present application utilize reagents for detecting the above-mentioned CG3 gene to provide a basis for rapidly identifying pandemic clone group CG3 of Vibrio parahaemolyticus and establishing a multiplex fluorescence PCR technology for rapidly identifying pandemic clone group CG3 of Vibrio parahaemolyticus. This provides a reference for tracing and investigating the source of high-risk factors for the prevalence of pandemic clone group CG3 of Vibrio parahaemolyticus in Shenzhen, which is of great significance for further carrying out work to prevent and control people infected with Vibrio parahaemolyticus.

[0034] The second aspect of the present application embodiment provides a set of primers and probes for detecting Vibrio parahaemolyticus, including:

[0035] The first upstream primer, the nucleotide sequence is as follows:

[0036] SEQ ID NO.2: CTACTGAATGGAGAGTCTTGTGCTT;

[0037] The first downstream primer, the nucleotide sequence is as follows:

[0038] SEQ ID NO.3: AATCGGTTGGTGTTATGGGTGT;

[0039] The first molecular beacon probe, the nucleotide sequence is as follows:

[0040] SEQ ID NO. 4: CGCGCATAAGTTTGTTCGTTCAATTCCGAAGCGCG.

[0041] The primers and probes for detecting Vibrio parahaemolyticus provided in the embodiments of the present application include a first upstream primer, a first downstream primer and a first molecular beacon probe with specific sequences. The primers and probe can specifically identify and amplify the CG3 gene unique to the pandemic clone group CG3 of Vibrio parahaemolyticus, thereby quickly and accurately identifying the pandemic clone group CG3 of Vibrio parahaemolyticus.

[0042] In one embodiment, the primers and probes for detecting Vibrio parahaemolyticus also include:

[0043] The second upstream primer, the nucleotide sequence is as follows:

[0044] SEQ ID NO.5: AAGCGCCAGTAGTACCTGA;

[0045] The second downstream primer, the nucleotide sequence is as follows:

[0046] SEQ ID NO.6: CCAATCTGACGGAACTGAGATT;

[0047] The second molecular beacon probe, the nucleotide sequence is as follows:

[0048] SEQ ID NO.7: CGCGCACCTGTGGCTTCTGCTGTGAATCCTGCGCG;

[0049] The third upstream primer, the nucleotide sequence is as follows:

[0050] SEQ ID NO.8: AAACATCTGCTTTTGAGCTTCCA;

[0051] The third downstream primer, the nucleotide sequence is as follows:

[0052] SEQ ID NO.9: CTCGAACAACAAACAATATCTCATCAG;

[0053] The third molecular beacon probe, the nucleotide sequence is as follows:

[0054] SEQ ID NO. 10: CCGGGGTGTCCCTTTTCCTGCCCCGG.

[0055] The second upstream primer, the second downstream primer and the second molecular beacon probe can specifically identify and amplify the species-specific gene TOXR of Vibrio parahaemolyticus, and the third upstream primer, the third downstream primer and the third molecular beacon probe can specifically identify and amplify the virulence gene TDH of the pandemic clone group CG3 of Vibrio parahaemolyticus. Therefore, the present application can more quickly and accurately identify the pandemic clone group CG3 of Vibrio parahaemolyticus through the above three sets of primers and probes through multiplex PCR amplification technology.

[0056] In one embodiment, the final concentrations of the primers and probes are: 0.14-0.18 μM for the first upstream primer, 0.14-0.18 μM for the first downstream primer, 0.06-0.10 μM for the first molecular beacon probe; 0.14-0.18 μM for the second upstream primer, 0.14-0.18 μM for the second downstream primer, 0.06-0.10 μM for the second molecular beacon probe; 0.14-0.18 μM for the third upstream primer, 0.14-0.18 μM for the third downstream primer, and 0.06-0.10 μM for the third molecular beacon probe. Under the above concentration conditions, multiplex PCR amplification can be well performed.

[0057] In one embodiment, in the above primers and probes, the upstream and downstream of the first molecular beacon probe are respectively combined with the first fluorescent group and the first quenching group, the upstream and downstream of the second molecular beacon probe are respectively combined with the second fluorescent group and the second quenching group, and the upstream and downstream of the third molecular beacon probe are respectively combined with the third fluorescent group and the third quenching group, and the first fluorescent group, the second fluorescent group and the third fluorescent group are all different. In this way, multiple fluorescent PCR is performed under the above conditions, and different channel fluorescence can be collected. Furthermore, the fluorescent group can be FAM, HEX, ROX, CY5, etc., and the quenching group can be BHQ, etc.

[0058] Furthermore, the applicant found that the pandemic clone group CG3 of Vibrio parahaemolyticus did not have the virulence gene TRH, but the virulence gene TRH existed in the non-CG3 pandemic clones. Therefore, in the primer and probe combination provided by the applicant, primers and probes for the virulence gene TRH can also be designed. Based on the characteristics of the large number of mutation sites of the virulence gene TRH, the applicant designed three pairs of primers for the virulence gene TRH (upstream primers SEQ ID NO.11-13, downstream primers SEQ ID NO.14-16) and two molecular beacon probes (SEQ ID NO.17-18, upstream and downstream are respectively combined with fluorescent groups and quenching groups) to better amplify the virulence gene TRH. In this way, through multiplex fluorescence PCR detection, if the CG3, TOXR, and TDH genes are positively displayed and the TRH gene is negatively displayed, the pandemic clone group CG3 of Vibrio parahaemolyticus can be detected more accurately.

[0059] The third aspect of the embodiments of the present application also provides a kit for detecting Vibrio parahaemolyticus, the kit comprising the above-mentioned primers and probes of the present application.

[0060] The kit provided in the embodiment of the present application uses primers and probes for detecting Vibrio parahaemolyticus that are unique to the embodiment of the present application. Based on the primers and probes, the kit can specifically identify and amplify the CG3 gene unique to the pandemic clone group CG3 of Vibrio parahaemolyticus. Therefore, the kit of the embodiment of the present application can quickly and accurately identify the pandemic clone group CG3 of Vibrio parahaemolyticus.

[0061] In one embodiment, the kit further comprises: MgCl2, dNTP, rTaq enzyme and buffer. Specifically, the final concentration of MgCl2 is 2-4 mM, the final concentration of dNTP is 0.1-0.3 mM, and the final concentration of rTaq enzyme is 0.2-0.4 U / 25 μl. The kit of the embodiment of the present application can detect the pandemic clone group CG3 of Vibrio parahaemolyticus based on the multiplex fluorescence PCR technology, and the reaction system formed under the above-mentioned final concentration conditions has a better multiplex fluorescence PCR amplification effect.

[0062] The following describes the invention in conjunction with specific embodiments.

[0063] Example 1

[0064] 1.1 Experimental strains

[0065] A total of 176 strains were used in this example, including 144 strains of Vibrio parahaemolyticus (including 82 strains of pandemic clone group CG3 and 62 strains of non-pandemic clone groups), 19 strains of other Vibrio species, and 13 strains of other common intestinal bacteria. The above strains are all from the strain library of Shenzhen Center for Disease Control and Prevention, and the strains have all been sequenced with full genome sequencing, and the strain background information is clear. The specific experimental strain list is shown in Table 1.

[0066] Table 1

[0067]

[0068]

[0069] 1.2 Strain isolation and identification

[0070] Vibrio parahaemolyticus was inoculated with 3.5% sodium chloride tryptone soy broth or 3% alkaline peptone water, and cultured in a 37°C incubator for 18 to 24 hours. After the culture was revived, it was inoculated with a Vibrio color plate, cultured at 37°C for 18 to 24 hours, and a single colony was isolated. A single purple-red colony was selected and added to 3.5% sodium chloride tryptone soy broth, and the bacteria were increased in a constant temperature shaker (37°C, 150r / min) for 18 to 24 hours to obtain a Vibrio parahaemolyticus liquid. Other Vibrio species were inoculated in alkaline peptone water for bacterial growth, non-Vibrio species were inoculated in LB broth for bacterial growth, and Vibrio color plates and corresponding bacterial color plates were inoculated. The colony identification was performed according to the instructions of each bacterial color plate, and a single colony of each colony was isolated. After bacterial growth, the corresponding bacterial liquid was obtained.

[0071] 1.3 Nucleic acid extraction

[0072] When establishing the pandemic clone CG3 system of Vibrio parahaemolyticus, take 1 mL of Vibrio parahaemolyticus enrichment solution into a 2 mL EP tube, centrifuge at room temperature at 10000 r / min for 1 min, remove the supernatant and mix the bacteria on an oscillator, fully suspend the bacteria, add 200 μL ATL (cell tissue lysis solution), mix well with a vortex oscillator, add 10 μL proteinase K, mix well and digest on a constant temperature oscillator at 900 r / min, 65°C for 35 min until the liquid is clear and transparent, then add 10 uL RNase, mix well and let it stand for 10 to 15 min, and use the cultured bacterial DNA extraction kit (magnetic bead method) of Guangzhou Bay Area Biotechnology Co., Ltd. for extraction. The extracted nucleic acid is determined by an ultra-micro spectrophotometer (NanoDrop one) and stored at -20°C for use.

[0073] The nucleic acid used to evaluate the specificity of the system was extracted by boiling water. A single colony was picked from the colorimetric plate and cultured in the culture solution for 18 to 24 hours. The mixture was centrifuged at 10,000 r / min for 1 minute, the supernatant was removed, and 200 uL of sterile water was added. The mixture was thoroughly shaken and mixed, and the mixture was placed in a water bath at 100°C for 5 minutes. The supernatant was centrifuged at 12,000 r / min for 5 minutes. The supernatant was the nucleic acid template and stored in a -20°C refrigerator for later use.

[0074] 1.4 Design of primers and probes for multiplex fluorescence PCR system

[0075] According to the Vibrio parahaemolyticus collected by the Shenzhen Comprehensive Monitoring Network from 2002 to 2018, after whole genome sequencing and gene quality assessment, the representative strain of the pandemic group RIMD 2210633 was used as the reference genome sequence, and the specific sequence CG3 gene of the clone group CG3 (as shown in SEQ ID NO.1) was obtained through bioinformatics analysis and comparison. Primers and probes were designed for the three genes (TOXR, TDH, CG3) of the pandemic clone group CG3 of Vibrio parahaemolyticus, among which the species-specific gene TOXR and the virulence gene TDH of Vibrio parahaemolyticus were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) The full-length sequences of the target genes were downloaded, and their respective conserved sequences were found through the MEGA7 software; and the specific CG3 gene of the pandemic clone group, the specific gene conserved sequence was imported into the Primer5 software to design primers. The design principles of primers are as follows: annealing temperature is about 60°C, upstream and downstream primer length is 18-25bp, PCR amplification product length is 100-200bp, nucleotide CG content is 40-60%, and the generation of primer dimers and related mismatches in the control system.

[0076] Improved molecular beacon probe design principles The loop length of the probe is 15-25bp (generally around 20bp), the stem length is 5-7bp, in the conserved region, the CG% content should be 40-60%, there are several C / G at both ends of the probe that participate in the formation of the stem and can hybridize with the target sequence, the remaining bases participating in the formation of the stem are freely added with C / G, and the TM value of the part complementary to the target sequence of the probe should be 5-10℃ higher than the TM value of the primer. After the primer and probe design are completed, the BLAST (Basic Local Alignment Search Tool) online tool on the NCBI website is used for preliminary comparison to ensure the specificity of the primer design. The final primer and probe information is shown in Table 2, all of which were synthesized and purified by Shanghai Biotech Co., Ltd.

[0077] Table 2

[0078]

[0079]

[0080] In addition, corresponding primers and probes can also be designed for the virulence gene TRH that is absent from pandemic clone group CG3 of Vibrio parahaemolyticus but present in non-CG3 pandemic clones, in order to highlight the specificity of primers and probes related to pandemic clone group CG3 of Vibrio parahaemolyticus. The relevant primers and probes for the TRH gene are as follows:

[0081] TRH-F1 (SEQ ID NO. 11): GTGTAACGTATTTGGATGAAACG,

[0082] TRH-F2 (SEQ ID NO. 12): GCACATAACAAACATATGTCCA,

[0083] TRH-F3 (SEQ ID NO. 13): TGACAACGAAGAATCAATAACCA;

[0084] TRH-R1 (SEQ ID NO.14): ACACATAACAAACATATGCCCA,

[0085] TRH-R2 (SEQ ID NO. 15): GCACATAACAAACATATGTCCA,

[0086] TRH-R3 (SEQ ID NO. 16): ACACATTACAAACATATGTCCA;

[0087] TRH-P1 (SEQ ID NO.17):

[0088] TGTCGAAGCATATGAGAGCGGAAATGGAATTCGACA,

[0089] TRH-P2 (SEQ ID NO.18):

[0090] TGTCGAGGCATATGAGAGCGGCAATTCGACA;

[0091] 5' and 3' dual-labeling modifications of TRH-P1 and TRH-P1 probes: 5` ROX, 3` BHQ2.

[0092] 1.5 Establishment of multiplex fluorescence PCR system for pandemic clone CG3 of Vibrio parahaemolyticus

[0093] The three genes (TOXR, TDH, CG3) of the pandemic clone group CG3 of Vibrio parahaemolyticus were CY5, FAM, and HEX. After the primers and probes were synthesized, they were diluted to 10uM for standby use. The total reaction system was 25μL. The specific dosage of the multiplex fluorescence PCR system of the pandemic clone group CG3 of Vibrio parahaemolyticus can be seen in Table 3.

[0094] Table 3

[0095] Reagents (Specifications) Dosage 10×PCR buffer 2.5μl <![CDATA[MgCl2(25mM)]]> 3μl dNTP(2.5mM) 2μl TOXR(10μm)(F+R+P) 0.4μl+0.4μl+0.2μl TDH(10μm)(F+R+P) 0.4μl+0.4μl+0.2μl CG3(10μm)(F+R+P) 0.4μl+0.4μl+0.2μl rTaq enzyme (1U) 0.3μl ddH2O 9.2μl template 5μl

[0096] For the detection of the TRH gene, except for the different amounts of primers and probes, the other total reaction system is the same as that in Table 3, 25 μL. The amounts of primers and probes (using the ROX fluorescence channel) for the detection of the TRH gene are:

[0097] TRH-F1 (10μm): 0.2μl; TRH-F2 (10μm): 0.2μl; TRH-F3 (10μm): 0.2μl; TRH-R1 (10μm): 0.2μl; TRH-R2 (10 μm): 0.2 μl; TRH-R3 (10 μm): 0.2 μl; TRH-P1 (10 μm): 0.1 μl; TRH-P2 (10 μm): 0.1 μl.

[0098] The PCR program of the multiplex fluorescence PCR system was 95°C, 3 min; 95°C, 20 s, 56°C, 20 s, 72°C, 30 s (40 cycles), and the fluorescence of FAM, HEX, ROX, and CY5 channels were collected during the annealing stage.

[0099] Example 2

[0100] The strains listed in Table 1 were selected to test the sensitivity and specificity of the multiplex fluorescence PCR system of Example 1.

[0101] (1) The sensitivity of the test is determined by using purified DNA and pure culture of Vibrio parahaemolyticus with known genotypes. DNA sensitivity is to be extracted from Vibrio parahaemolyticus using a nucleic acid extraction kit and diluted ten-fold with sterile water, with parallel samples being made at the same time. Bacterial solution sensitivity is to use Vibrio parahaemolyticus that has been enriched in 3.5% tryptic peptone broth for 18 to 24 hours, and the enriched solution is diluted ten-fold with sterile saline. 1 ml of each diluted bacterial solution is injected into a sterile plate, and 1 ml is taken to extract nucleic acid by boiling. Pour about 15 ml of nutrient agar medium that has been melted and cooled to about 45°C, and culture it in a 37°C incubator for 48 hours before counting the colonies.

[0102] The purified DNA of Vibrio parahaemolyticus was diluted 10 times in series, and parallel samples were prepared to detect the amplification efficiency and quantitative ability of multiplex fluorescence PCR. The standard curve was drawn with the CT value as the ordinate and the nucleic acid concentration as the abscissa. The amplification efficiency was calculated according to the formula E = (10 -1 / slope )-1 calculation.

[0103] Sensitivity and specificity results

[0104] After specific investigation of pandemic clones, non-pandemic clones, other Vibrio, and strains of other species of Vibrio parahaemolyticus, a total of 176 strains were obtained. The final number of strains and positive statistical results of the multiplex fluorescence PCR experiment are shown in Table 4.

[0105] Table 4

[0106]

[0107]

[0108] All strains underwent whole genome sequencing, and the whole genome sequencing results were compared with the results of each single fluorescence PCR. Table 5 is a comparison of the whole genome sequencing results of Vibrio parahaemolyticus and the results of the single fluorescence PCR target gene TOXR, Table 6 is a comparison of the whole genome sequencing results of Vibrio parahaemolyticus and the results of the single fluorescence PCR target gene TDH, and Table 7 is a comparison of the whole genome sequencing results of Vibrio parahaemolyticus and the results of the single fluorescence PCR target gene CG3.

[0109] Table 5

[0110]

[0111] Sensitivity of TOXR target gene: Positive coincidence rate = a / (a+c)×100%=100%

[0112] Specificity of TOXR target gene: Negative coincidence rate = d / (b+d)×100%=100%

[0113] Kappa=(Po-Pe) / (1-Pe)=1.

[0114] Table 6

[0115]

[0116]

[0117] Sensitivity of TDH target gene: Positive coincidence rate = a / (a+c)×100%=100%

[0118] Specificity of TDH target gene: Negative coincidence rate = d / (b+d) × 100% = 97.0%

[0119] Kappa=(Po-Pe) / (1-Pe)=97.6%.

[0120] Table 7

[0121]

[0122] Sensitivity of CG3 target gene: Positive coincidence rate = a / (a+c)×100%=100%

[0123] Specificity of CG3 target gene: Negative coincidence rate = d / (b+d)×100%=100%

[0124] Kappa=(Po-Pe) / (1-Pe)=1.

[0125] In addition, the comparison of the whole genome sequencing results of Vibrio parahaemolyticus and the single fluorescent PCR target gene TRH results is shown in Table 8.

[0126] Table 8

[0127]

[0128] Sensitivity of TRH target gene: Positive coincidence rate = a / (a+c)×100%=100%

[0129] Specificity of TRH target gene: Negative coincidence rate = d / (b+d)×100%=100%

[0130] Kappa=(Po-Pe) / (1-Pe)=1.

[0131] The above experimental results show that the multiplex fluorescent PCR system based on the primers and probes for detecting Vibrio parahaemolyticus unique to the present application has good sensitivity and specificity for the pandemic clone group CG3 of Vibrio parahaemolyticus.

[0132] (2) Establishment of minimum detection limit and standard curve of multiplex fluorescence PCR system

[0133] Vibrio parahaemolyticus with known genotypes was selected, and its nucleic acid was extracted using a kit. 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 For the samples to be tested, multiple fluorescence PCR experiments were performed for each gradient sample according to the multiple fluorescence PCR system in Table 3, and parallel experiments were performed at the same time. The gradient experimental results of TOXR, TDH, CG3, and TRH target genes are shown in the figure. Figure 1-4 The minimum detection limit of this experiment is 8.7-10.1 fg / ul, and the minimum detection limit of pure bacterial culture is 70-85 cfu / ml.

[0134] The standard curve of the multiplex fluorescence PCR system was established: Based on the results of the multiplex fluorescence PCR sensitivity experiment of Vibrio parahaemolyticus, the standard curve was drawn with nucleic acid concentration and CT value as the horizontal and vertical coordinates. The standard curves of each target gene can be seen Figure 5-8 .

[0135] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. Use of a reagent for detecting the CG3 gene in preparing a kit for detecting Vibrio parahaemolyticus; wherein: The nucleotide sequence of the CG3 gene is shown in SEQ ID NO.1, and the CG3 gene is the gene of the genomic island Vpal-3 of the pandemic clone group CG3; The reagent for detecting the CG3 gene comprises: The first upstream primer, the nucleotide sequence is shown in SEQ ID NO.2, The first downstream primer, the nucleotide sequence is shown in SEQ ID NO.3, The first molecular beacon probe, the nucleotide sequence is shown in SEQ ID NO.

4.

2. A set of primers and probes for detecting Vibrio parahaemolyticus, characterized in that: include: The first upstream primer, the nucleotide sequence is shown in SEQ ID NO.2, The first downstream primer, the nucleotide sequence is shown in SEQ ID NO.3, The first molecular beacon probe, the nucleotide sequence is shown in SEQ ID NO.

4.

3. The primer and probe according to claim 2, characterized in that: Also includes: The second upstream primer, the nucleotide sequence is shown in SEQ ID NO.5, The second downstream primer has a nucleotide sequence as shown in SEQ ID NO.6, A second molecular beacon probe, the nucleotide sequence of which is shown in SEQ ID NO.7; The third upstream primer, the nucleotide sequence is shown in SEQ ID NO.8, The third downstream primer, the nucleotide sequence is shown in SEQ ID NO.9, The third molecular beacon probe, the nucleotide sequence is shown in SEQ ID NO.

10.

4. The primer and probe according to claim 3, characterized in that: The final concentrations of the primers and probes used are: 0.14 to 0.18 μM for the first upstream primer, 0.14 to 0.18 μM for the first downstream primer, and 0.06 to 0.10 μM for the first molecular beacon probe; 0.14 to 0.18 μM for the second upstream primer, 0.14 to 0.18 μM for the second downstream primer, and 0.06 to 0.10 μM for the second molecular beacon probe; 0.14 to 0.18 μM for the third upstream primer, 0.14 to 0.18 μM for the third downstream primer, and 0.06 to 0.10 μM for the third molecular beacon probe.

5. The primer and probe according to claim 3, characterized in that: The first molecular beacon probe is bound to a first fluorescent group and a first quenching group at its upstream and downstream, respectively; the second molecular beacon probe is bound to a second fluorescent group and a second quenching group at its upstream and downstream, respectively; the third molecular beacon probe is bound to a third fluorescent group and a third quenching group at its upstream and downstream, respectively; and the first fluorescent group, the second fluorescent group and the third fluorescent group are all different.

6. A kit for detecting Vibrio parahaemolyticus, characterized in that: The kit comprises the primers and probes according to any one of claims 2 to 5.

7. The kit according to claim 6, characterized in that The kit also includes: MgCl2, dNTP, rTaq enzyme and buffer.

8. The kit according to claim 7, characterized in that The final concentration of the MgCl2 is 2-4 mM, and the final concentration of the dNTP is 0.1-0.3 mM.

9. The kit according to claim 7, characterized in that The final concentration of the rTaq enzyme is 0.2-0.4 U / 25 μl.

Images