A biomarker for detecting high myopia complicated with choroidal neovascularization, a detection kit and its application

Abstract

The present invention belongs to the field of biomedical detection technology, and in particular to a biomarker, a detection kit and an application for detecting high myopia complicated with choroidal neovascularization. The present invention discloses the application of tRF-22 in the preparation of a diagnostic reagent for high myopia complicated with choroidal neovascularization and a diagnostic kit for high myopia complicated with choroidal neovascularization. The present invention is verified by quantitative PCR and finds that tRF-22 is significantly correlated with the occurrence of high myopia complicated with choroidal neovascularization. The present invention utilizes real-time fluorescence quantitative PCR technology, and by detecting the relative content of tRF-22 in aqueous humor, it can be used for the screening of clinical patients with high myopia complicated with choroidal neovascularization, and provides a theoretical basis for the early intervention of high myopia complicated with choroidal neovascularization.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical detection technology, and in particular relates to a high myopia complicated with choroidal neovascularization detection biomarker, a detection kit and an application thereof, which can be used to diagnose high myopia complicated with choroidal neovascularization and judge the progression of the disease according to the individual's tRF-22 expression level. Background Art

[0002] Myopia in my country presents a severe situation of high incidence and low age. The prevention and control of myopia in children and adolescents has risen to a national strategy. If it is not effectively controlled in a timely manner, it is very easy to develop into high myopia and a variety of fundus complications. Among them, concurrent choroidal neovascularization (CNV) is one of the most serious complications that threaten vision, and there is a lack of effective treatment. A large number of studies have found that myopia progression is closely related to choroidal vascular function, and choroidal vascular dysfunction can lead to further development of myopia. At present, physical measurements and imaging examinations are used to monitor the axial length, refraction and choroidal vascular lesions during the progression of myopia. There are no molecular markers related to the degree of myopia progression and choroidal vascular lesions for early clinical monitoring. Aqueous humor, as an important ocular content, is in a dynamic circulation state and contains a variety of regulatory factors that participate in important physiological processes such as the growth and function maintenance of ocular tissues. At present, there are few studies on whether the aqueous humor contains key regulatory molecules involved in choroidal vascular lesions in the progressive stage of myopia. Therefore, finding reliable and accurate clinical biomarkers is of great significance for the diagnosis of choroidal vascular lesions in the progressive stage of myopia.

[0003] In the process of myopia progression, a variety of pathological stimuli are involved in choroidal vasculopathy. For example, inflammatory response, oxidative stress, and hypoxia. tsRNA is a non-coding RNA molecule produced from mature tRNA or its precursor under various stress responses. It is widely and stably present in various organisms and has conservative, tissue and spatiotemporal expression specificity. Studies have shown that tsRNA is involved in a variety of biological processes, including protein translation regulation, tumorigenesis, stem cell biology, ribosome biogenesis, transposon regulation, epigenetic regulation, apoptosis inhibition, etc. Therefore, its expression type, abundance and modification are closely related to tissue cell type and disease state.

[0004] tRF-22 is derived from tRNA Gln-CTG The 3' end contains a non-coding RNA of 22 bases. Currently, no tsRNA markers for early diagnosis have been reported in the field of high myopia complicated with choroidal neovascularization. Summary of the invention

[0005] In response to the problems existing in the prior art, the present invention provides a biomarker, a detection kit and an application for detecting choroidal neovascularization complicated by high myopia, aiming to solve some of the problems in the prior art or at least alleviate some of the problems in the prior art.

[0006] The present invention is achieved by providing a biomarker for detecting high myopia complicated with choroidal neovascularization. The biomarker for detecting progressive myopia choroidal neovascularization is tRF-22. The nucleotide sequence of the marker is shown in SEQ ID NO: 1. The sequence of tRF-22 is 5'-UCAAAUCTCGGUGGAACCUCCA-3'.

[0007] The present invention also provides a primer for detecting a biomarker for high myopia complicated with choroidal neovascularization, and the primer sequence is shown in SEQ ID NO:2.

[0008] Another object of the present invention is to provide a real-time fluorescence quantitative PCR detection kit for choroidal vascular disease using the high myopia complicated choroidal neovascular disease detection biomarker, including 2×EZ-probe qPCRMaster Mix for microRNA, Probe, universal 3' downstream primer, qRT-PCR upstream primer that specifically recognizes tRF-22, and qRT-PCR upstream primer that specifically recognizes U6. 2×EZ-probe qPCR Master Mix for microRNA, Probe, and universal 3' downstream primer use the reagents provided in the EZ-probe qPCR Master Mix for microRNA (ROX2plus) kit of EZB. The tRF-22-specific qRT-PCR upstream primer is shown in SEQ ID NO: 2; the U6 quantitative PCR upstream primer sequence is shown in SEQ ID NO: 3.

[0009] Furthermore, the PCR reaction system based on the PCR detection kit includes 25 μl of 2x EZ-probe qPCR MasterMix for microRNA, 1 μl of Probe (10 μM), 2 μl of upstream primer of specific qRT-PCR (specifically identifying tRF-22 or U6), 2 μl of downstream primer, 5 μl of cDNA of the sample to be tested, and RNase free ddH2O is supplemented to 50 μl.

[0010] Furthermore, the kit also includes a reverse transcription reaction system, which includes: gDNARemove, 4×miRNA RT Buffer, miRNA RT Enzyme Mix, and Nuclease free ddH2O.

[0011] Furthermore, the kit also includes an RNA extraction system, and the RNA extraction system includes Trizol reagent, chloroform, anhydrous ethanol, DEPC ddH2O, ddH2O, and isopropanol.

[0012] Another object of the present invention is to provide an application of the high myopia complicated with choroidal neovascularization detection biomarker in the preparation of a high myopia complicated with choroidal neovascularization diagnostic reagent, particularly in the preparation of a high myopia complicated with choroidal neovascularization diagnostic reagent based on real-time fluorescence quantitative PCR technology.

[0013] Another object of the present invention is to provide an application of the antisense nucleotide of the high myopia complicated with choroidal neovascularization detection biomarker in the preparation of a drug for treating high myopia complicated with choroidal neovascularization.

[0014] Another object of the present invention is to provide an application of the high myopia complicated by choroidal neovascularization detection biomarker in the preparation of a prognosis evaluation reagent after the treatment of high myopia complicated by choroidal neovascularization, particularly in the preparation of a prognosis evaluation reagent after the treatment of high myopia complicated by choroidal neovascularization based on real-time fluorescence quantitative PCR technology.

[0015] In combination with all the above technical solutions, the advantages and positive effects of the present invention are as follows: the high myopia complicated with choroidal neovascularization detection biomarker provided by the present invention can be used to diagnose human high myopia complicated with choroidal neovascularization and judge the progression of the disease according to the individual's tRF-22 expression level. tRF-22 antisense nucleotides are complementary to the target tRF-22, inhibit or block the conversion and expression of the gene, or induce RNase H to recognize or cut tRF-22, making it lose its function, and therefore can be used as a drug for the treatment of high myopia complicated with choroidal neovascularization. Therefore, the present invention provides a new use of tRF-22, which can be used as a diagnostic reagent for the early diagnosis of high myopia complicated with choroidal neovascularization.

[0016] The present invention verifies through quantitative PCR that tRF-22 is significantly correlated with high myopia complicated with choroidal neovascularization. The present invention uses probe method real-time fluorescence quantitative PCR technology to detect the significant difference in the expression of tRF-22 in aqueous humor of high myopia complicated with choroidal neovascularization, which can be used for the screening of clinical patients with high myopia complicated with choroidal neovascularization, and provides a theoretical basis for the early intervention of high myopia complicated with choroidal neovascularization.

[0017] The present invention determines that the change in tRF-22 expression is significantly correlated with the occurrence of choroidal neovascularization complicated by high myopia. By intervening in the expression of tRF-22 in RF / 6A cells, it is verified in functional experiments of cell activity, cell proliferation, cell migration and cell tube formation that the change in the expression of tRF-22 can significantly affect cell function. After tRF-22 is overexpressed in choroidal vascular endothelial cells, cell activity, proliferation, migration and tube formation can be significantly inhibited. tRF-22 can be used as a biomarker for early diagnosis of choroidal neovascularization complicated by high myopia, and the progression of choroidal neovascularization complicated by high myopia and the recurrence after treatment are regularly evaluated.

[0018] The present invention provides an important reference basis for the early diagnosis, prognosis and early intervention treatment of high myopia complicated by choroidal neovascularization, has great practical clinical value, and can be used to screen out high-risk and recurrent populations of high myopia complicated by choroidal neovascularization, so as to intervene and treat early and reduce unnecessary treatment and medical expenses for non-high-risk recurrent patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 1 is a schematic diagram of quantitative PCR analysis of the expression difference of tRF-22 in the aqueous humor of the experimental group (high myopia complicated with choroidal neovascularization) and the control group (cataract) provided in the embodiment of the present invention;

[0020] Figure 2 It is a schematic diagram of the expression difference of tRF-22 in the plasma of the experimental group (high myopia complicated with choroidal neovascularization) and the control group (cataract) provided by the embodiment of the present invention through quantitative PCR analysis;

[0021] FIG3 is a schematic diagram of analyzing the effect of tRF-22 intervention on RF / 6A cell-related pathological processes provided by an embodiment of the present invention.

[0022] Figure 3A It is a schematic diagram of the effect of tRF-22 transfection into RF / 6A cells on tRF-22 expression analyzed by quantitative PCR provided in an embodiment of the present invention.

[0023] Figure 3BThis is a schematic diagram of analyzing the effect of tRF-22 intervention on RF / 6A cell activity using MTT colorimetry provided in an embodiment of the present invention.

[0024] Figure 3C This is a schematic diagram of using an EdU kit to analyze the effect of tRF-22 intervention on RF / 6A cell proliferation provided by an embodiment of the present invention. The upper picture 3C is a cell proliferation signal EdU staining picture, and the lower picture 3F is a statistical analysis picture.

[0025] Figure 3D It is a schematic diagram of analyzing the effect of tRF-22 intervention on the migration function of RF / 6A cells using a Transwell cell migration experiment provided in an embodiment of the present invention, wherein the upper picture 3D is a cell migration staining picture, and the lower picture 3G is a statistical analysis picture.

[0026] Figure 3E This is a schematic diagram of the effect of tRF-22 intervention on the angiogenesis activity of RF / 6A cells analyzed by the Matrigel angiogenesis experiment provided in an embodiment of the present invention, wherein the upper picture 3E is a cell tube formation picture, and the lower picture 3H is a statistical analysis picture.

[0027] Figure 4 This is a schematic diagram of the quantitative PCR detection results in the patient's serum before and after the treatment of high myopia complicated with choroidal neovascularization provided by an embodiment of the present invention. The horizontal axis represents the serum samples before and after the surgical treatment, and the vertical axis represents the expression level of tRF-22. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with the examples. The equipment and reagents used in each embodiment and test example can be obtained from commercial sources unless otherwise specified. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0029] Based on the information contained in this application, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined process, properties or components, because these embodiments and other descriptions are only for illustrating specific aspects of the present invention. In fact, various changes that the technicians in this field or related fields can obviously make to the embodiments of the present invention are all covered within the scope of the appended claims.

[0030] Example 1 tRF-22 Correlation Verification of High Myopia Complicated with Choroidal Neovascularization

[0031] Aqueous humor samples and processing: Aqueous humor was collected from 50 patients with high myopia complicated by choroidal neovascularization (HM-CNV), and matched aqueous humor was collected from 50 patients with cataract (without fundus lesions) as controls.

[0032] Step 1: Obtain the fluid sample to be tested

[0033] The samples were aqueous humor samples from patients with high myopia, CNV and cataract.

[0034] Step 2: Extract RNA from the test fluid sample

[0035] a) Take 0.03 ml of aqueous humor sample and transfer it to a centrifuge tube, add 300 μl of Lysis Buffer, vortex at high speed for 10 seconds to completely dissolve the cells and then put them into the lysis buffer. (Note: If the next step is not performed, the sample can be stored at -70℃ for a long time).

[0036] b) Centrifuge at 12,000 x g for 2 minutes. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is mainly in the aqueous phase. Transfer the aqueous phase to a new tube.

[0037] c) Add an equal volume of ice-cold 100% ethanol to the supernatant. There may be a precipitate at this step. This is normal. Invert the tube several times or pipette up and down to disperse the precipitate, then transfer the sample to the spin column. Centrifuge at 4000x g for 1 min at 4°C, discard the supernatant, and the RNA will precipitate at the bottom of the tube.

[0038] d) Mix 2 μl gDNA removal agent and 10 μl ddH2O and add to the center of the spin column. Incubate at room temperature for 5 min to degrade residual DNA.

[0039] e) Add 500 μl Wash Buffer and centrifuge at 12000 x g for 1 min. There is no need to discard the liquid, but directly transfer the column to an RNase-free 1.5 ml centrifuge tube, open the lid, and let it stand in the air for 2 min.

[0040] f) Add 20-30 μl Elution Buffer to the center of the column, incubate at room temperature for 2 minutes, and centrifuge at 12,000 x g for 1 minute (transfer the Elution Buffer back to the column, incubate for 5 minutes, and centrifuge again to obtain more RNA).

[0041] g) Discard the spin column, determine the RNA concentration, and use the purified RNA for the following experiments or store at -70°C.

[0042] Step 3: RNA quality testing

[0043] The concentration of RNA was measured by UV spectrophotometer at 260nm and 280nm absorbance; the A260 / A280 ratio of the RNA solution was the RNA purity, ranging from 1.8 to 2.1. At the same time, the RNA quality was tested by agarose gel electrophoresis, and observed and photographed under UV transmission light.

[0044] Step 4: RNA reverse transcription to obtain cDNA samples

[0045] Reverse transcription was performed using the microRNA Reverse Transcription Kit from EZB. According to the system provided by the kit (20 μl), the following were added:

[0046] gDNA Remover treated RNA 5μl

[0047] 4x miRNA RT Buffer 5μl

[0048] miRNA RT Enzyme Mix 2μl

[0049] Nuclease free ddH2O 8μl

[0050] The above system was placed in a 0.2 μl EP tube without RNase, and inverted into cDNA according to the following procedure: 37°C for 15 min, 42°C for 10 min, and 95°C for 3 min. The obtained cDNA was stored at -20°C.

[0051] Step 5: Probe-based quantitative PCR

[0052] The probe quantitative PCR reaction system (20 μl) used EZ-probe qPCR Master Mix for microRNA (ROX2 plus) from EZB Company. The system configuration according to the instructions was as follows: 2x EZ-probe qPCR Master Mix for microRNA 10 μl, Probe (10 μM) 0.4 μl, specific qRT-PCR upstream primer 0.8 μl (specifically identifying tRF-22 or U6), downstream primer 0.8 μl, cDNA of the sample to be tested 2 μl, and RNase free ddH2O was added to make up to 20 μl.

[0053] U6 quantitative PCR upstream primer 5′-CCTGCTTCGGCAGCACA-3′;

[0054] tRF-22 quantitative PCR upstream primer 5′-GGGTCAAATCTCGGTGGAAC-3′.

[0055] PCR conditions: 95°C for 5 min, 92°C for 10 s, 60°C for 30 s, and 40 cycles.

[0056] Step 6: Data Analysis

[0057] The target RNA and internal reference RNA real-time fluorescence quantitative PCR detection were performed on the same sample, and the target RNA was normalized based on the expression level of the internal reference. Then, the relative expression level of the target RNA was analyzed using the DeltaCt method commonly used in the art. The Ct value of the target gene tRF-22 of all samples was subtracted from the Ct value of the internal reference gene U6 to obtain the Delta Ct value (ΔCt) of all samples. The formula was expressed as ΔCt=Ct(target gene tRF-22)-Ct(internal reference gene U6).

[0058] Finally, by comparing the expression difference of tRF-22 between the test sample (i.e., high myopia complicated with CNV sample) and the target sample (i.e., cataract group sample), the disease susceptibility of the test patient (e.g., Figure 2 25 representative cases were selected from 50 cases in each group).

[0059] Step 7: Interpretation of results

[0060] The expression level of the target tRF-22 was detected by probe quantitative PCR and the ΔCt range of the control group samples in each group was obtained, as shown in Table 2. The ΔCt of the samples to be tested was compared to analyze the differences between the experimental group and the control group. Further analysis was performed to determine whether the values ​​of each sample were within the range of the control group. If the ΔCt of the sample to be tested was within the ΔCt range of the control group, or was less than the ΔCt range, the sample to be tested was considered negative for high myopia choroidal vasculopathy; if the ΔCt of the sample to be tested was greater than the ΔCt range of the control group, it was considered positive for high myopia choroidal vasculopathy. The results are shown in Table 2.

[0061] Table 2: ΔCt range of samples in each group

[0062] tRF-22 Ct mean-U6 Ct mean Aqueous humor of patients in the control group 13.2-16.7 Plasma of patients in the control group 14.3-17.2 Aqueous humor of the experimental group 15.6-19.9 Plasma of patients in the experimental group 16.4-19.5

[0063] According to the above results, serum samples of 100 patients with high myopia choroidal vasculopathy and 100 patients with non-choroidal vasculopathy diagnosed by clinical imaging were collected for tRF-22 serum content analysis. The accuracy of the tRF-22-based method was evaluated. As shown in Table 3, the accuracy of serum samples was %, and the sensitivity was %, indicating that tRF-22 can be used as a biological marker for the diagnosis of high myopia choroidal vasculopathy.

[0064] Table 3: Results of tRF-22 as a biomarker for the diagnosis of choroidal vasculopathy in high myopia

[0065]

[0066] Step 8: Based on in vitro experiments, reveal from the basic principle that tRF-22 regulates the function of choroidal vascular endothelial cells, and then confirm its involvement in the regulation of choroidal vascular disease process.

[0067] In in vitro experiments, RF / 6A cells were transfected with tRF-22 mimics with the sequence 5'-UCAAAUCTCGGUGGAACCUCCA-3' and tRF-22 inhibitor with the sequence UCACGCGAGCCGAACGAACAAA to interfere with tRF-22 expression.

[0068] The Scr mimic sequence in the experiment was: 5′-UUUGUACUACACAAAAGUACUG-3′;

[0069] The sequence of Scr inhibitor is: 5'-CAGUACUUUUGTGUAGUACAAA-3'.

[0070] like Figure 3A The quantitative PCR analysis of the effect of tRF-22 transfection on RF / 6A cells on tRF-22 expression provided by the embodiment of the present invention is shown in FIG. Figure 3B The schematic diagram of the effect of tRF-22 intervention on RF / 6A cell activity using MTT colorimetry provided in the embodiment of the present invention is shown. Figure 3C The figure shows a schematic diagram of using an EdU kit to analyze the effect of tRF-22 intervention on RF / 6A cell proliferation provided by an embodiment of the present invention. The upper picture 3C is a cell proliferation signal EdU staining picture, and the lower picture 3F is a statistical analysis picture. Figure 3D The schematic diagram of the effect of tRF-22 intervention on RF / 6A cell migration function using Transwell cell migration assay provided by the embodiment of the present invention is shown, wherein the upper picture 3D is a cell migration staining picture, and the lower picture 3G is a statistical analysis picture. Figure 3E The figure shows a schematic diagram of the effect of tRF-22 intervention on the angiogenesis activity of RF / 6A cells using Matrigel angiogenesis experiment provided in an embodiment of the present invention, wherein the upper picture 3E is a cell tube formation picture, and the lower picture 3H is a statistical analysis picture.

[0071] The results show that silencing of tRF-22 expression in in vitro experiments can lead to abnormal activation of choroidal endothelial cells and promote pathological neovascularization; suggesting that myopia-related stimuli lead to abnormal tRF-22 expression, regulate the function of choroidal vascular endothelial cells, and then regulate the process of choroidal vascular disease.

[0072] Example 2 Feasibility of using tRF-22 as a prognostic marker

[0073] Step 1: Obtain the fluid sample to be tested

[0074] The serum of 100 patients with high myopia complicated with choroidal neovascularization before and after treatment was collected.

[0075] Step 2: Extract RNA from the test fluid sample

[0076] a) Take 0.03ml of aqueous humor sample and transfer it to a centrifuge tube, add 300ul Lysis Buffer, vortex at high speed for 10 seconds to completely dissolve the cells and then put them into the lysis buffer. (Note: If the next step is not performed, the sample can be stored at -70℃ for a long time).

[0077] b) Centrifuge at 12,000 x g for 2 minutes. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is mainly in the aqueous phase. Transfer the aqueous phase to a new tube.

[0078] c) Add an equal volume of ice-cold 100% ethanol to the supernatant. There may be a precipitate at this step. This is normal. Invert the tube several times or pipette up and down to disperse the precipitate, then transfer the sample to the spin column. Centrifuge at 4000x g for 1 min at 4°C, discard the supernatant, and the RNA will precipitate at the bottom of the tube.

[0079] d) Mix 2 μl gDNA removal agent and 10 μl ddH2O and add to the center of the spin column. Incubate at room temperature for 5 min to degrade residual DNA.

[0080] e) Add 500 μl Wash Buffer and centrifuge at 12000 x g for 1 min. There is no need to discard the liquid, but directly transfer the column to an RNase-free 1.5 ml centrifuge tube, open the lid, and let it stand in the air for 2 min.

[0081] f) Add 20-30 μl Elution Buffer to the center of the column, incubate at room temperature for 2 minutes, and centrifuge at 12,000 x g for 1 minute (transfer the Elution Buffer back to the column, incubate for 5 minutes, and centrifuge again to obtain more RNA).

[0082] g) Discard the spin column, determine the RNA concentration, and use the purified RNA for the following experiments or store at -70°C.

[0083] h) The purity and concentration of RNA were measured using a BioDrop UV-Vis spectrophotometer.

[0084] Step 3: Reverse transcribe the obtained RNA into cDNA using EZB's microRNA Reverse Transcription Kit. According to the system provided by the kit (20μl), configure as follows: 5μl of RNA treated with gDNA Remover, 5μl of 4x miRNA RT Buffer, 2μl of miRNA RT Enzyme Mix, 8μl of Nuclease free ddH2O, and reverse it to cDNA according to the following procedure: 37℃15min, 42℃10min, 95℃3min, and store the obtained cDNA at -20℃.

[0085] Step 4: Probe-based quantitative PCR

[0086] The probe quantitative PCR reaction system (20 μl) used EZ-probe qPCR Master Mix for microRNA (ROX2 plus) from EZB Company. The system configuration according to the instructions was as follows: 2x EZ-probe qPCR Master Mix for microRNA 10 μl, Probe (10 μM) 0.4 μl, specific qRT-PCR upstream primer 0.8 μl (specifically identifying tRF-22 or U6), downstream primer 0.8 μl, cDNA of the sample to be tested 2 μl, and RNase free ddH2O was added to make up to 20 μl.

[0087] PCR conditions: 95°C for 5 min, 92°C for 10 s, 60°C for 30 s, and 40 cycles.

[0088] Step 5: Data Analysis

[0089] Gene expression values ​​were calculated using the Delta Ct method, assuming that the amplification efficiencies of the target gene and the reference gene were close to 100% and the relative deviation did not exceed 1 Ct; ΔCt = mean Ct of the target gene - mean Ct of the reference gene, where U6 was selected as the reference gene.

[0090] Step 6: Result judgment

[0091] Calculate the ΔCt of the sample to be tested and analyze its changes before and after surgical treatment. Figure 4 As shown: serum was collected from patients with high myopia complicated with choroidal neovascularization before and after treatment; total RNA was extracted using Trizol reagent, and cDNA of total RNA was obtained by reverse transcription PCR; the expression level of target tRF-22 was detected by probe quantitative PCR, as shown Figure 4 As shown, Figure 450 representative cases were selected from 100 cases. Probe-based quantitative PCR was used to analyze the expression difference of tRF-22 in the serum of patients with high myopia complicated by choroidal neovascularization before and after treatment. The results showed that the expression of tRF-22 in the serum of patients with choroidal neovascularization after treatment was significantly upregulated, indicating that tRF-22 is expected to become a target for evaluating surgical efficacy and prognosis.

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of a kit for detecting the expression of a biomarker for high myopia complicated with choroidal neovascularization in the preparation of a diagnostic reagent for high myopia complicated with choroidal neovascularization, characterized in that: The biomarker is tRF-22, and the nucleotide sequence is shown in SEQ ID NO.

1. The kit includes: 2×EZ-probe qPCR MasterMix for microRNA, Probe, universal 3' downstream primer, qRT-PCR upstream primer that specifically recognizes tRF-22, and qRT-PCR upstream primer that specifically recognizes U6; The qRT-PCR upstream primer that specifically recognizes tRF-22 is shown in SEQ ID NO:2; the qRT-PCR upstream primer sequence of U6 is shown in SEQ ID NO:

3.

2. The use of a kit for detecting the expression of a biomarker for high myopia complicated with choroidal neovascularization as claimed in claim 1 in preparing a diagnostic reagent for high myopia complicated with choroidal neovascularization, characterized in that: The biomarker is detected based on real-time fluorescence quantitative PCR technology.

3. The use of a kit for detecting the expression of a biomarker for high myopia complicated with choroidal neovascularization as claimed in claim 1 in preparing a diagnostic reagent for high myopia complicated with choroidal neovascularization, characterized in that: The kit also includes a reverse transcription reaction system, which includes: gDNA Remove, 4× miRNA RT Buffer, miRNA RT Enzyme Mix, and Nuclease free ddH2O.

4. The use of a kit for detecting the expression of a biomarker for high myopia complicated with choroidal neovascularization as claimed in claim 1 in preparing a diagnostic reagent for high myopia complicated with choroidal neovascularization, characterized in that: The kit also includes an RNA extraction system, which includes Trizol reagent, chloroform, anhydrous ethanol, DEPC ddH2O, ddH2O, and isopropanol.

Images