Application of IDD proteins and related biomaterials in controlling rice leaf structure

Abstract

The present invention discloses a group of IDD proteins and their related biomaterials for use in controlling rice leaf structure. The present invention belongs to the field of biotechnology, and specifically relates to a group of IDD proteins and their related biomaterials for use in controlling rice leaf structure. The present invention provides the use of proteins OsIDD12 and OsIDD13 or substances that regulate their expression or substances that regulate protein activity or content in regulating plant leaf structure. Experiments have shown that proteins OsIDD12 and OsIDD13 can regulate rice leaf structure. By knocking out OsIDD12 and OsIDD13 genes, it was found that proteins OsIDD12 and OsIDD13 can control the increase in the number of veins and vein density in rice leaves, which has important theoretical significance for the creation of dominant C4 rice and rice breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of a group of IDD proteins and related biological materials in controlling the structure of rice leaves. Background Art

[0002] Photosynthesis provides a source of material and energy for the growth and development of rice. It is also the metabolic basis for the accumulation of starch and other nutrients in rice grains after they are full-grown. Improving the efficiency of photosynthesis is the key to increasing rice yields. Rice is a typical C3 plant. The key enzyme in the Kelvin cycle that catalyzes the dark reaction of photosynthesis is ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCo). RuBisCo has low carboxylation efficiency, and RuBisCo has both carboxylase and oxygenase activities. The low CO in the leaves caused by the frequent closure of the plant's stomata 2 The environment causes the activity of RuBisCo oxygenase to increase, consuming a large amount of effective photosynthetic products, resulting in a decrease in photosynthetic efficiency; and stomatal closure simultaneously promotes photorespiration of C3 rice, which greatly reduces the photosynthetic efficiency. It is reported that photorespiration causes rice to lose at least 30% of its theoretical yield.

[0003] Highly photosynthetic C4 plants have evolved in nature, and their CO 2 The fixation of is completed by phosphoenolpyruvate carboxylase (PEPC) in mesophyll cells. PEPC has a very high carboxylation efficiency, and it is generally believed that its conversion efficiency is a thousand times that of RuBisCo carboxylase. The high efficiency of PEPC reduces the amount of carboxylase required for C4 photosynthesis, thereby greatly reducing the demand for nitrogen in C4 plants (in order to meet photosynthesis, more than 50% of the protein in the leaves is RuBisCo). C4 plant CO 2 The fixation is completed in two types of cells. The PEPC-catalyzed carboxylation reaction is carried out in the mesophyll cells, and the 4-carbon product produced is transported to the vascular bundle sheath cells and then released through decarboxylation and CO 2 The Kelvin cycle is then completed, CO 2 It is concentrated in the leaf sheath cells and inhibits the oxygenase activity of RuBisCo and also inhibits photorespiration, thereby greatly improving photosynthetic efficiency. C4 plants only need a small amount of PEPC to meet CO 2 The carbonylation of C4 plants leads to a higher nitrogen utilization rate than C3 plants. 2 The concentration mechanism enables C4 plants to maintain a certain level of photosynthesis even after stomatal closure under high temperature and water deficit, thus having a higher water use efficiency.

[0004] Introducing the C4 pathway into C3 crops such as rice is a technological approach with great potential to improve photosynthetic efficiency. It also improves the water use efficiency and nitrogen use efficiency of rice, which meets the requirements of high-yield, high-efficiency and environmentally friendly agricultural production. C4 photosynthesis requires two types of cells (see Figure 1 ) is completed, in which the mesophyll cells only have the ability to fix CO 2 The function of the bundle sheath cells is to carry out CO 2 C4 plants have also evolved a special anatomical structure with high vein density that is adapted to the C4 photosynthetic pathway. The ratio of vascular bundle sheath cells to mesophyll cells between adjacent veins (vascular bundles) in C4 plant leaves is 1:1. This is a specific anatomical structure that all C4 grass plants, including crops such as corn, millet and sorghum, have (see Figure 1 In leaves of C3 photosynthetic crops such as rice, the ratio of bundle sheath cells to mesophyll cells between adjacent veins (vascular bundles) is about 1:4 (see Figure 1 Increasing the number / density of leaf veins or reducing the number / density of mesophyll cells is the key to changing the structure of rice leaves to form a C4 leaf structure. The vein type of rice is a typical parallel vein of monocots, consisting of a midrib (main vein) in the center of the leaf, multiple large veins on both sides of the midrib, and many small veins between the large veins parallel to the longitudinal direction (axis) of the leaf. These parallel veins are connected in the transverse direction of the leaf by connecting veins (reference: Sakaguchi J. & Fukuda H., Cell differentiation in the longitudinal veins and formation of commissural veins in rice (Oryza sativa) and maize (Zeamays), Journal of plant research, 2008, 121: 593-602). The large veins are also called large vascular bundles in the literature, and the small veins are called small vascular bundles (reference: Zou Liangping, Peng Ming, Research progress on rice leaf vein development, China Agricultural Science and Technology Herald, 2013, (1): 43-47).

[0005] Scientists have successfully introduced multiple enzymes required for the C4 photosynthetic pathway into rice, but have not been able to establish an effective C4 assimilation process. The reason for this result is that the C4-like anatomical structure has not been constructed in the rice leaves at the same time. This further suggests that the success of C4 rice requires not only the correct expression of C4 metabolic-related enzymes, but also the corresponding C4 leaf anatomical structure. At present, there are only a few reports on genes that control leaf vein density in leaves, and there are no reports on genes in rice that control the formation of C4-like anatomical structures in leaves. Summary of the invention

[0006] The technical problem to be solved by the present invention is how to synchronously construct an anatomical structure similar to that of C4 plants in rice leaves.

[0007] In order to solve the problems existing in the prior art, the present invention provides the use of a protein or a substance for regulating the expression of a gene or a substance for regulating the activity or content of the protein in regulating the structure of plant leaves.

[0008] The application provided by the present invention is the application of a protein or a substance for regulating the expression of a gene or a substance for regulating the activity or content of the protein in any of the following:

[0009] 1) Application of proteins or substances regulating gene expression or substances regulating the activity or content of the proteins in regulating plant leaf structure;

[0010] 2) Use of a protein or a substance that regulates the expression of a gene or a substance that regulates the activity or content of the protein in the preparation of a product that regulates plant leaf structure;

[0011] 3) Use of a protein or a substance regulating the expression of a gene or a substance regulating the activity or content of the protein in cultivating plants with altered leaf structures;

[0012] 4) Use of a protein or a substance regulating the expression of a gene or a substance regulating the activity or content of the protein in the preparation of a product for cultivating plants with altered leaf structures;

[0013] 5) Application of proteins or substances regulating gene expression or substances regulating the activity or content of the proteins in plant breeding;

[0014] The protein is any of the following:

[0015] G1) a composition consisting of a protein having an amino acid sequence of SEQ ID No. 1 and a protein having an amino acid sequence of SEQ ID No. 3;

[0016] G2) a protein whose amino acid sequence is SEQ ID No. 1 or a protein whose amino acid sequence is SEQ ID No. 3;

[0017] G3) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the proteins of G1) and G2) and having more than 80% identity with the protein shown in A1) and having functions related to regulating plant leaf structure;

[0018] G4) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of G1) or G2).

[0019] The protein whose amino acid sequence is SEQ ID No. 1 is named OsIDD12.

[0020] The protein whose amino acid sequence is SEQ ID No. 3 is named OsIDD13.

[0021] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0022] In the above protein, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0023] The above-mentioned regulation of leaf structure may be regulation of the number / density of leaf veins and / or the number / density of mesophyll cells between leaf veins.

[0024] The protein described in the above application is derived from rice (Oryza sativa).

[0025] Herein, the substance that regulates the activity and / or content of the protein may be a substance that regulates the expression of a gene encoding the proteins OsIDD12 and OsIDD13.

[0026] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0027] In the above application, the substance regulating gene expression and the substance regulating the activity or content of the protein may be a biological material related to the protein, and the biological material may be any one of the following:

[0028] c1) a nucleic acid molecule encoding the protein described above;

[0029] c2) an expression cassette containing the nucleic acid molecule described in c1);

[0030] c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2);

[0031] c4) a recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3);

[0032] c5) a transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2);

[0033] c6) transgenic plant tissue containing the nucleic acid molecule described in c1), or transgenic plant tissue containing the expression cassette described in c2);

[0034] c7) a transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2);

[0035] e1) a nucleic acid molecule that inhibits, reduces or silences the expression of the protein encoding gene mentioned above;

[0036] e2) an expression cassette containing the nucleic acid molecule described in e1);

[0037] e3) a recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2);

[0038] e4) a recombinant microorganism containing the nucleic acid molecule described in e1), or a recombinant microorganism containing the expression cassette described in e2), or a recombinant microorganism containing the recombinant vector described in e3);

[0039] e5) a transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2);

[0040] e6) transgenic plant tissue containing the nucleic acid molecule described in e1), or transgenic plant tissue containing the expression cassette described in e2);

[0041] e7) A transgenic plant organ containing the nucleic acid molecule described in e1), or a transgenic plant organ containing the expression cassette described in e2).

[0042] In the above biological material, the nucleic acid molecule described in c1) is a DNA molecule shown in any of the following:

[0043] d1) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.2;

[0044] d2) the coding region sequence is the 8th to 1609th position of the DNA molecule shown in SEQ ID NO.2 in the sequence listing;

[0045] d3) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.4;

[0046] d4) The coding region sequence is the 4th to 1518th position of the DNA molecule shown as SEQ ID NO. 4 in the sequence listing.

[0047] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0048] In the above e3), the recombinant vector may be a plant gene editing vector. The plant gene editing vector may be a pYLCRISPR / Cas9Pubi-H vector.

[0049] As a specific embodiment, the recombinant vector is the recombinant vector pCRISPR-OsIDD12 / OsIDD13. The recombinant vector pCRISPR-OsIDD12 / OsIDD13 is a vector containing a target site 5'- CGTGTGCGAGATCTGCAACC -3' sequence gRNA scaffold sequence (9430 to 9525 of SEQ ID No.5), promoter sequence (9047 to 9429 of SEQ ID No.5) and two spacer sequences (9024 to 9046; 9526 to 9558 of SEQ ID No.5) were inserted into the fragment between the restriction endonuclease BsaI site, and the other nucleotide sequences of the vector pYLCRISPR / Cas9Pubi-H were kept unchanged to obtain the pCRISPR-OsIDD12 / OsIDD13 recombinant vector. The recombinant plasmid was named the recombinant vector pCRISPR-OsIDD12 / OsIDD13.

[0050] The microorganism described in e4) above may be Agrobacterium, and the Agrobacterium is EHA105.

[0051] Those skilled in the art can easily mutate the nucleotide sequences encoding the proteins OsIDD12 and OsIDD13 of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequences of the proteins OsIDD12 and OsIDD13 isolated from the present invention are all derived from the nucleotide sequences of the present invention and are equivalent to the sequences of the present invention as long as they encode the proteins OsIDD12 and OsIDD13 and have the functions of the proteins OsIDD12 and OsIDD13.

[0052] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0053] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0054] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0055] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (ie, cosmid), Ti plasmid or viral vector.

[0056] The recombinant expression vector containing the OsIDD12 and OsIDD13 genes can be constructed using existing plant expression vectors. The plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment. The plant expression vectors may also include the 3' non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as, but not limited to, Agrobacterium crown gall induction (Ti) plasmid genes (such as rouge synthase Nos gene), plant genes (such as soybean storage protein genes) 3' end transcribed non-translated regions have similar functions.

[0057] When using OsIDD12 and OsIDD13 genes to construct recombinant plant expression vectors, any enhanced promoter or constitutive promoter can be added before the transcription start nucleotide, including but not limited to cauliflower mosaic virus (CAMV) 35S promoter, maize ubiquitin promoter (ubiquitin), which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are wide, and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene.

[0058] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0059] The invention also provides a method for regulating plant leaf structure.

[0060] The method for regulating plant leaf structure provided by the present invention comprises regulating plant leaf structure by simultaneously regulating the expression of genes encoding proteins OsIDD12 and OsIDD13 or regulating the activity and / or content of the proteins, or regulating the activity and / or content of genes encoding the proteins.

[0061] In the present invention, the regulation is down-regulation, inhibition or reduction.

[0062] The present invention also provides a method for cultivating plants with altered leaf structure.

[0063] The method for cultivating plants with altered leaf structures provided by the present invention comprises down-regulating or inhibiting or reducing the expression level of the genes encoding the proteins OsIDD12 and OsIDD13 in the target plant, or / and down-regulating or inhibiting or reducing the activity and / or content of the genes encoding the proteins, to obtain plants with altered leaf structures.

[0064] In the above-mentioned breeding method, the down-regulation or inhibition or reduction of the activity and / or content of the protein in the target plant, or / and the expression level of the gene encoding the protein can be obtained by introducing a recombinant expression vector containing a nucleic acid molecule that inhibits or reduces or silences the expression of the gene encoding the proteins OsIDD12 and OsIDD13 into the recipient plant, thereby obtaining the target plant with changed plant leaf structure.

[0065] The OsIDD12 and OsIDD13 genes encode the OsIDD12 and OsIDD13 proteins.

[0066] In one embodiment of the present invention, the method for cultivating a plant with altered leaf structure comprises the following steps:

[0067] 1) constructing a recombinant expression vector comprising the DNA molecules shown in SEQ ID NO.2 and SEQ ID NO.4 for inhibiting, reducing or silencing;

[0068] 2) Transforming the recombinant expression vector constructed in step 1) into a recipient plant (such as a crop or rice);

[0069] 3) Transgenic plants with altered leaf structures were obtained through screening and identification.

[0070] The introduction refers to introduction by recombinant means, including but not limited to Agrobacterium-mediated transformation, biolistic methods, electroporation, in planta technology, and the like.

[0071] By using any vector that can guide the expression of foreign genes in plants, the coding genes or gene fragments for knocking out proteins OsIDD12 and OsIDD13 provided by the present invention are introduced into plant cells or recipient plants, and transgenic cell lines and transgenic plants with altered plant leaf structures can be obtained. The expression vector carrying the coding genes for knocking out proteins OsIDD12 and OsIDD13 can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, and the transformed plant tissues can be cultivated into plants.

[0072] The microorganism described herein may be yeast, bacteria, algae or fungi. Among them, the bacteria may be from Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, etc. Specifically, it may be Agrobacterium EHA105.

[0073] In the present invention, the regulation may be up-regulation, enhancement or increase. The regulation may also be down-regulation, attenuation or reduction.

[0074] In the present invention, the purpose of plant breeding may include cultivating plants with altered leaf structures.

[0075] In the present invention, the leaf structure change may be to produce a C4-like plant anatomical structure.

[0076] In the present invention, the leaf structure change may specifically be an increase in the number / density of leaf veins and / or a decrease in the number / density of mesophyll cells between leaf veins.

[0077] The C4-like plant anatomical structure may be embodied in any of the following:

[0078] 1) The number of major veins in the leaves of the transgenic plant is increased;

[0079] 2) The number of leaf veins of the transgenic plant is increased;

[0080] 3) The number of small veins between the large veins of the transgenic plant is increased;

[0081] 4) The amount of mesophyll between the major and minor veins of the transgenic plant is reduced;

[0082] 5) The amount of mesophyll between the veins of the transgenic plant is reduced;

[0083] 6) The number of major veins on the leaves of the transgenic plant is higher than that of the recipient plant;

[0084] 7) The number of leaf veins of the transgenic plant is higher than that of the recipient plant;

[0085] 8) The number of small veins between the large veins of the transgenic plant is higher than that of the recipient plant.

[0086] 9) The amount of mesophyll between the major and minor veins of the transgenic plant is less than that of the recipient plant.

[0087] 10) The transgenic plants have less mesophyll between the veins than the recipient plants.

[0088] The major veins may be secondary veins inferior to the mid (main) vein in monocotyledons.

[0089] The veinlet may be a fine vein inferior to a secondary vein.

[0090] The major and minor veins together with the mid(main) vein constitute the parallel vein system of monocotyledonous plants such as rice.

[0091] In the present invention, the plant may be any one of the following:

[0092] E1) monocots or dicots,

[0093] E2) Graminales,

[0094] E3) Gramineae plants,

[0095] E4) Oryza plants,

[0096] E5) Rice.

[0097] The proteins or biological materials described herein also fall within the scope of protection claimed by the present invention.

[0098] The present invention studies the function of the proteins OsIDD12 and OsIDD13 acting together to change the anatomical structure of rice leaves and produce a C4-like anatomical structure of leaves. The OsIDD12 and OsIDD13 genes were simultaneously knocked out by the CRISPR-Cas9 gene editing method so that there were no normal OsIDD12 and OsIDD13 protein products in the rice body. The results of verifying the gene function showed that the loss of proteins OsIDD12 and OsIDD13 in rice can increase the number of small veins between large veins, and at the same time reduce the number of mesophyll cells between veins and reduce the density of mesophyll cells, thereby increasing the vein density of leaves. The present invention is of great significance in the application of creating C4 rice, and provides an important structural control gene for the introduction of the C4 photosynthetic pathway of C4 rice. The present invention provides an important candidate gene for C4 rice breeding and provides a chassis material for promoting the creation of high-light-efficiency rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0099] Figure 1 Schematic diagram of the anatomical structure of typical C3 plant (rice) and C4 plant (corn) leaves.

[0100] Figure 2 This is a schematic diagram of the effect of freehand slicing, which is used to screen transgenic materials and strains with changes in leaf structures such as veins, as well as to count the number of veins and mesophyll cells of each transgenic material.

[0101] Figure 3 To reduce the relative expression levels of OsIDD12 and OsIDD13 genes in OsIDD12 and OsIDD13 expressing plants by gene knockout.

[0102] Figure 4 The morphology of plants with reduced expression of OsIDD12 and OsIDD13. The plant on the far left is the control Nipponbare, the plant in the middle is transgenic line 1, and the plant on the right is transgenic line 2. The white scale in the figure represents 20 cm.

[0103] Figure 5The leaf morphology of the materials with reduced OsIDD12 and OsIDD13 expression. The leftmost leaf is the flag leaf of the control Nipponbare, the middle plant is the flag leaf of transgenic line 1, and the right plant is the flag leaf of transgenic line 2. The white scale in the figure represents 15 cm.

[0104] Figure 6 Paraffin sections of flag leaves of OsIDD12 and OsIDD13 plants. The upper picture shows a cross section of the flag leaf of the control Nipponbare, the middle picture shows a cross section of the flag leaf of transgenic line 1, and the lower picture shows a cross section of the flag leaf of transgenic line 2. The black numbers indicate the mesophyll cells, and the black scale in the picture represents 100 microns.

[0105] Figure 7 To reduce the number of veins in the flag leaves of OsIDD12 and OsIDD13 plants, the left figure shows the number of large veins, which is significantly higher in transgenic lines 1 and 2 than in Nipponbare (p<0.05), and the right figure shows the number of small veins, which is significantly higher in transgenic lines 1 and 2 than in Nipponbare (p<0.01).

[0106] Figure 8 To reduce the number of mesophyll cells in the flag leaves of OsIDD12 and OsIDD13 plants, the number of interveinal mesophyll cells in transgenic lines 1 and 2 was significantly reduced compared with that in Nipponbare (p<0.01). DETAILED DESCRIPTION

[0107] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0108] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0109] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0110] The japonica rice variety "Nipponbare" in the following examples has been recorded in: Goff, SA et al., (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science (New York, NY), 296 (5565), 92-100, and the public can obtain it from the Institute of Biotechnology, Chinese Academy of Agricultural Sciences. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0111] The vector pYLCRISPR / Cas9Pubi-H in the following examples is from: Liu Yaoguang, State Key Laboratory of Conservation and Utilization of Subtropical Agricultural Biological Resources, South China Agricultural University. Recorded in: Ma, X. et al., (2015). A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Molecular Plant 8: 1274-1284, based on the doctoral dissertation of this laboratory "Creation of Maize Transcription Factor Overexpression Materials in Rice and Study on the Function of OsbHLH91 / OsbHLH92 Genes", author: Teng Shouzhen (awarded in 2022). The sequence is published in gene bank (GenBank: KR029109.1). The public can obtain it from the Institute of Biotechnology, Chinese Academy of Agricultural Sciences. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0112] The statistical method in the following examples is the student's T-test method built into the statistical software SSPS. The number of samples is the Nipponbare wild-type control, and at least 11 individual plants are counted for each transgenic line.

[0113] Example 1. Acquisition of OsIDD12 and OsIDD13 genes

[0114] 1. Acquisition of OsIDD12 gene

[0115] The OsIDD12 gene was amplified by PCR, and the high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase) was purchased from Vazyme. The cDNA reverse transcribed from the total RNA of the leaves of Nipponbare 7 days after germination was used as a template, and the primers were OsIDD12-F: 5-'GGACATCATGCTGAGTTCTTGCG-3', OsIDD12-R: 5-'CTAGTTGAGGTCCATTGCCATCG-3' for PCR amplification. The PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2. The amplified product was sequenced. The coding sequence of OsIDD12 protein in the rice variety Nipponbare is the nucleotide sequence shown in SEQ ID NO.2 from position 8 to position 1609, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.1.

[0116] Table 1. PCR reaction system of OsIDD12 gene

[0117] sample Addition volume (μL) cDNA template 2 OsIDD12-F (10mM) 2 OsIDD12-R (10mM) 2 DMSO 2.5 dNTP (2.5 mM each) 2.5 Reaction Buffer (10X) 5 Phanta(5U / μL) 1 <![CDATA[ddH 2 The]]> 33 Total volume 50

[0118] Table 2. PCR reaction conditions of OsIDD12 gene

[0119]

[0120]

[0121] 2. Acquisition of OsIDD13 gene

[0122] The OsIDD13 gene was amplified by PCR, and the high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase) was purchased from Vazyme. The total RNA reverse transcribed from the leaves of Nipponbare 7 days after germination was used as a template, and the primers were OsIDD13-F: 5-'GCCATGTTGGGTTCTTGCG-3', OsIDD13-R: 5-'CTACATGATGCCCATGCTGTTAGC-3' for PCR amplification. The PCR reaction system is shown in Table 3, and the reaction conditions are shown in Table 2. The amplified product was sequenced. The coding sequence of OsIDD13 protein in the rice variety Nipponbare is the nucleotide sequence shown in SEQ ID NO.4 from position 4 to position 1518, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.3.

[0123] Table 3. PCR reaction system of OsIDD13 gene

[0124]

[0125] Example 2: Obtaining and phenotypic identification of plants with reduced expression

[0126] 1. Reduce the acquisition of expression plants

[0127] 1) The pCRISPR-OsIDD12 / OsIDD13 gene knockout vector was constructed as follows:

[0128] This method is based on the CRISPR-Cas9 gene editing system, which specifically destroys the OsIDD12 and OsIDD13 genes at the same time so that they cannot express normal products (OsIDD12 and OsIDD13 proteins). Specific gene editing target sites are designed according to the vector requirements and the characteristics of the OsIDD12 and OsIDD13 genes. These sites are common specific sites on the OsIDD12 and OsIDD13 genes: 5'-CGTGTGCGAGATCTGCAACC-3', and no other gene in the entire rice genome contains a matching sequence. According to the primers listed in Table 4, the PCR method was used to amplify each DNA fragment containing the target site, and then the fragment was connected to the target target fragment and the vector backbone pYLCRISPR / Cas9Pubi-H in the enzyme digestion-ligation system. The specific connection steps are as follows: after 37℃ BsaI digestion for 10 minutes, add: 1.5μL of T4 DNA ligase buffer with 10 times the system concentration and 0.2μL of T4 DNA ligase, connect on the PCR instrument for variable temperature cycle: 37℃2min, 10℃3min, 20℃5min, a total of 15 cycles, and finally react at 37℃ for 2min. The connection product was sequenced to determine that the connection was correct, and the pCRISPR-OsIDD12 / OsIDD13 knockout vector was obtained, and its nucleotide sequence is shown in SEQ ID No.5 and SEQ ID No.6. The pCRISPR-OsIDD12 / OsIDD13 knockout vector is a double-stranded DNA consisting of 16269 bp, wherein the nucleotide sequence at positions 1 to 15000 of one chain is positions 1 to 15000 of SEQ ID No.5, and the nucleotide sequence at positions 15001 to 16269 is positions 1 to 1269 of SEQ ID No.6.

[0129] pCRISPR-OsIDD12 / OsIDD13 knockout vector is a vector containing the target site 5'- CGTGTGCGAGATCTGCAACC-3' sequence, the gRNA scaffold sequence (9430 to 9525 of SEQ ID No.5), the promoter sequence (9047 to 9429 of SEQ ID No.5) and two spacer sequences (9024 to 9046; 9526 to 9558 of SEQ ID No.5) were inserted into the fragment between the restriction endonuclease BsaI sites, and the other nucleotide sequences of the vector pYLCRISPR / Cas9Pubi-H were kept unchanged to obtain the pCRISPR-OsIDD12 / OsIDD13 recombinant vector.

[0130] Table 4. Primer sequences used for gene knockout

[0131]

[0132] 2) Obtaining recombinant Agrobacterium

[0133] The knockout vector pCRISPR-OsIDD12 / OsIDD13 obtained in step 1 was transferred into Agrobacterium tumefaciens EHA105 (Miaoling Biotechnology, catalog number: CCell32003) by electroporation to obtain recombinant Agrobacterium, which was named EHA105 / pCRISPR-OsIDD12 / OsIDD13 and used to transform rice callus.

[0134] 3) Genetic transformation of rice

[0135] After the mature seeds of Nipponbare were cultured in an induction medium for 3 weeks (culture conditions: 32°C light intensity 13230Lx), the vigorously growing callus was selected as the recipient of transformation. The recombinant bacteria EHA105 / pCRISPR-OsIDD12 / OsIDD13 obtained in step 2 was used to infect the callus, cultured in the dark at 25°C for 3 days, and then cultured on a screening medium containing 50mg / L hygromycin and 400mg / L carbenicillin for 2 weeks (culture conditions: 32°C, light intensity 13230Lx). Individuals without Agrobacterium contamination and with fresh callus growth were used for differentiation culture (culture conditions: 32°C, light intensity 13230Lx). After the seedlings were differentiated, they were transferred to the rooting and seedling medium for culture for about 2 weeks (culture conditions: 32°C, light intensity 13230Lx) and then transferred to the field for planting to obtain T. 0 Transgenic rice plants with OsIDD12 and OsIDD13 knockout were generated, and transgenic positive plant lines were identified by PCR. Positive plants were harvested to obtain T 1 Generation of seeds.

[0136] 2. Preliminary phenotype identification of transgenic plants with knockout of OsIDD12 and OsIDD13

[0137] For the T obtained in step 11 The seeds of the first generation were planted in the field and T 1 Generation of plants, take T 1 The leaves of the first-generation transgenic plants were sliced ​​manually for preliminary screening, and the plant types with obvious changes in leaf structure were marked. The growth of the plants was observed, and the normal fruiting plants were harvested in the harvest season to obtain T 2 Generation of seeds.

[0138] 1) Manual sectioning of transgenic plants with knockout of OsIDD12 and OsIDD13 to preliminarily screen for strains with altered leaf structures

[0139] Chloral hydrate, lactic acid, toluidine blue, toothpicks, double-sided knives, and glass slides were purchased from the market.

[0140] a. Sample

[0141] The above harvested T 2 The seeds were planted in the greenhouse to obtain T 2 For the first generation of transgenic rice, we took leaves of transgenic rice plants and wild-type rice (Nipponbare) grown in the greenhouse for 60 days, and cut a 1-cm-long leaf segment from the middle of the leaf. Ten rice plants were measured in each strain each time, and a total of 200 plants from 20 strains were examined.

[0142] b. Fixed

[0143] Place the cut leaf segment sample block in a 2 mL centrifuge tube and add 1.5 mL of freshly prepared Carnoy's fixative (anhydrous ethanol: glacial acetic acid = 3:1) for fixation. Use a vacuum apparatus in an indoor fume hood to evacuate until the leaf completely sinks, and replace the fixative once every 24 hours. After leaving it at room temperature for 1 week, slice it by hand for observation.

[0144] c. Sectioning and staining

[0145] Use two tightly fitting double-sided blades to cross-cut the material, transfer the material to a decolorizing solution (saturated chloral hydrate lactic acid solution), and place it in the decolorizing solution at 50°C for 4 hours. Use a toothpick to transfer the decolorized material to clean water, then use tweezers to pick up the material in the clean water, dye it in 1% toluidine blue dye for 10-20 seconds, and then rinse it in clean water to remove the floating color. Then use a toothpick to transfer it to a slide.

[0146] d. Microscope observation and recording

[0147] Observe under a low-power microscope and record the strains with obvious changes in leaf structure.

[0148] The results showed that among the 20 independent transgenic lines, 10 lines had at least one individual plant with obvious changes in leaf structure. Finally, the offspring of the two transgenic lines pCRISPR-OsIDD12 / OsIDD13 were identified for detailed observation and statistics.

[0149] 3. Detailed observation and statistics of leaf anatomical phenotypes of transgenic plants with OsIDD12 and OsIDD13 knockout

[0150] The two transgenic lines T obtained in the previous step were 2 The seeds of the first generation were planted in the field and T 2 Generation of plants, take T 2 The leaves of the first-generation plants were manually sliced ​​and screened (20 plants for each line, repeated once) to further clarify the phenotypes of the two transgenic lines in the previous step, and they were named transgenic line 1 and transgenic line 2, respectively.

[0151] Quantitative PCR test results ( Figure 3 ) showed that the expression levels of OsIDD12 and OsIDD13 were significantly lower than those of wild-type Nipponbare. The morphological observation results were as follows: Compared with WT plants at the same period, T 2 The plant height of transgenic lines 1 and 2 of the first generation of transgenic rice plants decreased, and the number of tillers increased ( Figure 4 ); the length-width ratio of the flag leaf was reduced compared with that of the WT plant ( Figure 5 ).

[0152] 1) Paraffin sections of leaves from plants with OsIDD12 and OsIDD13 knockout

[0153] The two lines pCRISPR-OsIDD12 / OsIDD13 identified through manual section observation will be further observed and statistically analyzed. Specifically, each transgenic line will be planted in the field. 20 days after the plants bloom and enter the grain filling period, the flag leaves will be taken for paraffin sectioning in order to carefully observe the changes in leaf structure. Paraffin sections will be sampled from 2 plants of each line with obvious structural changes, and 2 flag leaves will be taken from each plant.

[0154] 2) Paraffin sections of leaves from plants with reduced expression

[0155] Glacial acetic acid, ethanol, xylene, adhesive tablets, safranin, fast green, neutral gum, slides, and cover slips were purchased from the market.

[0156] a. Sample

[0157] The flag leaf of the transgenic line material with reduced expression in field cultivation was taken 20 days after flowering.

[0158] b. Material Fixation

[0159] Take a 1-2 cm section of the flag leaf and fix it with a newly prepared Carnoy fixative (anhydrous ethanol: glacial acetic acid = 3:1). Use a room temperature vacuum pump to evacuate the sample so that it is completely submerged in the fixative. Place it at room temperature for 24 hours, and replace the fixative once. The material is preserved in the fixative for a long time.

[0160] c. Material dehydration

[0161] After fixation for one week, the material was rinsed three times with 70% ethanol. Dehydration was repeated three times with 70% ethanol for 2 hours. Dehydration was repeated three times with 75%, 80%, 85%, 90%, 100%, and 100% ethanol in different concentrations, each for 1 hour.

[0162] d. Material transparency

[0163] The materials stored in 100% ethanol were cleared using different gradients of ethanol / xylene clearing solutions, namely 100% ethanol, ethanol / xylene = 3:1, ethanol / xylene = 1:1, ethanol / xylene = 1:3, 100% xylene, and 100% xylene for 1 hour each.

[0164] e. Material wax dipping

[0165] At about 38℃, gradually add crushed paraffin into xylene until the volume ratio reaches 1:1, and wait until the paraffin is completely dissolved. Transfer the above paraffin to a 58℃ incubator to allow the xylene to completely evaporate, then divide it into small beakers with materials, and then keep it at 58℃, replace new paraffin every 4 hours, and repeat three times.

[0166] f. Material embedding

[0167] Place the wax-soaked material in a small paper box, then pour in the melted paraffin, and then place the small paper box in cold water to solidify the paraffin as quickly as possible.

[0168] g. Material slicing and spreading

[0169] As needed, trim the wax block embedded with the material into a trapezoidal shape with a blade. Keep the wax block intact and keep as little paraffin as possible around the material. Stick the trimmed wax block to a hardwood block (a small homemade wooden block, about 1 cm × 2 cm × 2 cm), and then fix the wax block to the wax carrier of the slicer. Adjust the angle of the slice and adjust the machine to make the slice thickness 8 microns. Add a drop of water and sample adhesive tablet to each clean slide and spread it evenly, float the wax strip on the slide, and then spread the slide on a 42°C slide spreader.

[0170] h. Wax dissolution and rehydration

[0171] The sections were placed in xylene to dissolve the paraffin until it was completely dissolved, and then placed in xylene:anhydrous ethanol (1:1) for 5 minutes, 100%, 95%, 90%, 85%, 80%, 70%, 50%, 35% ethanol, and rehydrated in distilled water for 5 minutes each.

[0172] i. Dyeing and dehydration

[0173] Dye with 1% safranin aqueous solution for about 12 hours, rinse with running water to remove excess dye, and then dehydrate in 35%, 50%, and 70% ethanol for 5 minutes each. Continue to dye in 0.1% fast green for about 10 seconds, immediately enter 100% ethanol for 30 seconds, 100% ethanol, absolute ethanol: xylene (1:1), and xylene for 5 minutes each.

[0174] j. Seal film

[0175] The above slides are blown dry at room temperature. After confirming that the staining is successful through microscopic examination, a drop of mounting medium is dropped onto the material, and then a coverslip is carefully placed and allowed to air dry naturally.

[0176] k. Microscope observation and photography

[0177] Use a microscope with a built-in camera system to perform microscopic observation and photography of materials.

[0178] The results showed that compared with the wild type of Nipponbare, shutting down the expression of genes OsIDD12 and OsIDD13 by gene editing can effectively change the leaf structure of rice. The phenotype is that the number of leaf veins increases, and the number of mesophyll cells between veins (between adjacent large and small veins and between small veins) decreases significantly. Figure 6 In Nipponbare, there is typically an interval of 8 cells between two veinlets, but after knocking out OsIDD12 and OsIDD13, the number of mesophyll cells is reduced to about 5.

[0179] 3) Statistics of leaf veins and mesophyll cells in plants with OsIDD12 and OsIDD13 knockout

[0180] The number of mesophyll cells at all levels of veins and between veinlets of 11 plants with clear phenotypes after screening 20 plants in each of the above pCRISPR-OsIDD12 / OsIDD13 lines was statistically analyzed. The statistics showed that the increase in the number of veins and the decrease in the number of mesophyll cells were statistically significantly different. The results are shown in Figure 7 and Figure 8 Student's t-test was used, with P<0.01 indicating a very significant difference and P<0.1 indicating a significant difference.

[0181] In summary, OsIDD12 and OsIDD13 proteins have the function of controlling the structure of rice leaves. Reducing the expression of OsIDD12 and OsIDD13 genes by gene knockout can increase the number of small veins between large veins in rice leaves, while reducing the number of mesophyll cells between veins and the density of mesophyll cells, thereby increasing the vein density of leaves.

[0182] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application, characterized in that: The application is any one of U1)-U4): U1) Use of proteins or substances that regulate gene expression or substances that regulate the activity or content of the proteins in regulating plant leaf structure; U2) Use of a protein or a substance that regulates gene expression or a substance that regulates the activity or content of the protein in the preparation of a product that regulates plant leaf structure; U3) Use of a protein or a substance that regulates gene expression or a substance that regulates the activity or content of the protein in cultivating plants with altered plant leaf structures; U4) Use of a protein or a substance that regulates gene expression or a substance that regulates the activity or content of the protein in the preparation of a product for cultivating plants with altered plant leaf structures; The protein is the protein shown in G1) or G2): G1) a composition consisting of a protein having an amino acid sequence of SEQ ID No. 1 and a protein having an amino acid sequence of SEQ ID No. 3; G2) a fusion protein obtained by connecting a protein tag to the N-terminus or / and the C-terminus of G1); The substance is a recombinant expression vector comprising a nucleic acid molecule that inhibits, reduces or silences the expression of the gene encoding the protein; The recombinant expression vector is based on the CRISPR-Cas9 gene editing system; The leaf structure changes are an increase in the number or density of leaf veins, and / or a decrease in the number or density of mesophyll cells between leaf veins.

2. The use according to claim 1, characterized in that: The protein is derived from rice.

3. The use according to claim 1 or 2, characterized in that: The recombinant expression vector is a double-stranded DNA consisting of 16269 bp, the nucleotide sequence of positions 1-15000 of one chain is positions 1-15000 of SEQ ID No.5, and the nucleotide sequence of positions 15001-16269 is positions 1-1269 of SEQ ID No.

6.

4. A method for regulating plant leaf structure, characterized in that: The method comprises regulating the activity and / or content of a protein in a target plant, or / and regulating the expression level of a gene encoding the protein, to regulate the plant leaf structure; The regulating the activity and / or content of a protein in a target plant, or / and regulating the expression of a gene encoding the protein, comprises introducing into a recipient plant a recombinant expression vector comprising a nucleic acid molecule that inhibits, reduces or silences the expression of a gene encoding the protein, wherein the recombinant expression vector is based on a CRISPR-Cas9 gene editing system; The protein is the protein shown in G1) or G2): G1) a composition consisting of a protein having an amino acid sequence of SEQ ID No. 1 and a protein having an amino acid sequence of SEQ ID No. 3; G2) a fusion protein obtained by connecting a protein tag to the N-terminus or / and the C-terminus of G1); The plant is rice; The leaf structure changes are an increase in the number or density of leaf veins, and / or a decrease in the number or density of mesophyll cells between leaf veins.

5. The method according to claim 4, characterized in that: The recombinant expression vector is a double-stranded DNA consisting of 16269 bp, the nucleotide sequence of positions 1-15000 of one chain is positions 1-15000 of SEQ ID No.5, and the nucleotide sequence of positions 15001-16269 is positions 1-1269 of SEQ ID No.

6.

6. A breeding method for cultivating plants with altered leaf structures, comprising regulating the activity and / or content of a protein in a target plant, or / and regulating the expression level of a gene encoding the protein, to obtain plants with altered leaf structures; The regulating the activity and / or content of a protein in a target plant, or / and regulating the expression of a gene encoding the protein, comprises introducing into a recipient plant a recombinant expression vector comprising a nucleic acid molecule that inhibits, reduces or silences the expression of a gene encoding the protein, wherein the recombinant expression vector is based on a CRISPR-Cas9 gene editing system, to obtain a target plant with a changed plant leaf structure; The protein is the protein shown in G1) or G2): G1) a composition consisting of a protein having an amino acid sequence of SEQ ID No. 1 and a protein having an amino acid sequence of SEQ ID No. 3; G2) a fusion protein obtained by connecting a protein tag to the N-terminus or / and the C-terminus of G1); The plant is rice; The leaf structure changes are an increase in the number or density of leaf veins, and / or a decrease in the number or density of mesophyll cells between leaf veins.

7. The method according to claim 6, characterized in that: The recombinant expression vector is a double-stranded DNA consisting of 16269 bp, the nucleotide sequence of positions 1-15000 of one chain is positions 1-15000 of SEQ ID No.5, and the nucleotide sequence of positions 15001-16269 is positions 1-1269 of SEQ ID No.6.

Images