Cas enzymes and systems and applications

Abstract

The present invention belongs to the field of nucleic acid editing, in particular to the field of clustered regularly interspaced short palindromic repeats (CRISPR) technology. Specifically, the present invention provides a novel Cas enzyme, which has low homology with reported Cas enzymes, can exhibit nuclease activity inside and outside cells, and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of gene editing, in particular to the technical field of regularly clustered interspaced short palindromic repeats (CRISPR). Specifically, the present invention relates to a novel CRISPR enzyme (or, referred to as CRISPR protein, Cas effector protein, Cas enzyme or Cas protein), a fusion protein comprising such a protein, and nucleic acid molecules encoding them. The present invention also relates to a complex and composition for nucleic acid editing (e.g., gene or genome editing), which comprises a Cas protein or fusion protein of the present invention, or a nucleic acid molecule encoding them. Background Art

[0002] CRISPR / Cas technology is a widely used gene editing technology that uses RNA to guide specific binding to target sequences on the genome and cut DNA to produce double-strand breaks, and uses biological non-homologous end joining or homologous recombination for site-specific gene editing.

[0003] The CRISPR / Cas9 system is the most commonly used Type II CRISPR system, which recognizes the PAM motif of 3'-NGG and performs blunt-end cleavage on the target sequence. The CRISPR / Cas Type V system is a newly discovered CRISPR system that has a 5'-TTN motif and performs sticky-end cleavage on the target sequence, such as Cpf1, C2c1, CasX, and CasY. However, the different CRISPR / Cas systems currently available have different advantages and disadvantages. For example, Cas9, C2c1, and CasX all require two RNAs for guide RNA, while Cpf1 only requires one guide RNA and can be used for multiple gene editing. CasX has a size of 980 amino acids, while the common Cas9, C2c1, CasY, and Cpf1 are usually around 1,300 amino acids in size. In addition, the PAM sequences of Cas9, Cpf1, CasX, and CasY are relatively complex and diverse, while C2c1 recognizes the rigorous 5'-TTN, so its target site is easier to predict than other systems, thereby reducing potential off-target effects.

[0004] In summary, given that the currently available CRISPR / Cas systems are limited by some defects, the development of a more robust new CRISPR / Cas system with multi-faceted good performance is of great significance to the development of biotechnology. Summary of the invention

[0005] After a lot of experiments and repeated exploration, the inventors of this application unexpectedly discovered a new type of nuclease (Cas enzyme). Based on this discovery, the inventors developed a new CRISPR / Cas system and a gene editing method and nucleic acid detection method based on the system.

[0006] Cas effector proteins

[0007] On the one hand, the present invention provides a Cas protein, which is an effector protein in the CRISPR / Cas system. In the present invention, it is referred to as Cas-sf0135, Cas-sf6844, Cas-sf5525, Cas-sf6327, Cas-sf3539, Cas-sf0153, Cas-sf4073, Cas-sf0352, Cas-sf8808, Cas-sf8856 and Cas-sf3391, and the amino acid sequences of the above proteins are shown in SEQ ID No.1-11 respectively.

[0008] In one embodiment, the Cas protein amino acid sequence has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to any one of SEQ ID No.1-11, and substantially retains the biological function of the sequence from which it is derived. Preferably, the Cas protein is derived from the same species as Cas-sf0135, Cas-sf6844, Cas-sf5525, Cas-sf6327, Cas-sf3539, Cas-sf0153, Cas-sf4073, Cas-sf0352, Cas-sf8808, Cas-sf8856 or Cas-sf3391.

[0009] In one embodiment, the amino acid sequence of the Cas protein has a sequence of one or more amino acid substitutions, deletions or additions compared to any of the sequences of SEQ ID No. 1-11; and the biological function of the sequence from which it is derived is substantially retained; the one or more amino acid substitutions, deletions or additions include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions. Preferably, the Cas protein is derived from the same species as Cas-sf0135, Cas-sf6844, Cas-sf5525, Cas-sf6327, Cas-sf3539, Cas-sf0153, Cas-sf4073, Cas-sf0352, Cas-sf8808, Cas-sf8856 or Cas-sf3391.

[0010] It is clear to those skilled in the art that the structure of a protein can be changed without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples and embodiments of conservative amino acid substitutions are clear to those skilled in the art. Specifically, the amino acid residue can be replaced with another amino acid residue belonging to the same group as the site to be replaced, that is, a non-polar amino acid residue can be substituted for another non-polar amino acid residue, a polar uncharged amino acid residue can be substituted for another polar uncharged amino acid residue, a basic amino acid residue can be substituted for another basic amino acid residue, and an acidic amino acid residue can be substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. As long as the substitution does not result in the inactivation of the biological activity of the protein, a conservative substitution in which an amino acid is replaced by other amino acids belonging to the same group falls within the scope of the present invention. Therefore, the protein of the present invention may contain one or more conservative substitutions in the amino acid sequence, and these conservative substitutions are preferably generated by substitution according to Table 1. In addition, the present invention also covers proteins that also contain one or more other non-conservative substitutions, as long as the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention.

[0011] Conservative amino acid substitutions can be performed at one or more predicted non-essential amino acid residues. "Non-essential" amino acid residues are amino acid residues that can be changed (deleted, substituted or replaced) without changing the biological activity, while "essential" amino acid residues are required for biological activity. "Conservative amino acid substitutions" are substitutions in which amino acid residues are replaced by amino acid residues with similar side chains. Amino acid substitutions can be performed in the non-conserved regions of the above-mentioned Cas proteins. In general, such substitutions are not performed on conserved amino acid residues, or on amino acid residues located within conserved motifs, where such residues are required for protein activity. However, it will be appreciated by those skilled in the art that functional variants may have fewer conservative or non-conservative changes in conserved regions.

[0012] Table 1

[0013]

[0014]

[0015] It is well known in the art that one or more amino acid residues can be changed (replaced, deleted, truncated or inserted) from the N and / or C terminus of a protein while still retaining its functional activity. Therefore, proteins in which one or more amino acid residues are changed from the N and / or C terminus of a Cas protein while retaining its desired functional activity are also within the scope of the present invention. These changes may include changes introduced by modern molecular methods such as PCR, which includes PCR amplification of a protein coding sequence by means of including an amino acid coding sequence in an oligonucleotide used in PCR amplification to change or extend the protein coding sequence.

[0016] It will be appreciated that proteins can be altered in a variety of ways, including amino acid substitutions, deletions, truncations and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the above-mentioned proteins can be prepared by mutations in the DNA. Other forms of mutagenesis and / or directed evolution can also be accomplished, for example, using known mutagenesis, recombination and / or shuffling methods, in combination with related screening methods, to perform single or multiple amino acid substitutions, deletions and / or insertions.

[0017] Those skilled in the art will appreciate that these minor amino acid changes in the Cas proteins of the present invention can occur (e.g., naturally occurring mutations) or be produced (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domain of the protein, the properties of the polypeptide may be changed, but the polypeptide may retain its activity. If the mutations present are not close to the catalytic domain, active site, or other functional domain, lesser effects may be expected.

[0018] Those skilled in the art can identify the essential amino acids of the Cas protein of the present invention according to methods known in the art, such as site-directed mutagenesis or protein evolution or analysis of a bioinformatics system. The catalytic domain, active site or other functional domain of the protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, combined with mutations of amino acids at putative key sites.

[0019] In one embodiment, the Cas protein contains an amino acid sequence shown in any one of SEQ ID No.1-11.

[0020] In one embodiment, the Cas protein is an amino acid sequence shown in any one of SEQ ID No.1-11.

[0021] In one embodiment, the Cas protein is a derivatized protein having the same biological function as a protein having a sequence shown in any one of SEQ ID No. 1-11.

[0022] The biological functions include, but are not limited to, the activity of binding to the guide RNA, the endonuclease activity, the activity of binding to and cutting a specific site of the target sequence under the guidance of the guide RNA, including but not limited to Cis cutting activity and Trans cutting activity.

[0023] The present invention also provides a fusion protein, which includes the Cas protein as described above and other modified parts.

[0024] In one embodiment, the modifying moiety is selected from another protein or polypeptide, a detectable label, or any combination thereof.

[0025] In one embodiment, the modified portion is selected from an epitope tag, a reporter gene sequence, a nuclear localization signal (NLS) sequence, a targeting portion, a transcriptional activation domain (e.g., VP64), a transcriptional repression domain (e.g., a KRAB domain or a SID domain), a nuclease domain (e.g., Fok1), and a domain having an activity selected from the following: nucleotide deaminase, methylase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity and nucleic acid binding activity; and any combination thereof. The NLS sequence is well known to those skilled in the art, and examples thereof include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc and TUS protein.

[0026] In one embodiment, the NLS sequence is located at, near or close to a terminus (e.g., the N-terminus, the C-terminus, or both) of the Cas protein of the invention.

[0027] The epitope tag is well known to those skilled in the art, including but not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art can select other suitable epitope tags (e.g., purification, detection or tracing).

[0028] The reporter gene sequence is well known to those skilled in the art, and examples thereof include but are not limited to GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0029] In one embodiment, the fusion protein of the present invention comprises a domain capable of binding to a DNA molecule or an intracellular molecule, such as maltose binding protein (MBP), the DNA binding domain (DBD) of Lex A, the DBD of GAL4, and the like.

[0030] In one embodiment, the fusion protein of the invention comprises a detectable label, such as a fluorescent dye, such as FITC or DAPI.

[0031] In one embodiment, the Cas protein of the present invention is optionally coupled, conjugated or fused to the modification portion via a linker.

[0032] In one embodiment, the modification portion is directly linked to the N-terminus or C-terminus of the Cas protein of the present invention.

[0033] In one embodiment, the modified portion is connected to the N-terminus or C-terminus of the Cas protein of the present invention via a linker. Such linkers are well known in the art, and examples thereof include but are not limited to linkers comprising one or more (e.g., 1, 2, 3, 4 or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β-Ala, GABA or Ava), or PEG, etc.

[0034] The Cas protein, protein derivative or fusion protein of the present invention is not limited by the way it is produced. For example, it can be produced by genetic engineering methods (recombinant technology) or by chemical synthesis methods.

[0035] Cas protein nucleic acid

[0036] In another aspect, the present invention provides an isolated polynucleotide comprising:

[0037] (a) a polynucleotide sequence encoding the Cas protein or fusion protein of the present invention;

[0038] (b) a polynucleotide whose sequence is shown in any one of SEQ ID No. 12-33;

[0039] (c) a sequence having one or more base substitutions, deletions or additions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 base substitutions, deletions or additions) compared to the sequence shown in any one of SEQ ID No. 12-33;

[0040] (d) a polynucleotide having a nucleotide sequence homology ≥80% (preferably ≥90%, more preferably ≥95%, and most preferably ≥98%) to any one of SEQ ID Nos. 12-33, and encoding a polypeptide as shown in any one of SEQ ID Nos. 1-11; or,

[0041] (e) A polynucleotide complementary to the polynucleotide described in any one of (a) to (d).

[0042] In one embodiment, the nucleotide sequence described in any one of (a)-(e) is codon optimized for expression in prokaryotes. In one embodiment, the nucleotide sequence described in any one of (a)-(e) is codon optimized for expression in eukaryotic cells.

[0043] In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

[0044] Direct Repeat Sequence

[0045] On the other hand, the present invention provides an engineered direct repeat sequence that forms a complex with the above-mentioned Cas protein.

[0046] The direct repeat sequence is connected to a guide sequence that can hybridize with the target sequence to form a guide RNA (guideRNA or gRNA).

[0047] The hybridization of the target sequence with the gRNA represents at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity between the nucleic acid sequences of the target sequence and the gRNA, so that they can hybridize to form a complex; or represents that at least 12, 15, 16, 17, 18, 19, 20, 21, 22, or more bases of the nucleic acid sequences of the target sequence and the gRNA can complementarily pair to form a complex.

[0048] In some embodiments, the direct repeat sequence has at least 90% sequence identity with any one of SEQ ID No.34-45. In some embodiments, the direct repeat sequence has a sequence having one or more base substitutions, deletions or additions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 base substitutions, deletions or additions) compared to any one of SEQ ID No.34-45.

[0049] In some embodiments, the direct repeat sequence is shown in any one of SEQ ID No.34-45.

[0050] Guide RNA (gRNA)

[0051] On the other hand, the present invention provides a gRNA, which includes a first segment and a second segment; the first segment is also called a "skeleton region", "protein binding segment", "protein binding sequence", or "Direct Repeat sequence"; the second segment is also called a "targeting sequence for targeting nucleic acid" or "targeting segment for targeting nucleic acid", or "guide sequence for targeting target sequence".

[0052] The first segment of the gRNA is capable of interacting with the Cas protein of the present invention, thereby forming a complex between the Cas protein and the gRNA.

[0053] In a preferred embodiment, the first segment is a direct repeat sequence as described above.

[0054] The targeting sequence of the targeting nucleic acid of the present invention or the targeting section of the targeting nucleic acid comprises a nucleotide sequence complementary to the sequence in the target nucleic acid. In other words, the targeting sequence of the targeting nucleic acid of the present invention or the targeting section of the targeting nucleic acid interacts with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the targeting sequence of the targeting nucleic acid or the targeting section of the targeting nucleic acid can be changed, or can be modified to hybridize any desired sequence in the target nucleic acid. The nucleic acid is selected from DNA or RNA.

[0055] The percent complementarity between the targeting sequence of a targeting nucleic acid or the targeting segment of a targeting nucleic acid and the target sequence of a target nucleic acid can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).

[0056] The "skeleton region", "protein binding segment", "protein binding sequence", or "direct repeat sequence" of the gRNA of the present invention can interact with the CRISPR protein (or, Cas protein). The gRNA of the present invention guides the interacting Cas protein to a specific nucleotide sequence in the target nucleic acid through the action of the targeting sequence of the targeting nucleic acid.

[0057] Preferably, the guide RNA comprises a first segment and a second segment from 5' to 3' direction.

[0058] In the present invention, the second segment can also be understood as a guide sequence that hybridizes with the target sequence.

[0059] The gRNA of the present invention can form a complex with the Cas protein.

[0060] The gRNA of the Cas-sf0135 protein, Cas-sf3539 protein and Cas-sf8808 protein of the present invention comprises a guide sequence that hybridizes with a target nucleic acid, wherein the target nucleic acid includes a sequence located at the 3' end of a protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-TTN-3', wherein N=A / T / C / G.

[0061] The gRNA of the Cas-sf6844 protein of the present invention comprises a guide sequence hybridizing with a target nucleic acid, wherein the target nucleic acid comprises a sequence located at the 3' end of a protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-ATG-3'.

[0062] The gRNA of the Cas-sf3391 protein of the present invention comprises a guide sequence that hybridizes with a target nucleic acid, wherein the target nucleic acid includes a sequence located at the 3' end of a protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-RHYN-3', wherein R=A / G; H=A / C / T; Y=C / T; N=A / T / C / G.

[0063] Carrier

[0064] The present invention also provides a vector, which comprises the Cas protein, isolated nucleic acid molecule or polynucleotide as described above; preferably, it also includes a regulatory element operably linked thereto.

[0065] In one embodiment, the regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

[0066] In one embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, and an integration vector.

[0067] In some embodiments, the vector included in the system is a viral vector (e.g., a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated vector, and a herpes simplex vector), and can also be a plasmid, a virus, a cosmid, a phage, etc., which are well known to those skilled in the art.

[0068] CRISPR system

[0069] The present invention provides an engineered non-naturally occurring vector system, or a CRISPR-Cas system, which includes a Cas protein or a nucleic acid sequence encoding the Cas protein and a nucleic acid encoding one or more guide RNAs.

[0070] In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding one or more guide RNAs are artificially synthesized.

[0071] In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding one or more guide RNAs do not naturally co-exist.

[0072] The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize with the genomic loci of the DNA molecule encoding the one or more gene products, and guide the Cas protein to the genomic loci of the DNA molecule encoding the one or more gene products. After the Cas protein reaches the target sequence position, it modifies, edits or cuts the target sequence, thereby changing or modifying the expression of the one or more gene products.

[0073] The cells of the present invention include one or more of animals, plants or microorganisms.

[0074] In some embodiments, the Cas protein is codon optimized for expression in a cell.

[0075] In some embodiments, the Cas protein cleaves one or both strands at the location of the target sequence.

[0076] In some embodiments, the Cas protein cuts the complementary and / or non-complementary strands of the target nucleic acid under the mediation of gRNA.

[0077] Preferably, the Cas protein simultaneously cuts the complementary and non-complementary strands of the target nucleic acid.

[0078] In the present invention, the gRNA guides the Cas protein to recognize and bind to the complementary strand, and the non-complementary strand is a nucleic acid strand paired with the complementary strand. The PAM sequence is located on the non-complementary strand, and the complementary strand contains a PAM complementary sequence paired with the above-mentioned PAM sequence.

[0079] In one embodiment, the cleavage site of Cas-sf6844 on the complementary strand of the target sequence is between the 10th nt and the 11th nt at the 5' end of the PAM complementary sequence, and the gRNA guides the Cas-sf6844 protein to recognize and bind to the complementary strand.

[0080] In one embodiment, the cleavage site of Cas-sf3539 on the non-complementary chain of the target sequence is between the 14th nt and the 15th nt at the 3' end of the PAM sequence, and the gRNA guides the Cas-sf3539 protein to recognize and bind to the above-mentioned complementary chain, and the above-mentioned non-complementary chain is a DNA chain paired with the complementary chain.

[0081] In one embodiment, the cleavage site of Cas-sf8808 on the complementary chain of the target sequence is between the 22nt and 24nt at the 5' end of the PAM complementary sequence, and the cleavage site of Cas-sf8808 on the non-complementary chain of the target sequence is between the 18nt and 19nt at the 3' end of the PAM sequence. The gRNA guides the Cas-sf8808 protein to recognize and bind to the above-mentioned complementary chain, and the above-mentioned non-complementary chain is a DNA chain paired with the complementary chain.

[0082] In one embodiment, the cleavage site of Cas-sf3391 on the complementary chain of the target sequence is between the 20th nt and the 23rd nt at the 5' end of the PAM complementary sequence, and the cleavage site of Cas-sf3391 on the non-complementary chain of the target sequence is between the 15th nt and the 16th nt or between the 18th and the 19th nt at the 3' end of the PAM sequence. The gRNA guides the Cas-sf3391 protein to recognize and bind to the above-mentioned complementary chain, and the above-mentioned non-complementary chain is a DNA chain paired with the complementary chain.

[0083] The present invention also provides an engineered non-naturally occurring vector system, which may include one or more vectors, wherein the one or more vectors include:

[0084] a) a first regulatory element, which is operably linked to the gRNA,

[0085] b) a second regulatory element, which is operably linked to the Cas protein;

[0086] Components (a) and (b) are located on the same or different carriers of the system.

[0087] The first and second regulatory elements include a promoter (e.g., a constitutive promoter or an inducible promoter), an enhancer (e.g., a 35S promoter or a 35S enhanced promoter), an internal ribosome entry site (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences).

[0088] In some embodiments, the vector in the system is a viral vector (e.g., a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated vector, and a herpes simplex vector), and can also be a plasmid, a virus, a cosmid, a phage, etc., which are well known to those skilled in the art.

[0089] In some embodiments, the systems provided herein are in a delivery system. In some embodiments, the delivery system is a nanoparticle, a liposome, an exosome, a microbubble, and a gene gun.

[0090] In one embodiment, the target sequence is a DNA or RNA sequence from a prokaryotic cell or a eukaryotic cell. In one embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.

[0091] In one embodiment, the target sequence is present in a cell. In one embodiment, the target sequence is present in the nucleus or in the cytoplasm (e.g., an organelle). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.

[0092] In one embodiment, the Cas protein is connected to one or more NLS sequences. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is connected to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.

[0093] On the other hand, the present invention relates to an engineered CRISPR system, which comprises the above-mentioned Cas protein and one or more guide RNAs, wherein the guide RNA includes a direct repeat sequence and a spacer sequence capable of hybridizing with a target nucleic acid, and the Cas protein can bind to the guide RNA and target a target nucleic acid sequence complementary to the spacer sequence.

[0094] In one embodiment, the Cas enzyme is Cas-sf0135 protein or Cas-sf3539 protein or Cas-sf8808 protein, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of the protospacer adjacent motif (PAM), and the PAM has a sequence shown as 5'-TTN-3', wherein N=A / T / C / G.

[0095] In one embodiment, the Cas enzyme is Cas-sf6844 protein, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of the protospacer adjacent motif (PAM), and the PAM has a sequence shown as 5'-ATG-3'.

[0096] In one embodiment, the Cas enzyme is Cas-sf3391 protein, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of the protospacer adjacent motif (PAM), and the PAM has a sequence shown in 5'-RHYN-3', wherein R=A / G; H=A / C / T; Y=C / T; N=A / T / C / G.

[0097] Protein-nucleic acid complexes / compositions

[0098] In another aspect, the present invention provides a compound or composition comprising:

[0099] (i) a protein component selected from: the above-mentioned Cas protein, derivatized protein or fusion protein, and any combination thereof; and

[0100] (ii) a nucleic acid component comprising (a) a guide sequence capable of hybridizing to a target sequence; and (b) a direct repeat sequence capable of binding to a Cas protein of the present invention.

[0101] The protein component and the nucleic acid component are combined with each other to form a complex.

[0102] In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.

[0103] In one embodiment, the complex or composition is non-naturally occurring or modified. In one embodiment, at least one component of the complex or composition is non-naturally occurring or modified. In one embodiment, the first component is non-naturally occurring or modified; and / or, the second component is non-naturally occurring or modified.

[0104] Activated CRISPR complex

[0105] On the other hand, the present invention also provides an activated CRISPR complex, the activated CRISPR complex comprising: (1) a protein component selected from: a Cas protein, a derivatized protein or a fusion protein of the present invention, and any combination thereof; (2) a gRNA comprising (a) a guide sequence capable of hybridizing with a target sequence; and (b) a direct repeat sequence capable of binding to the Cas protein of the present invention; and (3) a target sequence bound to the gRNA. Preferably, the binding is carried out by binding the targeting sequence of the targeting nucleic acid on the gRNA to the target nucleic acid.

[0106] The terms "activated CRISPR complex", "activated complex" or "ternary complex" used in this article refer to the complex after the Cas protein, gRNA and target nucleic acid in the CRISPR system are bound or modified.

[0107] The Cas protein and gRNA of the present invention can form a binary complex, which is activated when bound to a nucleic acid substrate to form an activated CRISPR complex. The nucleic acid substrate is complementary to the spacer sequence in the gRNA (or referred to as a guide sequence hybridized with the target nucleic acid). In some embodiments, the spacer sequence of the gRNA completely matches the target substrate. In other embodiments, the spacer sequence of the gRNA matches a portion (continuous or discontinuous) of the target substrate.

[0108] In a preferred embodiment, the activated CRISPR complex can exhibit side branch nuclease cleavage activity, which refers to the non-specific cleavage activity or random cleavage activity of the activated CRISPR complex on single-stranded nucleic acids, also known as trans cleavage activity in the art.

[0109] Delivery and delivery compositions

[0110] The Cas protein, gRNA, fusion protein, nucleic acid molecule, vector, system, complex and composition of the present invention can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipofection, nuclear transfection, microinjection, sonoporation, gene gun, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendritic transfection, heat shock transfection, nuclear transfection, magnetofection, lipofection, puncture transfection, optical transfection, agent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial virions, etc.

[0111] Therefore, in another aspect, the present invention provides a delivery composition comprising a delivery vector and one or more selected from the following: the Cas protein, fusion protein, nucleic acid molecule, vector, system, complex and composition of the present invention.

[0112] In one embodiment, the delivery vehicle is a particle.

[0113] In one embodiment, the delivery vehicle is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene guns or viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses or adeno-associated viruses).

[0114] Host cells

[0115] The present invention also relates to an in vitro, ex vivo or in vivo cell or cell line or their progeny, which comprises: the Cas protein, fusion protein, nucleic acid molecule, protein-nucleic acid complex, activated CRISPR complex, vector, and delivery composition of the present invention.

[0116] In certain embodiments, the cell is a prokaryotic cell.

[0117] In certain embodiments, the cell is a eukaryotic cell. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a non-human mammalian cell, such as a cell of a non-human primate, a cow, a sheep, a pig, a dog, a monkey, a rabbit, a rodent (such as a rat or a mouse). In certain embodiments, the cell is a non-mammalian eukaryotic cell, such as a cell of a poultry bird (such as a chicken), a fish or a crustacean (such as a clam, a shrimp). In certain embodiments, the cell is a plant cell, such as a cell or a cultivated plant or a food crop such as cassava, corn, sorghum, soybean, wheat, oat or rice, such as algae, a tree or a production plant, a fruit or a vegetable (for example, a tree such as a citrus tree, a nut tree; Solanum, cotton, tobacco, tomato, grape, coffee, cocoa, etc.).

[0118] In certain embodiments, the cell is a stem cell or a stem cell line.

[0119] In certain cases, the host cells of the invention contain genetic or genomic modifications that are not present in their wild type.

[0120] Gene Editing Methods and Applications

[0121] The Cas protein, nucleic acid, composition, CIRSPR / Cas system, vector system, delivery composition, activated CRISPR complex or host cell of the present invention can be used for any one or more of the following purposes: targeting and / or editing target nucleic acid; cutting double-stranded DNA, single-stranded DNA or single-stranded RNA; non-specific cutting and / or degradation of side branch nucleic acid; non-specific cutting of single-stranded nucleic acid; nucleic acid detection; detection of nucleic acid in target sample; specific editing of double-stranded nucleic acid; base editing of double-stranded nucleic acid; base editing of single-stranded nucleic acid. In other embodiments, it can also be used to prepare reagents or kits for any one or more of the above purposes.

[0122] The present invention also provides the use of the above-mentioned Cas protein, nucleic acid, composition, CIRSPR / Cas system, vector system, delivery composition or activated CRISPR complex in gene editing, gene targeting or gene cutting; or, use in the preparation of reagents or kits for gene editing, gene targeting or gene cutting.

[0123] In one embodiment, the gene editing, gene targeting or gene cleavage is performed inside and / or outside the cell.

[0124] The present invention also provides a method for editing a target nucleic acid, targeting a target nucleic acid, or cutting a target nucleic acid, the method comprising contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition, or the above-mentioned activated CRISPR complex. In one embodiment, the method is to edit the target nucleic acid, target the target nucleic acid, or cut the target nucleic acid in a cell or outside the cell.

[0125] The gene editing or editing of target nucleic acid includes modifying genes, knocking out genes, changing the expression of gene products, repairing mutations, and / or inserting polynucleotides, gene mutations.

[0126] The editing can be performed in prokaryotic cells and / or eukaryotic cells.

[0127] On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex in nucleic acid detection, or in the preparation of a reagent or kit for nucleic acid detection.

[0128] On the other hand, the present invention also provides a method for cutting single-stranded nucleic acids, the method comprising contacting a nucleic acid population with the above-mentioned Cas protein and gRNA, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, and the Cas protein cuts the plurality of non-target single-stranded nucleic acids.

[0129] The gRNA is capable of binding to the Cas protein.

[0130] The gRNA is capable of targeting the target nucleic acid.

[0131] The contacting can be inside a cell in vitro, ex vivo or in vivo.

[0132] Preferably, the cleavage of the single-stranded nucleic acid is non-specific cleavage.

[0133] On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, composition, CIRSPR / Cas system, vector system, delivery composition or activated CRISPR complex in non-specific cleavage of single-stranded nucleic acid, or in the preparation of a reagent or kit for non-specific cleavage of single-stranded nucleic acid.

[0134] On the other hand, the present invention also provides a kit for gene editing, gene targeting or gene cutting, which comprises the above-mentioned Cas protein, gRNA, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition, the above-mentioned activated CRISPR complex or the above-mentioned host cell.

[0135] On the other hand, the present invention also provides a kit for detecting a target nucleic acid in a sample, the kit comprising: (a) a Cas protein, or a nucleic acid encoding the Cas protein; (b) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA comprising the guide RNA, or a nucleic acid encoding the precursor RNA; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize with the guide RNA.

[0136] It is known in the art that the precursor RNA can be cleaved or processed into the mature guide RNA described above.

[0137] On the other hand, the invention provides the use of the above-mentioned Cas protein, nucleic acid, composition, CIRSPR / Cas system, vector system, delivery composition, activated CRISPR complex or host cell in the preparation of a preparation or a kit, wherein the preparation or kit is used for:

[0138] (i) gene or genome editing;

[0139] (ii) target nucleic acid detection and / or diagnosis;

[0140] (iii) editing a target sequence in a target locus to modify an organism or non-human organism;

[0141] (iv) treatment of disease;

[0142] (iv) Targeting target genes.

[0143] Preferably, the above-mentioned gene or genome editing is performed inside or outside the cell.

[0144] Preferably, the target nucleic acid detection and / or diagnosis is performed in vitro.

[0145] Preferably, the treatment of the disease is the treatment of a condition caused by a defect in the target sequence in the target locus.

[0146] In another aspect, the present invention provides a method for detecting a target nucleic acid in a sample, the method comprising contacting the sample with the Cas protein, gRNA (guide RNA) and a single-stranded nucleic acid detector, the gRNA comprising a region binding to the Cas protein and a guide sequence hybridizing with the target nucleic acid; detecting a detectable signal generated by the Cas protein cutting the single-stranded nucleic acid detector, thereby detecting the target nucleic acid; the single-stranded nucleic acid detector does not hybridize with the gRNA.

[0147] Method for specifically modifying target nucleic acid

[0148] On the other hand, the present invention also provides a method for specifically modifying a target nucleic acid, the method comprising: contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex.

[0149] The specific modification can occur in vivo or in vitro.

[0150] The specific modification can occur inside or outside the cell.

[0151] In some cases, the cell is selected from a prokaryotic cell or a eukaryotic cell, for example, an animal cell, a plant cell, or a microbial cell.

[0152] In one embodiment, the modification refers to a break in the target sequence, such as a single-strand / double-strand break in DNA, or a single-strand break in RNA.

[0153] In some cases, the method further comprises contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target nucleic acid.

[0154] In one embodiment, the modification further comprises inserting an editing template (eg, an exogenous nucleic acid) into the break.

[0155] In one embodiment, the method further comprises: contacting the editing template with the target nucleic acid, or delivering it to a cell comprising the target nucleic acid. In this embodiment, the method repairs the broken target gene by homologous recombination with an exogenous template polynucleotide; in some embodiments, the repair results in a mutation, including insertion, deletion, or substitution of one or more nucleotides of the target gene, and in other embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.

[0156] Detection (non-specific cleavage)

[0157] On the other hand, the present invention provides a method for detecting a target nucleic acid in a sample, the method comprising contacting the sample with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cutting the single-stranded nucleic acid detector, thereby detecting the target nucleic acid.

[0158] In the present invention, the target nucleic acid includes ribonucleotides or deoxyribonucleotides; including single-stranded nucleic acids and double-stranded nucleic acids, such as single-stranded DNA, double-stranded DNA, single-stranded RNA, and double-stranded RNA.

[0159] In one embodiment, the target nucleic acid is derived from samples such as viruses, bacteria, microorganisms, soil, water, human body, animals, plants, etc. Preferably, the target nucleic acid is a product enriched or amplified by methods such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM, etc.

[0160] In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or a SNP site or a nucleic acid that differs from a control; preferably, the virus is a plant virus or an animal virus, for example, a papillomavirus, a hepadnavirus, a herpes virus, an adenovirus, a poxvirus, a parvovirus, a coronavirus; preferably, the virus is a coronavirus, preferably, SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-Cov.

[0161] In the present invention, the gRNA has at least 50% matching degree with the target sequence on the target nucleic acid, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%.

[0162] In one embodiment, when the target sequence contains one or more characteristic sites (such as a specific mutation site or SNP), the characteristic sites are completely matched with the gRNA.

[0163] In one embodiment, the detection method may include one or more gRNAs with different guide sequences, which target different target sequences.

[0164] In the present invention, the single-stranded nucleic acid detector includes but is not limited to single-stranded DNA, single-stranded RNA, DNA-RNA hybrids, nucleic acid analogs, base modifiers, and single-stranded nucleic acid detectors containing a base-free spacer, etc.; "nucleic acid analogs" include but are not limited to: locked nucleic acids, bridge nucleic acids, morpholino nucleic acids, ethylene glycol nucleic acids, hexitol nucleic acids, threose nucleic acids, arabinose nucleic acids, 2'oxymethyl RNA, 2'methoxyacetyl RNA, 2'fluoro RNA, 2'amino RNA, 4'thio RNA and combinations thereof, including optional ribonucleotides or deoxyribonucleotide residues.

[0165] In the present invention, the detectable signal is realized by the following means: vision-based detection, sensor-based detection, color detection, fluorescence signal-based detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition / dispersion, electrochemical detection and semiconductor-based detection.

[0166] In the present invention, preferably, a fluorescent group and a quenching group are respectively arranged at both ends of the single-stranded nucleic acid detector, and a detectable fluorescent signal can be exhibited when the single-stranded nucleic acid detector is cut. The fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; the quenching group is selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0167] In other embodiments, different labeling molecules are respectively set at the 5' end and the 3' end of the single-stranded nucleic acid detector, and the colloidal gold test results of the single-stranded nucleic acid detector before and after being cut by the Cas protein are detected by colloidal gold detection; the single-stranded nucleic acid detector will show different color development results on the colloidal gold detection line and the quality control line before and after being cut by the Cas protein.

[0168] In some embodiments, the method of detecting a target nucleic acid may further include comparing the level of the detectable signal to a reference signal level, and determining the amount of the target nucleic acid in the sample based on the level of the detectable signal.

[0169] In some embodiments, the method of detecting a target nucleic acid can also include using an RNA reporter nucleic acid and a DNA reporter nucleic acid (e.g., fluorescent color) on different channels, and determining the level of the detectable signal by measuring the signal levels of the RNA and DNA reporter molecules, and by measuring the amount of the target nucleic acid in the RNA and DNA reporter molecules, and sampling based on the combined (e.g., using a minimum or product) level of the detectable signal.

[0170] In one embodiment, the target gene is present in a cell.

[0171] In one embodiment, the cell is a prokaryotic cell.

[0172] In one embodiment, the cell is a eukaryotic cell.

[0173] In one embodiment, the cell is an animal cell.

[0174] In one embodiment, the cell is a human cell.

[0175] In one embodiment, the cell is a plant cell, such as a cell of a cultivated plant (such as cassava, corn, sorghum, wheat, or rice), algae, tree, or vegetable.

[0176] In one embodiment, the target gene is present in a nucleic acid molecule (eg, a plasmid) in vitro.

[0177] In one embodiment, the target gene is present in a plasmid.

[0178] Definition of terms

[0179] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics and recombinant DNA procedures used herein are conventional procedures widely used in the corresponding fields. At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0180] Cas proteins

[0181] In the present invention, Cas protein, Cas enzyme, and Cas effector protein can be used interchangeably; the inventors have discovered and identified for the first time a Cas effector protein having an amino acid sequence selected from the following:

[0182] (i) any one of SEQ ID No. 1-11;

[0183] (ii) a sequence having one or more amino acid substitutions, deletions or additions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions or additions) compared to the sequence shown in any one of SEQ ID No. 1-11; or

[0184] (iii) a sequence having at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID Nos. 1-11.

[0185] Nucleic acid cleavage or nucleic acid cleavage herein includes: DNA or RNA breakage (Cis cleavage) in the target nucleic acid produced by the Cas enzyme described herein, DNA or RNA breakage in the side branch nucleic acid substrate (single-stranded nucleic acid substrate) (i.e., non-specific or non-targeted, Trans cleavage). In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA break or a single-stranded RNA break.

[0186] CRISPR system

[0187] As used herein, the terms "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system" or "CRISPR system" are used interchangeably and have the meaning generally understood by those skilled in the art, which generally includes transcription products or other elements related to the expression of CRISPR-associated ("Cas") genes, or transcription products or other elements capable of directing the activity of the Cas genes.

[0188] CRISPR / Cas complex

[0189] As used herein, the term "CRISPR / Cas complex" refers to a complex formed by the binding of a guide RNA or mature crRNA to a Cas protein, which comprises a direct repeat sequence that hybridizes to a guide sequence of a target sequence and binds to a Cas protein, and the complex is capable of recognizing and cleaving a polynucleotide that can hybridize to the guide RNA or mature crRNA.

[0190] Guide RNA (gRNA)

[0191] As used herein, the terms "guide RNA (gRNA)", "mature crRNA", "guide sequence" are used interchangeably and have meanings generally understood by those skilled in the art. In general, the guide RNA may comprise a direct repeat sequence and a guide sequence, or may consist essentially of or consist of a direct repeat sequence and a guide sequence.

[0192] In some cases, the guide sequence is any polynucleotide sequence that has sufficient complementarity with the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, when optimally aligned, the degree of complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining the optimal alignment is within the capabilities of ordinary technicians in this field. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman algorithm in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0193] Target sequence

[0194] "Target sequence" refers to a polynucleotide targeted by a guide sequence in a gRNA, such as a sequence having complementarity with the guide sequence, wherein hybridization between the target sequence and the guide sequence will promote the formation of a CRISPR / Cas complex (including Cas protein and gRNA). Complete complementarity is not required, as long as there is sufficient complementarity to cause hybridization and promote the formation of a CRISPR / Cas complex.

[0195] The target sequence can comprise any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located inside or outside the cell. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondria or chloroplast. A sequence or template that can be used to recombine into a target locus comprising the target sequence is referred to as an "editing template" or "editing polynucleotide" or "editing sequence". In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, the recombination is homologous recombination.

[0196] In the present invention, "target sequence" or "target polynucleotide" or "target nucleic acid" can be any endogenous or exogenous polynucleotide to a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or junk DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM).

[0197] Single-stranded nucleic acid detector

[0198] The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2-200 nucleotides, preferably 2-150 nucleotides, preferably 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides, preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

[0199] The single-stranded nucleic acid detector includes different reporting groups or labeling molecules at both ends. When it is in the initial state (i.e., uncleaved state), it does not present a reporting signal. When the single-stranded nucleic acid detector is cut, it presents a detectable signal, i.e., there is a detectable difference between after cutting and before cutting.

[0200] In one embodiment, the reporter group or labeling molecule includes a fluorescent group and a quencher group, the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; the quencher group is selected from one or any several of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0201] In one embodiment, the single-stranded nucleic acid detector has a first molecule (such as FAM or FITC) connected to the 5' end and a second molecule (such as biotin) connected to the 3' end. The reaction system containing the single-stranded nucleic acid detector is used to detect the target nucleic acid in conjunction with the flow strip (preferably, colloidal gold detection method). The flow strip is designed to have two capture lines, with an antibody that binds to the first molecule (i.e., the first molecule antibody) at the sample contact end (colloidal gold), an antibody that binds to the first molecule antibody at the first line (control line), and an antibody that binds to the second molecule (i.e., the second molecule antibody, such as avidin) at the second line (test line). When the reaction flows along the strip, the first molecule antibody binds to the first molecule and carries the cut or uncut oligonucleotide to the capture line, and the cut reporter will bind to the antibody of the first molecule antibody at the first capture line, and the uncut reporter will bind to the second molecule antibody at the second capture line. The binding of the reporter group to each line will result in a strong readout / signal (e.g., color). As more reporters are cut, more signals will accumulate at the first capture line, and less signals will appear at the second line. In some aspects, the present invention relates to the use of a flow strip as described herein for detecting nucleic acids. In some aspects, the present invention relates to a method for detecting nucleic acids using a flow strip as defined herein, such as a (lateral) flow test or a (lateral) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector can be replaced with each other, or the position of the molecules can be changed, as long as the reporting principle is the same or similar to the present invention, the improved method is also included in the present invention.

[0202] The detection method of the present invention can be used for quantitative detection of target nucleic acid to be detected. The quantitative detection index can be quantified according to the signal strength of the reporter group, such as according to the luminescence intensity of the fluorescent group, or according to the width of the color band.

[0203] wild type

[0204] As used herein, the term "wild type" has the meaning generally understood by those skilled in the art, which refers to the typical form of an organism, strain, gene, or the characteristics that distinguish it from mutant or variant forms when it exists in nature, which can be isolated from a source in nature and has not been intentionally modified by man.

[0205] Derivatization

[0206] As used herein, the term "derivatization" refers to a chemical modification of an amino acid, polypeptide or protein wherein one or more substituents have been covalently attached to the amino acid, polypeptide or protein. The substituents may also be referred to as side chains.

[0207] A derivatized protein is a derivative of the protein. Generally, derivatization of the protein does not adversely affect the desired activity of the protein (e.g., the activity of binding to the guide RNA, the endonuclease activity, the activity of binding to and cutting a specific site of the target sequence under the guidance of the guide RNA), that is, the derivative of the protein has the same activity as the protein.

[0208] Derivatized Protein

[0209] Also known as "protein derivatives", refers to modified forms of proteins, for example, wherein one or more amino acids of the protein may be deleted, inserted, modified and / or substituted.

[0210] Non-natural

[0211] As used herein, the terms "non-naturally occurring" or "engineered" are used interchangeably and indicate the involvement of human effort. When these terms are used to describe a nucleic acid molecule or polypeptide, it means that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which it is associated in nature or as found in nature.

[0212] Orthologue (ortholog)

[0213] As used herein, the term "orthologue" has the meaning commonly understood by those skilled in the art. As a further guide, an "orthologue" of a protein as described herein refers to a protein belonging to a different species that performs the same or similar function as its orthologue.

[0214] Identity

[0215] As used herein, the term "identity" is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a position in both sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 out of 10 positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 out of a total of 6 positions match). Typically, the comparison is made when the two sequences are aligned to produce maximum identity. Such an alignment can be achieved by using, for example, the method of Needleman et al. (1970) J. Mol. Biol. 48: 443-453, which can be conveniently performed by a computer program such as the Align program (DNAstar, Inc.). The percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4: 11-17 (1988)), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J Mol. Biol. 48: 444-453 (1970)) algorithm, which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using a Blossum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0216] Carrier

[0217] The term "vector" refers to a nucleic acid molecule that is capable of transporting another nucleic acid molecule to which it is attached. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules including one or more free ends, no free ends (e.g., circular); nucleic acid molecules including DNA, RNA, or both; and other various polynucleotides known in the art. The vector can be introduced into a host cell by transformation, transduction, or transfection so that the genetic material elements it carries are expressed in the host cell. A vector can be introduced into a host cell to produce transcripts, proteins, or peptides, including proteins, fusion proteins, isolated nucleic acid molecules, etc. as described herein (e.g., CRISPR transcripts, such as nucleic acid transcripts, proteins, or enzymes). A vector can contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription start sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain a replication initiation site.

[0218] One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.

[0219] Another type of vector is a viral vector, wherein a virally derived DNA or RNA sequence is present in a vector for packaging a virus (e.g., a retrovirus, a replication-defective retrovirus, an adenovirus, a replication-defective adenovirus, and an adeno-associated virus). The viral vector also comprises a polynucleotide carried by a virus for transfection into a host cell. Some vectors (e.g., bacterial vectors and episomal mammalian vectors with a bacterial origin of replication) can replicate autonomously in the host cell into which they are introduced.

[0220] Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell after introduction into the host cell, and are replicated together with the host genome. Moreover, some vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to as "expression vectors" herein.

[0221] Host cells

[0222] As used herein, the term "host cell" refers to cells that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, eukaryotic cells such as microbial cells, fungal cells, animal cells and plant cells.

[0223] Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of the host cell to be transformed, the level of expression desired, and the like.

[0224] Regulatory elements

[0225] As used herein, the term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), which are described in detail in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, California (1990). In some cases, regulatory elements include those sequences that direct the constitutive expression of a nucleotide sequence in many types of host cells and those sequences that direct the nucleotide sequence to be expressed only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in desired tissues of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or special cell types (e.g., lymphocytes). In some cases, the regulatory element can also direct expression in a timing-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; CMV enhancer; R-U5' fragment in the LTR of HTLV-I ((Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and intron sequences between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0226] Promoter

[0227] As used herein, the term "promoter" has a meaning well known to those skilled in the art, and refers to a non-coding nucleotide sequence located upstream of a gene that can initiate expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of a gene product in a cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell essentially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of a gene product in the cell essentially only when the cell is a cell of the tissue type corresponding to the promoter.

[0228] NLS

[0229] A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for import into the nucleus by nuclear transport, i.e., a protein with an NLS is transported to the nucleus. Typically, an NLS comprises a positively charged Lys or Arg residue exposed on the surface of the protein. Exemplary nuclear localization sequences include, but are not limited to, NLSs from: SV40 large T antigen, EGL-13, c-Myc, and TUS proteins. In some embodiments, the NLS comprises a PKKKRKV sequence. In some embodiments, the NLS comprises an AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS comprises a PAAKRVKLD sequence. In some embodiments, the NLS comprises an MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS comprises a KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, the sequence KIPIK in the yeast transcription repressor Matα2, and PY-NLS.

[0230] Operatively connected

[0231] As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).

[0232] Complementarity

[0233] As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by means of traditional Watson-Crick or other non-traditional types. The percentage of complementarity represents the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Complete complementarity" means that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.

[0234] Strict conditions

[0235] As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity with a target sequence predominantly hybridizes to the target sequence and substantially does not hybridize to non-target sequences. Stringent conditions are typically sequence-dependent and vary depending on many factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence.

[0236] Hybridization

[0237] The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) comprising a nucleotide sequence that enables it to non-covalently bind, i.e., form base pairs and / or G / U base pairs, "anneal" or "hybridize" with another nucleic acid in a sequence-specific, anti-parallel manner (i.e., nucleic acids specifically bind to complementary nucleic acids).

[0238] Hybridization requires that the two nucleic acids contain complementary sequences, although there may be mismatches between the bases. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which are variables well known in the art. Typically, the length of a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

[0239] It should be understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to the target region in the target nucleic acid sequence with which it hybridizes.

[0240] The hybridization of the target sequence and the gRNA represents that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the nucleic acid sequences of the target sequence and the gRNA can hybridize to form a complex; or represents that at least 12, 15, 16, 17, 18, 19, 20, 21, 22 or more bases of the nucleic acid sequences of the target sequence and the gRNA can complementarily pair and hybridize to form a complex.

[0241] Express

[0242] As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcripts) and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides may be collectively referred to as "gene products." If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.

[0243] Connectors

[0244] As used herein, the term "joint" refers to a linear polypeptide formed by connecting multiple amino acid residues through peptide bonds. The joint of the present invention can be an artificially synthesized amino acid sequence, or a naturally occurring polypeptide sequence, such as a polypeptide having a hinge region function. Such joint polypeptides are well known in the art (see, for example, Holliger, P. et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poljak, RJ et al. (1994) Structure 2: 1121-1123).

[0245] treat

[0246] As used herein, the term "treat" refers to treating or curing a disorder, delaying the onset of symptoms of a disorder, and / or delaying the progression of a disorder.

[0247] Subjects

[0248] As used herein, the term "subject" includes, but is not limited to, various animals, plants, and microorganisms.

[0249] animal

[0250] For example, mammals, such as bovines, equines, ovines, porcines, canines, felines, lagomorphs, rodents (e.g., mice or rats), non-human primates (e.g., macaques or cynomolgus monkeys), or humans. In certain embodiments, the subject (e.g., a human) suffers from a disorder (e.g., a disorder caused by a disease-related gene defect).

[0251] plant

[0252] The term "plant" is to be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, in particular monocotyledonous or dicotyledonous plants, vegetable crops, including artichokes, Brussels sprouts, rocket, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, romaine lettuce), bok choy, yellow taro, melons (e.g., melon, watermelon, Crenshaw melon, honeydew melon, cantaloupe), rapeseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, pak choi), cardoon, carrot, napa, okra, onion, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, courgette, squash, pumpkin), radish, cabbage, cauliflower, zucchini ... onions, rutabagas, eggplant (also called eggplant), salsify, lettuce, shallots, endive, garlic, spinach, green onions, squash, greens, beets (sugar beets and fodder beets), sweet potatoes, Swiss chard, horseradish, tomatoes, turnips, and spices; fruits and / or vines such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, y), cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pomegranates, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, silver grass, corn / maize (fodder corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans) , oil plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, peanut), Arabidopsis, fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plant; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, as well as trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0253] Advantageous Effects of the Invention

[0254] The present invention discovered a new type of Cas enzyme. The Blast results showed that the Cas enzyme of the present application had low consistency with the reported Cas enzymes. It can exhibit nuclease activity in vivo and in vitro and has broad application prospects.

[0255] Embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but it will be appreciated by those skilled in the art that the following drawings and examples are only used to illustrate the present invention, rather than to limit the scope of the present invention. Various objects and advantages of the present invention will become apparent to those skilled in the art based on the following detailed description of the accompanying drawings and preferred embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0256] Figure 1 .Fluorescence results of Cas-sf0135 and Cas-sf6844 used for nucleic acid detection.

[0257] Figure 2 .PAM structure of Cas-sf0135.

[0258] Figure 3 .Sequencing results of target genes after editing by Cas-sf0135 in eukaryotic cells.

[0259] Figure 4 .PAM structure of Cas-sf6844.

[0260] Figure 5 .Sequencing results of target genes after editing by Cas-sf6844 in eukaryotic cells.

[0261] Figure 6 .The location where Cas-sf6844 cuts the target nucleic acid.

[0262] Figure 7 .The fluorescence results of Cas-sf5525 used for nucleic acid detection.

[0263] Figure 8 .Cas-sf6327 detection results for single-stranded nucleic acid.

[0264] Fig. 9 .PAM structure of Cas-sf3539.

[0265] Fig.10 .The cutting results of double-stranded nucleic acid by Cas-sf3539.

[0266] Fig.11 .The cleavage efficiency of Cas-sf3539 on complementary and non-complementary chains.

[0267] Fig.12 .The location where Cas-sf3539 cuts the target nucleic acid.

[0268] Fig.13 .Cas-sf8808 detection results for single-stranded nucleic acid.

[0269] Fig.14.The cutting results of double-stranded nucleic acid by Cas-sf8808.

[0270] Fig.15 .The location where Cas-sf8808 cuts the target nucleic acid.

[0271] Fig.16 .Sequencing results of target genes after Cas-sf8808 editing in eukaryotic cells.

[0272] Fig.17 .Cas-sf8856 detection results for single-stranded nucleic acid.

[0273] Fig.18 .PAM structure of Cas-sf3391.

[0274] Fig.19 .The cutting results of double-stranded nucleic acid by Cas-sf3391.

[0275] Fig. 20 .Sequencing results of target genes after editing by Cas-sf3391 in eukaryotic cells.

[0276] Fig.21 .The cleavage efficiency of Cas-sf3391 on complementary and non-complementary chains.

[0277] Fig. 22 .The location where Cas-sf3391 cuts the target nucleic acid.

[0278] Fig.23 .Cas-sf0153 detection results for single-stranded nucleic acid.

[0279] Fig.24 .Cas-sf4073 detection results for single-stranded nucleic acid.

[0280] Fig.25 .Cas-sf0352 detection results for single-stranded nucleic acid.

[0281] Sequence information

[0282]

[0283] DETAILED DESCRIPTION

[0284] The following examples are only used to describe the present invention, but not to limit the present invention. Unless otherwise specified, the experiment and method described in the embodiment are carried out basically according to the conventional methods well known in the art and described in various references. For example, the conventional techniques such as immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA used in the present invention can be found in Sambrook, Fritsch and Maniatis, "Molecular cloning: laboratory manual" (MOLECULAR CLONING: A LABORATORY MANUAL), 2nd edition (1989); "Contemporary molecular biology experimental manual" (CURRENT PROTOCOLS IN MOLECULAR BIOLOGY) (FM Ausubel (FM Ausubel) et al. edited, (1987)); "Enzymology" (METHODS IN ENZYMOLOGY) series (Academic Publishing Company): "PCR 2: Practical method" (PCR 2: A PRACTICAL METHOD) APPROACH) (MJ MacPherson, BD Hames, and GR Taylor, eds. (1995)), ANTIBODIES, A LABORATORY MANUAL, eds. Harlow and Lane, eds. (1988), and ANIMAL CELL CULTURE (RI Freshney, ed. (1987)).

[0285] In addition, if the specific conditions are not specified in the examples, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be obtained commercially. It is known to those skilled in the art that the embodiments describe the present invention by way of example and are not intended to limit the scope of the present invention. All public cases and other references mentioned herein are incorporated herein by reference in their entirety.

[0286] Example 1. Acquisition of Cas protein

[0287] The inventors analyzed the uncultured metagenome and identified 11 new Cas enzymes through redundancy removal and protein cluster analysis. Blast results show that the sequence consistency of Cas proteins is low with reported Cas proteins, and they are named Cas-sf0135, Cas-sf6844, Cas-sf5525, Cas-sf6327, Cas-sf3539, Cas-sf0153, Cas-sf4073, Cas-sf0352, Cas-sf8808, Cas-sf8856 and Cas-sf3391 in the present invention; the amino acid sequences, encoding nucleic acid sequences and nucleic acids after human codon optimization of the above proteins are shown in Tables 2-4 below, and the same-direction repeat sequences of gRNAs corresponding to the above different proteins are shown in Table 5.

[0288] Table 2. Amino acid sequences of different Cas proteins

[0289]

[0290]

[0291]

[0292]

[0293] Table 3. Nucleotide sequences of different Cas proteins

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300]

[0301]

[0302]

[0303]

[0304] Table 4. Humanized nucleic acid sequences of different Cas proteins

[0305]

[0306]

[0307]

[0308]

[0309]

[0310]

[0311]

[0312]

[0313]

[0314] Table 5. Direct repeat sequences of gRNA corresponding to different proteins

[0315]

[0316]

[0317] Example 2. Application of Cas-sf0135 protein in nucleic acid detection

[0318] This example verifies the trans-cleavage activity of Cas-sf0135 by in vitro testing. In this example, a gRNA that can be paired with a target nucleic acid is used to guide the Cas-sf0135 protein to recognize and bind to the target nucleic acid; then, the Cas-sf0135 protein stimulates the trans-cleavage activity of any single-stranded nucleic acid, thereby cutting the single-stranded nucleic acid detector in the system; a fluorescent group and a quenching group are respectively set at both ends of the single-stranded nucleic acid detector, and if the single-stranded nucleic acid detector is cut, fluorescence will be stimulated; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be set as a label that can be detected by colloidal gold.

[0319] In this example, the target nucleic acid is selected as single-stranded DNA, N-crRNA2-j19 ssDNA: TCAAGCTGGTTCAATCTGTCAAGCAGCAGCAAAGCAAGAGCAGC;

[0320] The gRNA sequence is: GUGUAGGCCUCCUCUGAAUGGGGUGGCUAAUGACAC UUGCUGCUGCUUGACAGAUU (Italics are direct repeat sequences, and the underlined region is the targeted region);

[0321] The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

[0322] The following reaction system was used: Cas-sf0135 final concentration was 50 nM, gRNA final concentration was 50 nM, target nucleic acid final concentration was 50 nM, and single-stranded nucleic acid detector final concentration was 200 nM. Incubate at 37°C and read FAM fluorescence / 30 s. No target nucleic acid was added to the control group.

[0323] like Figure 1 As shown in the figure, compared with the control, in the presence of target nucleic acid and gRNA, the single-stranded nucleic acid detector in the Cas-sf0135 cleavage system quickly reports fluorescence. The above experiments reflect that Cas-sf0135 can be used for the detection of target nucleic acid in conjunction with the single-stranded nucleic acid detector. Figure 1 In the figure, 2 is the experimental result of adding the target nucleic acid, and 4 is the control group without adding the target nucleic acid.

[0324] Example 3. PAM identification of Cas-sf0135 protein

[0325] Construction of Cas-sf0135 protein expression plasmid: After optimizing the human codons of the nucleic acid sequence, perform gene synthesis and connect it into the E. coli expression vector PeT28(a)+ vector. Add JM23119 promoter to the vector PeT28(a)+-Cas-sf0135 to start Cas-sf0135 crRNA transcription. Form the vector: PeT28(a)+-Cas-sf0135-JM23119-crRNA, crRNA sequence:

[0326] GUGUAGGCCUCCUCUGAAUGGGGUGGCUAAUGACAC UCCCCUACGUGCUGCUGAAGUUG C The underlined sequence is the target sequence; Construction of PAM library: synthetic sequence

[0327] CGTGTTTCGTAAAGTCTGGAAACGCGGAAGCCCCCAGCGCTTCAGCGTCNNNNNN T CCCCTACGTGCTGCTGAAGTTGC CCGCAA, N is a random deoxynucleotide, and the underline is the target sequence. After being filled with Klenow enzyme, it was connected to the pacyc184 vector. After transforming E. coli, the plasmid was extracted to form a PAM library.

[0328] PAM library subtraction experiment: Prepare competent medium: BL21(DE3)-PeT28(a)+-Cas-sf0135-JM23119-crRNA. PAM library plasmid transformation competent medium: BL21(DE3)-PeT28(a)+-Cas-sf0135-JM23119-crRNA, spread on LB plate containing kanamycin and chloramphenicol, collect bacteria after overnight culture at 37℃, adjust the bacterial concentration to OD60000.6-0.8, add IPTG 0.2mM, and induce at 37℃ for 4h. FastPure EndoFree Plasmid Maxi Kit (vazyme) was used to extract plasmids to obtain the subtracted PAM library. Primers: PAM-F: GGTCTTCGGTTTCCGTGTT; PAM-R: TGGCGTTGACTCTCAGTCAT. The control group samples were obtained by PCR reaction using 30 ng / μL plasmid (PAM library) as template primers, and the experimental group samples were obtained by PCR reaction using 30 ng / μL plasmid (subtracted PAM library) as template. The control group samples and the experimental group samples were sent to the second generation sequencing for data analysis to obtain the PAM sequence. Using Weblogo to draw a map, it was found that the PAM structure was 5'-TTN-3', where N = A / T / C / G, such as Figure 2 shown.

[0329] Example 4. Editing efficiency of Cas-sf0135 protein in animal cells

[0330] The gene editing activity of Cas-sf0135 protein was verified in animal cells, and the target was designed for the FUT8 gene of Chinese hamster ovary cells (CHO). The vector pcDNA3.3 was modified to carry EGFP fluorescent protein and PuroR resistance gene. The SV40 NLS-Cas-sf0135-NLS fusion protein was inserted through the restriction site BsmB1; the U6 promoter and gRNA sequence were inserted through the restriction site Mfe1. The CMV promoter promoted the expression of the fusion protein SV40 NLS-Cas-sf0135-NLS-GFP. The protein Cas-sf0135-NLS was connected to the protein GFP with the connecting peptide T2A. The promoter EF-1α promoted the expression of the puromycin resistance gene.

[0331] Plating: CHO cells were plated when the confluence reached 70-80%, and the number of cells seeded in a 12-well plate was 8*10^4 cells / well.

[0332] Transfection: 12-24 hours after plating, add 2ug plasmid to 100μL opti-MEM and mix well; add 4μL diluted plasmid EL Transfection Reagent (TRAN), incubate at room temperature for 15-20 minutes. Add the incubated mixture to the culture medium containing cells for transfection.

[0333] Puromycin screening: Add puromycin 24 hours after transfection, with a final concentration of 10 ng / ml. After 24 hours of puromycin treatment, change to normal medium and continue culturing for another 24 hours.

[0334] Extract DNA, PCR amplify the editing region, and send to hiTOM sequencing: The cells were collected after trypsin digestion, and genomic DNA was extracted using the Cell / Tissue Genomic DNA Extraction Kit (Biotek). Genomic DNA was amplified by primers PQ0106-FUT8-HiTom-F1:

[0335] GGAGTGAGTACGGTGTGCGAGTTCTGTTGCATGGTAGG; PQ0106-FUT8-HiTom-R1: GAGTTGGATGCTGGATGGGCCAAGCTTCTTGGTGGTTTC The PCR products were sequenced by hiTOM (http: / / 121.40.237.174 / HiTOM / Sample_acceptance_sanyang.php).

[0336] Sequencing data analysis was performed to count the types and proportions of sequences within 20 bp upstream and downstream of the target site -18, and to obtain the editing efficiency of the Cas-sf0135 protein at the target site.

[0337] CHO cell FUT8 gene target sequence: gR17-FUT8:

[0338] TTT CCAGCCAAGGTTGTGGACGGATCA , the italic part is the PAM sequence, and the underlined area is the targeting region. The gRNA sequence is

[0339] GUGUAGGCCUCCUCUGAAUGGGGUGGCUAAUGACAC CCAGCCAAGGUUGUGGACGGAUCA , the underlined area is the targeted area.

[0340] The analysis results showed that the editing efficiency of Cas-sf0135 in the target site gR17-FUT8 of CHO cells was 0.86%, and the editing type was InDel. The partial sequencing results of the edited target nucleic acid were as follows: Figure 3 shown.

[0341] Example 5. Application of Cas-sf6844 protein in nucleic acid detection

[0342] This example verifies the trans-cleavage activity of Cas-sf6844 by in vitro testing. In this example, a gRNA that can be paired with a target nucleic acid is used to guide the Cas-sf6844 protein to recognize and bind to the target nucleic acid; subsequently, the Cas-sf6844 protein stimulates the trans-cleavage activity of any single-stranded nucleic acid, thereby cutting the single-stranded nucleic acid detector in the system; a fluorescent group and a quenching group are respectively set at both ends of the single-stranded nucleic acid detector, and if the single-stranded nucleic acid detector is cut, fluorescence will be stimulated; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be set as a marker that can be detected by colloidal gold.

[0343] In this example, the target nucleic acid is selected as single-stranded DNA, N-crRNA2-j19 ssDNA:

[0344] TCAAGCTGGTTCAATCTGTCAAGCAGCAGCAAAGCAAGAGCAGC;

[0345] The gRNA sequence is:

[0346] GUGCAGCGGCCCGGCCGAGCCGGGCCGAAGAGACAC UUGCUGCUGCUUGACAGAUU (Italics are direct repeat sequences, and the underlined region is the targeted region);

[0347] The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

[0348] The following reaction system was used: Cas-sf6844 final concentration was 50 nM, gRNA final concentration was 50 nM, target nucleic acid final concentration was 50 nM, and single-stranded nucleic acid detector final concentration was 200 nM. Incubate at 37°C and read FAM fluorescence / 30 s. No target nucleic acid was added to the control group.

[0349] like Figure 1 As shown in the figure, compared with the control, in the presence of target nucleic acid and gRNA, the single-stranded nucleic acid detector in the Cas-sf6844 cleavage system quickly reports fluorescence. The above experiments reflect that Cas-sf6844 can be used for the detection of target nucleic acid in conjunction with the single-stranded nucleic acid detector. Figure 1 In the figure, 1 is the experimental result of adding the target nucleic acid, and 3 is the control group without adding the target nucleic acid.

[0350] Example 6. Cas-sf6844 protein PAM identification

[0351] Construction of Cas-sf6844 protein expression plasmid: After optimizing the human codons of the nucleic acid sequence, perform gene synthesis and connect it to the E. coli expression vector PeT28(a)+ vector. Add JM23119 promoter to the vector PeT28(a)+-Cas-sf6844 to initiate Cas-sf6844 crRNA transcription. Form the vector: PeT28(a)+-Cas-sf6844-JM23119-crRNA, crRNA sequence:

[0352] GUGCAGCGGCCCGGCCGAGCCGGGCCGAAGAGACAC UCCCCUACGUGCUGCUGAA GUUGC The underlined sequence is the target sequence; Construction of PAM library: synthetic sequence

[0353] CGTGTTTCGTAAAGTCTGGAAACGCGGAAGCCCCCAGCGCTTCAGCGTCNNNNNN T CCCCTACGTGCTGCTGAAGTTGC CCGCAA, N is a random deoxynucleotide, and the underline is the target sequence. After being filled with Klenow enzyme, it was connected to the pacyc184 vector. After transforming E. coli, the plasmid was extracted to form a PAM library.

[0354] PAM library subtraction experiment: Prepare competent medium: BL21(DE3)-PeT28(a)+-Cas-sf6844-JM23119-crRNA. PAM library plasmid transformation competent medium: BL21(DE3)-PeT28(a)+-Cas-sf6844-JM23119-crRNA, spread on LB plate containing kanamycin and chloramphenicol, collect bacteria after overnight culture at 37℃, adjust the bacterial concentration to OD60000.6-0.8, add IPTG 0.2mM, and induce at 37℃ for 4h. FastPure EndoFree Plasmid Maxi Kit (vazyme) was used for plasmid extraction to obtain the subtracted PAM library. Primers: PAM-F: GGTCTTCGGTTTCCGTGTT; PAM-R: TGGCGTTGACTCTCAGTCAT. The control group samples were obtained by PCR reaction using 30 ng / μL plasmid (PAM library) as template primers, and the experimental group samples were obtained by PCR reaction using 30 ng / μL plasmid (subtracted PAM library) as template. The control group samples and the experimental group samples were sent to the second generation sequencing for data analysis to obtain the PAM sequence. Using Weblogo to draw a map, it was found that the PAM structure was 5'-ATG-3', such as Figure 4 shown.

[0355] Example 7. Editing efficiency of Cas-sf6844 protein in animal cells

[0356] The gene editing activity of Cas-sf6844 protein was verified in animal cells, and the target was designed for the FUT8 gene of Chinese hamster ovary cells (CHO). The vector pcDNA3.3 was modified to carry EGFP fluorescent protein and PuroR resistance gene. The SV40 NLS-Cas-sf6844-NLS fusion protein was inserted through the restriction site BsmB1; the U6 promoter and gRNA sequence were inserted through the restriction site Mfe1. The CMV promoter promoted the expression of the fusion protein SV40 NLS-Cas-sf6844-NLS-GFP. The protein Cas-sf6844-NLS was connected to the protein GFP with the connecting peptide T2A. The promoter EF-1α promoted the expression of the puromycin resistance gene.

[0357] Plating: CHO cells were plated when the confluence reached 70-80%, and the number of cells seeded in a 12-well plate was 8*10^4 cells / well.

[0358] Transfection: 12-24 hours after plating, add 2ug plasmid to 100μL opti-MEM and mix well; add 4μL diluted plasmid EL Transfection Reagent (TRAN), incubate at room temperature for 15-20 minutes. Add the incubated mixture to the culture medium containing cells for transfection.

[0359] Puromycin screening: Add puromycin 24 hours after transfection, with a final concentration of 10 ng / ml. After 24 hours of puromycin treatment, change to normal medium and continue culturing for another 24 hours.

[0360] Extract DNA, PCR amplify the editing region, and send to hiTOM for sequencing: Cells were collected after trypsin digestion, and genomic DNA was extracted using the Cell / Tissue Genomic DNA Extraction Kit (Biotek). Genomic DNA was sequenced with primers PQ0106-FUT8-HiTom-F1: ggagtgagtacggtgtgCGAGTTCTGTTGCATGGTAGG;

[0361] PQ0106-FUT8-HiTom-R1: GAGTTGGATGCTGGATGGGCCAAGCTTCTTGGTGGTTTC amplified the region near the target site. The PCR product was sequenced by hiTOM (http: / / 121.40.237.174 / HiTOM / Sample_acceptance_sanyang.php).

[0362] Sequencing data analysis was performed to count the types and proportions of sequences within 20 bp upstream and downstream of the target site -18, and to obtain the editing efficiency of the Cas-sf6844 protein at the target site.

[0363] CHO cell FUT8 gene target sequence: FUT8-g2: ATGGGGAGCTCGACCACTTGAACATTT, the italic part is the PAM sequence, and the underlined area is the targeting region. The gRNA sequence is

[0364] GUGCAGCGGCCCGGCCGAGCCGGGCCGAAGAGACAC GGGAGCUCGACCACUUGAA CAUUU , the underlined area is the targeted area.

[0365] The analysis results showed that the editing efficiency of Cas-sf6844 in the target site FUT8-gR2 of CHO cells was 5.34%, and the editing type was InDel. The partial sequencing results of the edited target nucleic acid were as follows: Figure 5 shown.

[0366] Example 8. Cleavage properties of Cas-sf6844 protein - cleavage position

[0367] In this example, the cleavage position of the complementary strand TS and the non-complementary strand NTS of the double-stranded target nucleic acid by the Cas-sf6844 protein is determined by in vitro detection. In this example, gRNA is used to guide the Cas-sf6844 protein to recognize and bind to the double-stranded target nucleic acid; the Cas protein stimulates the cis cleavage activity of the double-stranded target nucleic acid, thereby cleaving the double-stranded target nucleic acid in the system. The double-stranded target nucleic acid after cleavage is flattened and A is added, and then the adapter with T is connected. The connection product is enriched by PCR and then Sanger sequencing is performed.

[0368] In this example, the target nucleic acid is selected as double-stranded DNA (plasmid), the sequence is:

[0369] CATTAGATCTGTGTGGCCAAATG TCCCCTACGTGCTGCTGAAG TTGC was connected to the vector T-Vector-pEASY-Blunt Simple Cloning Vector. The italic part is the PAM sequence, and the underlined area is the targeting region.

[0370] gRNA:Cas-sf6844-5spacer1:

[0371] GUGCAGCGGCCCGGCCGAGCCGGGCCGAAGAGACAC UCCCCUACGUGCUGCUGAA GUUGC (The underlined area is the targeted area).

[0372] The following reaction system was used: 50 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf6844 100 nM, gRNA 250 nM, double-stranded target nucleic acid 10 ng / μL (plasmid). Cas protein and gRNA were incubated at 25°C for 10 min; double-stranded target nucleic acid was added, incubated at 37°C for 1 h, and incubated at 85°C for 5 min; 50 uL 2X Taq DNA Polymerase Mix (Novozyme) (1:1) was added to the above system, and the reaction was carried out at 72°C for 30 min; the above reaction solution was liquid recovered; 2 μL of annealed primer 2 μM was added to the recovered liquid

[0373] (TK-117: CGGCATTCCTGCTGAACCGCTCTTCCGATCT, TK-111: GATCGGAAGAGCGGTTCAGCAGGAATGCCG), T4 (NEB) ligase at 22℃ for 1h. Take 10μL of the ligation product, primer S1-PAM-after: ACTCAGCGGCATTCCTGCTGAACCGC, PQ0275-F: CCGTATTACCGCCTTTGAG, 2X Taq DNA Polymerase Mix (Novagen) for PCR reaction. PCR product was sequenced by Sanger sequencing. The results are as follows Figure 6 As shown, when Cas-sf6844 protein cuts the target nucleic acid, the cutting position is between 10-11 nt of TS. That is, the cutting site of Cas-sf6844 on the complementary chain of the target sequence is between 10 nt and 11 nt at the 5' end of the PAM complementary sequence, and gRNA guides Cas-sf6844 protein to recognize and bind to the above complementary chain.

[0374] Example 9. Application of Cas-sf5525 protein in nucleic acid detection

[0375] This example verifies the trans-cleavage activity of Cas-sf5525 by in vitro testing. In this example, a gRNA that can be paired with a target nucleic acid is used to guide the Cas-sf5525 protein to recognize and bind to the target nucleic acid; then, the Cas-sf5525 protein stimulates the trans-cleavage activity of any single-stranded nucleic acid, thereby cutting the single-stranded nucleic acid detector in the system; a fluorescent group and a quenching group are respectively set at both ends of the single-stranded nucleic acid detector, and if the single-stranded nucleic acid detector is cut, fluorescence will be stimulated; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be set as a marker that can be detected by colloidal gold.

[0376] In this example, the target nucleic acid is selected as single-stranded DNA, NB-i3g1-ssDNA:

[0377] CGACATTCCGAAGAACGCTGAAGCCTGGGGCAAATTGTGCAATTTGCGGC;

[0378] The gRNA sequence is:

[0379] AUAGAAGUGUGGAUACCCUACCGGGUAUCACUGACAC CCCCCAGCGCUUCAGCGUUC (Italics are direct repeat sequences, and the underlined region is the targeted region);

[0380] The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

[0381] The following reaction system was used: Cas-sf5525 final concentration was 50 nM, gRNA final concentration was 50 nM, target nucleic acid final concentration was 50 nM, and single-stranded nucleic acid detector final concentration was 200 nM. Incubate at 37°C and read FAM fluorescence / 30 s. No target nucleic acid was added to the control group.

[0382] like Figure 7 As shown in the figure, compared with the control, in the presence of target nucleic acid and gRNA, the single-stranded nucleic acid detector in the Cas-sf5525 cutting system quickly reports fluorescence. The above experiments reflect that Cas-sf5525 can be used for the detection of target nucleic acid in conjunction with the single-stranded nucleic acid detector. Figure 7 In the figure, 1 is the experimental result with the addition of target nucleic acid, and 2 is the control group without the addition of target nucleic acid.

[0383] Example 10. Application of Cas-sf6327 protein in nucleic acid detection

[0384] This example verifies the trans-cleavage activity of Cas-sf6327 by in vitro testing. In this example, a gRNA that can be paired with a target nucleic acid is used to guide the Cas-sf6327 protein to recognize and bind to the target nucleic acid; subsequently, the Cas-sf6327 protein stimulates the trans-cleavage activity of any single-stranded nucleic acid, thereby cutting the single-stranded nucleic acid detector in the system; a fluorescent group and a quenching group are respectively set at both ends of the single-stranded nucleic acid detector, and if the single-stranded nucleic acid detector is cut, fluorescence will be stimulated; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be set as a marker that can be detected by colloidal gold.

[0385] In this example, the target nucleic acid is selected as single-stranded DNA, NB-i3g1-ssDNA:

[0386] CGACATTCCGAAGAACGCTGAAGCCTGGGGCAAATTGTGCAATTTGCGGC;

[0387] The gRNA sequence is:

[0388] GUGCCAAAACCUUCUGAGCAGGGAGGUUGCGAGCAC CCCCCAGCGCUUCAGCGUUC (Italics are direct repeat sequences, and the underlined region is the targeted region);

[0389] The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

[0390] The following reaction system was used: Cas-sf6327 final concentration was 50 nM, gRNA final concentration was 50 nM, target nucleic acid final concentration was 50 nM, and single-stranded nucleic acid detector final concentration was 200 nM. Incubate at 37°C and read FAM fluorescence / 30 s. No target nucleic acid was added to the control group.

[0391] like Figure 8 As shown in the figure, compared with the control, in the presence of target nucleic acid and gRNA, the single-stranded nucleic acid detector in the Cas-sf6327 cleavage system quickly reports fluorescence. The above experiments reflect that Cas-sf6327 can be used for the detection of target nucleic acids in conjunction with the single-stranded nucleic acid detector. Figure 8 In the figure, 1 is the experimental result with the addition of target nucleic acid, and 2 is the control group without the addition of target nucleic acid.

[0392] Example 11. Cas-sf3539 protein PAM identification

[0393] Construction of Cas-sf3539 protein expression plasmid: After optimizing the human codons of the nucleic acid sequence, perform gene synthesis and connect it to the E. coli expression vector PeT28(a)+ vector. Add JM23119 promoter to the vector PeT28(a)+-Cas-sf3539 to initiate Cas-sf3539 crRNA transcription. Form the vector: PeT28(a)+-Cas-sf3539-JM23119-crRNA, crRNA sequence:

[0394] CUAACAGUGUGGGUCUGAAACACAGACCAUUGACAC UGCAAUGCGUUGGAUUAUG ACGAU The underlined sequence is the target sequence; Construction of PAM library: synthetic sequence

[0395] TTCCTTGGCCTGC ATCGTCATAATCCAACGCATTGCA NNNNNNTTTAACAGTGGCCTTATTAAATGACTTCTCTCCCCT, N is a random deoxynucleotide, and the underline is the target sequence. After being filled with Klenow enzyme, it was connected to the pacyc184 vector. After transforming E. coli, the plasmid was extracted to form a PAM library.

[0396] PAM library subtraction experiment: Prepare competent medium: BL21(DE3)-PeT28(a)+-Cas-sf3539-JM23119-crRNA. PAM library plasmid transformation competent medium: BL21(DE3)-PeT28(a)+-Cas-sf3539-JM23119-crRNA, spread on LB plate containing kanamycin and chloramphenicol, collect bacteria after overnight culture at 37℃, adjust the bacterial concentration to OD60000.6-0.8, add IPTG 0.2mM, and induce at 37℃ for 4h. FastPure EndoFree Plasmid Maxi Kit (vazyme) was used for plasmid extraction to obtain the subtracted PAM library. Primers: PAM-F: GGTCTTCGGTTTCCGTGTT; PAM-R: TGGCGTTGACTCTCAGTCAT. The control group samples were obtained by PCR reaction using 30 ng / μL plasmid (PAM library) as template primers, and the experimental group samples were obtained by PCR reaction using 30 ng / μL plasmid (subtracted PAM library) as template. The control group samples and the experimental group samples were sent to the second generation sequencing for data analysis to obtain the PAM sequence. Using Weblogo to draw a map, it was found that the PAM structure was 5'-TTN-3', where N = A / T / C / G, such as Fig. 9 shown.

[0397] Example 12. Application of Cas-sf3539 protein in double-stranded nucleic acid editing

[0398] This example detects the cis cleavage activity of double-stranded DNA of Cas-sf3539 in vitro. In this example, a gRNA that can pair with a target nucleic acid is used to guide the Cas-sf3539 protein to recognize and bind to the target nucleic acid, thereby cleaving the target nucleic acid in the system, and the cleaved target nucleic acid is detected by agarose electrophoresis.

[0399] In this example, the target nucleic acid is double-stranded DNA (plasmid), NB-i3g1, whose sequence is: AACATTGGCCGCAAATTGCACAATTTG CCCCCAGCGCTTCAGCGTTC TTCGGAATGTC GCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCAT CAAATTGGATGACAAAGATCCAAATTTCA was connected to the vector T-Vector-pEASY-Blunt Simple Cloning Vector; the italic part is the PAM sequence, N=A / T / C / G, and the underlined area is the targeting region.

[0400] gRNA:BLG13539-NB-i3g1:

[0401] CUAACAGUGUGGGUCUGAAACACAGACCAUUGACAC CCCCCAGCGCUUCAGCG UUC (The underlined area is the targeted area)

[0402] The following reaction system was used: 20 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf3539 final concentration was 100 nM, gRNA final concentration was 200 nM, and double-stranded target nucleic acid final concentration was 5 ng / μL. Incubate at 37 °C for 1 h and 85 °C for 20 min. The cleavage products were subjected to agarose electrophoresis to detect the cleavage ability of Cas-sf3539. Cas-sf3539 protein, gRNA and target nucleic acid were added to the experimental group, and gRNA was not added to the control group (CK).

[0403] The results are as follows Fig.10 As shown, compared with the control without gRNA, Cas-sf3539 in the experimental group with PAM 5'-TTN-3' (N = A / T / C / G) can cut the double-stranded nucleic acid in the system, showing obvious cutting bands. This shows that Cas-sf3539 can be used for cutting and editing double-stranded target nucleic acids with PAM 5'-TTN-3' (N = A / T / C / G).

[0404] Example 13. Cleavage properties of Cas-sf3539 protein - NTS / TS cleavage efficiency

[0405] This embodiment detects the cutting efficiency of Cas-sf3539 on the complementary strand (TS) and non-complementary strand (NTS) of the target nucleotide double-stranded DNA in vitro. 5'6-FAM marks the non-complementary strand (NTS) and 5'ROX marks the complementary strand (TS). The gRNA guides the Cas-sf3539 protein to recognize and bind to the target nucleic acid, thereby cutting the target nucleic acid in the system. The cut target nucleic acid is detected by capillary electrophoresis (ABI 3730xl genetic analyzer). The DNA fragments migrate from the cathode to the anode in the gel and are arranged according to the length of the fragments. When the scanning window of the laser scanner at the anode end is migrated, the fluorescent dye is excited and emits a certain wavelength of light, which is recorded according to the fluorescence intensity. The electrophoresis track of each DNA fragment with a fluorescent dye is recorded according to the actual time of each passing through the laser scanning window, and each fragment is represented by a fluorescence absorption peak. The higher the peak value, the more the amount of the fragment; the time when the peak appears is directly related to the size of the fragment. The smaller the fragment, the earlier the peak appears. In the FAM fluorescence channel, the size of the uncut NTS fragment by Cas-sf3539 is 380 nt, and the fragment after Cas-sf3539 cuts NTS is about 126 nt. In the ROX fluorescence channel, the size of the uncut TS fragment by Cas-sf3539 is 380 nt, and the fragment after Cas-sf3539 cuts TS is about 254 nt. The calculation formula of fragment cutting efficiency is: Cutting efficiency = cutting peak area / (cutting peak area + uncut peak area).

[0406] In this example, the target nucleic acid is selected as double-stranded DNA (PCR product), and the primers are:

[0407] XQ0001-5FAM:GTATGTTGTGTGGAATTGTG 5'6-FAM;

[0408] XQ0002-5ROX:GCTGCGCGTAACCACCACAC 5'ROX

[0409] The sequence of the amplified product is:

[0410] GTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA

[0411] TGATTACGCCAAGCTGCCCTTCATTAGATCTGTGTGGCCAATTC TCCCCTACGTGCTGC

[0412] TGAAG TTGCAAGGGCAGCTTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGG

[0413] CCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCT

[0414] TGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGC

[0415] CCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGC; the italic part is the PAM sequence, and the underlined region is the targeting region.

[0416] gRNA:Cas-sf3539-5spacer1:

[0417] CUAACAGUGUGGGUCUGAAACACAGACCAUUGACAC UCCCCUACGUGCUGCUGAA GUUGC (The underlined area is the targeted area)

[0418] The following reaction system was used: 20 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf3539 50 nM, gRNA 100 nM, double-stranded target nucleic acid 1 μL (PCR product). Incubate at 37°C for 5 min, 15 min, 30 min, 60 min, and incubate at 85°C for 20 min. Capillary electrophoresis was used to detect the products in the FAM and ROX channels (ABI 3730xl Genetic Analyzer). The software Gene mapper 4.1 was used for data analysis and calculation of the cutting efficiency of NTS and TS.

[0419] The results are as follows Fig.11 As shown: Cas-sf3539 preferentially cuts NTS when cutting target nucleic acid.

[0420] Example 14. Cleavage properties of Cas-sf3539 protein - cleavage position

[0421] In this example, the cleavage position of the complementary and non-complementary strands of the double-stranded target nucleic acid by the Cas-sf3539 protein is determined by in vitro detection. In this example, gRNA is used to guide the Cas-sf3539 protein to recognize and bind to the double-stranded target nucleic acid; the Cas protein stimulates the cis cleavage activity of the double-stranded target nucleic acid, thereby cleaving the double-stranded target nucleic acid in the system. The double-stranded target nucleic acid after cleavage is flattened and A is added, and then the adapter with T is connected. The connection product is enriched by PCR and then Sanger sequencing is performed.

[0422] In this example, the target nucleic acid is double-stranded DNA (plasmid), sequence: CATTAGATCTGTGTGGCCAATTC TCCC CTACGTGCTGCTGAAG TTGC was connected to the vector T-Vector-pEASY-Blunt Simple Cloning Vector. The italic part is the PAM sequence, and the underlined area is the targeting region.

[0423] gRNA:Cas-sf3539-5spacer1:

[0424] CUAACAGUGUGGGUCUGAAACACAGACCAUUGACAC UCCCCUACGUGCUGCUGAA GUUGC (The underlined area is the targeted area).

[0425] The following reaction system was used: 50 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf3539 100 nM, gRNA 250 nM, double-stranded target nucleic acid 10 ng / μL (plasmid). Cas protein and gRNA were incubated at 25°C for 10 min; double-stranded target nucleic acid was added, incubated at 37°C for 1 h, and incubated at 85°C for 5 min; 50 uL 2X Taq DNA Polymerase Mix (Novozyme) (1:1) was added to the above system, and the reaction was carried out at 72°C for 30 min; the above reaction solution was liquid recovered; 2 μL of annealed primer 2 μM was added to the recovered liquid

[0426] (TK-117: CGGCATTCCTGCTGAACCGCTCTTCCGATCT, TK-111: GATCGGAAGAGCGGTTCAGCAGGAATGCCG), T4 (NEB) ligase at 22℃ for 1h. Take 10μL of the ligation product, primer S1-PAM-after: ACTCAGCGGCATTCCTGCTGAACCGC, PQ0275-F: CCGTATTACCGCCTTTGAG, 2X Taq DNA Polymerase Mix (Novagen) for PCR reaction. PCR product was sequenced by Sanger sequencing. The results are as follows Fig.12 As shown, when Cas-sf3539 protein cuts the target nucleic acid, the cutting position is between 14-15nt of NTS. That is, the cutting site of Cas-sf3539 on the non-complementary strand of the target sequence is between 14nt and 15nt at the 3' end of the PAM sequence, and the gRNA guides the Cas-sf3539 protein to recognize and bind to the above complementary strand, which is the DNA strand paired with the complementary strand.

[0427] Example 15. Application of Cas-sf8808 protein in nucleic acid detection

[0428] This example verifies the trans-cleavage activity of Cas-sf8808 by in vitro testing. In this example, a gRNA that can be paired with a target nucleic acid is used to guide the Cas-sf8808 protein to recognize and bind to the target nucleic acid; subsequently, the Cas-sf8808 protein stimulates the trans-cleavage activity of any single-stranded nucleic acid, thereby cutting the single-stranded nucleic acid detector in the system; a fluorescent group and a quenching group are respectively set at both ends of the single-stranded nucleic acid detector, and if the single-stranded nucleic acid detector is cut, fluorescence will be stimulated; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be set as a marker that can be detected by colloidal gold.

[0429] In this example, the target nucleic acid is selected as single-stranded DNA, SQ0009:

[0430] CTCTGTTGCGGGCAACTTCAGCAGCACGTAGGGGAGAACGCTGAAGCGC;

[0431] The gRNA sequence is:

[0432] CUCGCAAUGCCUCAGAAACCCGUCCUUGGUUGACGG UCCCCUACGUGCUGCUGAAG (Italics are direct repeat sequences, and the underlined region is the targeted region);

[0433] The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

[0434] The following reaction system was used: Cas-sf8808 final concentration was 50 nM, gRNA final concentration was 50 nM, target nucleic acid final concentration was 50 nM, and single-stranded nucleic acid detector final concentration was 200 nM. Incubate at 37°C and read FAM fluorescence / 30 s. No target nucleic acid was added to the control group.

[0435] like Fig.13 As shown in the figure, compared with the control, in the presence of target nucleic acid and gRNA, the single-stranded nucleic acid detector in the Cas-sf8808 cleavage system quickly reports fluorescence. The above experiments reflect that Cas-sf8808 can be used for the detection of target nucleic acid in conjunction with the single-stranded nucleic acid detector. Fig.13 In the figure, 1 is the experimental result with the addition of target nucleic acid, and 2 is the control group without the addition of target nucleic acid.

[0436] Example 16. Application of Cas-sf8808 protein in double-stranded nucleic acid editing

[0437] This example detects the cis cleavage activity of double-stranded DNA of Cas-sf8808 in vitro. In this example, a gRNA that can pair with a target nucleic acid is used to guide the Cas-sf8808 protein to recognize and bind to the target nucleic acid, thereby cleaving the target nucleic acid in the system, and the cleaved target nucleic acid is detected by agarose electrophoresis.

[0438] In this example, the target nucleic acid is double-stranded DNA (plasmid), 5spacer1-PAM, and its sequence is: CATTAGATCTGTGTGGCCAANNN TCCCCTACGTGCTGCTGAAGTTGC Connect to the vector T-Vector-pEASY-Blunt SimpleCloning Vector; the italic part is the PAM sequence, N=A / T / C / G, and the underlined area is the targeting region.

[0439] gRNA:BLG8808-5'spacer1:

[0440] CUCGCAAUGCCUCAGAAACCCGUCCUUGGUUGACGG UCCCCUACGUGCUGCUG AAG (The underlined area is the targeted area)

[0441] The following reaction system was used: 20 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf8808 final concentration was 100 nM, gRNA final concentration was 200 nM, and double-stranded target nucleic acid final concentration was 5 ng / μL. Incubate at 37 °C for 1 h and 85 °C for 20 min. The cleavage product was subjected to agarose electrophoresis to detect the cleavage ability of Cas-sf8808. Cas-sf8808 protein, gRNA and target nucleic acid were added to the experimental group, and gRNA was not added to the control group (CK).

[0442] The results are as follows Fig.14 As shown, compared with the control without gRNA, Cas-sf8808 in the experimental group with PAM 5'-TTN-3' (N = A / T / C / G) can cut the double-stranded nucleic acid in the system, showing obvious cutting bands. This shows that Cas-sf8808 can be used for cutting and editing double-stranded target nucleic acids with PAM 5'-TTN-3' (N = A / T / C / G).

[0443] Example 17. Cleavage properties of Cas-sf8808 protein - cleavage position

[0444] In this example, the cleavage position of the complementary and non-complementary strands of the double-stranded target nucleic acid by the Cas-sf8808 protein is determined by in vitro detection. In this example, gRNA is used to guide the Cas-sf8808 protein to recognize and bind to the double-stranded target nucleic acid; the Cas protein stimulates the cis cleavage activity of the double-stranded target nucleic acid, thereby cleaving the double-stranded target nucleic acid in the system. The double-stranded target nucleic acid after cleavage is flattened and A is added, and then the adapter with T is connected. The connection product is enriched by PCR and then Sanger sequencing is performed.

[0445] In this example, the target nucleic acid is double-stranded DNA (plasmid), sequence: CATTAGATCTGTGTGGCCAATTC TCCC CTACGTGCTGCTGAAG TTGC was connected to the vector T-Vector-pEASY-Blunt Simple Cloning Vector. The italic part is the PAM sequence, and the underlined area is the targeting region.

[0446] gRNA:Cas-sf8808-5spacer1:

[0447] CUCGCAAUGCCUCAGAAACCCGUCCUUGGUUGACGG UCCCCUACGUGCUGCUGAA G (The underlined area is the targeted area).

[0448] The following reaction system was used: 50 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf8808 100 nM, gRNA 250 nM, double-stranded target nucleic acid 10 ng / μL (plasmid). Cas protein, gRNA, incubate at 25 ° C for 10 min; add double-stranded target nucleic acid, incubate at 37 ° C for 1 h, and incubate at 85 ° C for 5 min; add 50 uL 2X Taq DNA Polymerase Mix (Novozyme) (1:1) to the above system, react at 72 ° C for 30 min; the above reaction solution was liquid recovered; 2 μL of annealed primer 2 μM (TK-117: CGGCATTCCTGCTGAACCGCTCTTCCGATCT, TK-111:

[0449] GATCGGAAGAGCGGTTCAGCAGGAATGCCG), T4 (NEB) ligase at 22℃ for 1h. Take 10μL of the ligation product, primer S1-PAM-after: ACTCAGCGGCATTCCTGCTGAACCGC, PQ0275-F: CCGTATTACCGCCTTTGAG, 2X TaqDNA Polymerase Mix (Novagen) for PCR reaction. PCR product was sequenced by Sanger sequencing. The results are as follows Fig.15 As shown, when Cas-sf8808 protein cuts the target nucleic acid, the cutting position is between 18-19nt of NTS and 22-24nt of TS. That is, the cutting site of Cas-sf8808 on the complementary chain of the target sequence is between 22nt and 24nt at the 5' end of the PAM complementary sequence, and the cutting site of Cas-sf8808 on the non-complementary chain of the target sequence is between 18nt and 19nt at the 3' end of the PAM sequence. The gRNA guides the Cas-sf8808 protein to recognize and bind to the above complementary chain, and the above non-complementary chain is the DNA chain paired with the complementary chain.

[0450] Example 18. Editing efficiency of Cas-sf8808 protein in animal cells

[0451] The gene editing activity of Cas-sf8808 protein was verified in animal cells, and the target was designed for the FUT8 gene of Chinese hamster ovary cells (CHO). The vector pcDNA3.3 was modified to carry EGFP fluorescent protein and PuroR resistance gene. The SV40 NLS-Cas-sf8808-NLS fusion protein was inserted through the restriction site BsmB1; the U6 promoter and gRNA sequence were inserted through the restriction site Mfe1. The CMV promoter promoted the expression of the fusion protein SV40 NLS-Cas-sf8808-NLS-GFP. The protein Cas-sf8808-NLS was connected to the protein GFP with the connecting peptide T2A. The promoter EF-1α promoted the expression of the puromycin resistance gene.

[0452] Plating: CHO cells were plated when the confluence reached 70-80%, and the number of cells seeded in a 12-well plate was 8*10^4 cells / well.

[0453] Transfection: 12-24 hours after plating, add 2ug plasmid to 100μL opti-MEM and mix well; add 4μL diluted plasmid EL Transfection Reagent (TRAN), incubate at room temperature for 15-20 minutes. Add the incubated mixture to the culture medium containing cells for transfection.

[0454] Puromycin screening: Add puromycin 24 hours after transfection, with a final concentration of 10 ng / ml. After 24 hours of puromycin treatment, change to normal medium and continue culturing for another 24 hours.

[0455] Extract DNA, PCR amplify the editing region, and send to hiTOM for sequencing: The cells were collected after trypsin digestion, and genomic DNA was extracted using a cell / tissue genomic DNA extraction kit (Biotek). Genomic DNA was amplified near the target site using primers NAFUT8-JC-Hitom-1F2: GGAGTGAGTACGGTGTGCAGTCCATGTCAGACGCACTG; PQ0106-FUT8-HiTom-R5: GAGTTGGATGCTGGATGGTACAGAACCACTTGTTGGTC. The PCR product was sequenced by hiTOM (http: / / 121.40.237.174 / HiTOM / Sample_acceptance_sanyang.php).

[0456] Sequencing data analysis was performed to count the types and proportions of sequences within 20 bp upstream and downstream of the target site -18, and to obtain the editing efficiency of the Cas-sf8808 protein at the target site.

[0457] CHO cell FUT8 gene target sequence: gR16-FUT8:

[0458] TTT AACAAAGAAGGGTCATCAGTGGCC , the italic part is the PAM sequence, and the underlined area is the targeting region. The gRNA sequence is

[0459] CUCGCAAUGCCUCAGAAACCCGUCCUUGGUUGACGG AACAAAGAAGGGUCAUCAG UGG , the underlined area is the targeted area.

[0460] The analysis results showed that the editing efficiency of Cas-sf8808 in the target site gR16-FUT8 of CHO cells was 0.25%, and the editing type was InDel. The partial sequencing results of the edited target nucleic acid were as follows: Fig.16 shown.

[0461] Example 19. Application of Cas-sf8856 protein in nucleic acid detection

[0462] This example verifies the trans-cleavage activity of Cas-sf8856 by in vitro testing. In this example, a gRNA that can be paired with a target nucleic acid is used to guide the Cas-sf8856 protein to recognize and bind to the target nucleic acid; subsequently, the Cas-sf8856 protein stimulates the trans-cleavage activity of any single-stranded nucleic acid, thereby cutting the single-stranded nucleic acid detector in the system; a fluorescent group and a quenching group are respectively set at both ends of the single-stranded nucleic acid detector, and if the single-stranded nucleic acid detector is cut, fluorescence will be stimulated; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be set as a label that can be detected by colloidal gold.

[0463] In this example, the target nucleic acid is selected as single-stranded DNA, NB-i3g1-ssDNA:

[0464] CGACATTCCGAAGAACGCTGAAGCCTGGGGCAAATTGTGCAATTTGCGGC;

[0465] The gRNA sequence is:

[0466] GUUGCAACGAAGUUUGAUUGCGAGGUACGCCUCGAC CCCCCAGCGCUUCAGCGUUC (Italics are direct repeat sequences, and the underlined region is the targeted region);

[0467] The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

[0468] The following reaction system was used: Cas-sf8856 final concentration was 50 nM, gRNA final concentration was 50 nM, target nucleic acid final concentration was 50 nM, and single-stranded nucleic acid detector final concentration was 200 nM. Incubate at 37°C and read FAM fluorescence / 30 s. No target nucleic acid was added to the control group.

[0469] like Fig.17 As shown in the figure, compared with the control, in the presence of target nucleic acid and gRNA, the single-stranded nucleic acid detector in the Cas-sf8856 cleavage system quickly reports fluorescence. The above experiments reflect that Cas-sf8856 can be used for the detection of target nucleic acid in conjunction with the single-stranded nucleic acid detector. Fig.17 In the figure, 1 is the experimental result with the addition of target nucleic acid, and 2 is the control group without the addition of target nucleic acid.

[0470] Example 20. Cas-sf3391 protein PAM identification

[0471] Construction of Cas-sf3391 protein expression plasmid: After optimizing the human codons of the nucleic acid sequence, perform gene synthesis and connect it to the E. coli expression vector PeT28(a)+ vector. Add JM23119 promoter to the vector PeT28(a)+-Cas-sf3391 to initiate Cas-sf3391 crRNA transcription. Form the vector: PeT28(a)+-Cas-sf3391-JM23119-crRNA, crRNA sequence:

[0472] AUAGAAACCCCUACAAAUUGCGCUCUGAGGAGCGAC UCCCCUACGUGCUGCUGAA GUUGC The underlined sequence is the target sequence; Construction of PAM library: synthetic sequence

[0473] CGTGTTTCGTAAAGTCTGGAAACGCGGAAGCCCCCAGCGCTTCAGCGTCNNNNNN T CCCCTACGTGCTGCTGAAGTTGC CCGCAA, N is a random deoxynucleotide, and the underline is the target sequence. After being filled with Klenow enzyme, it was connected to the pacyc184 vector. After transforming E. coli, the plasmid was extracted to form a PAM library.

[0474] PAM library subtraction experiment: Prepare competent medium: BL21(DE3)-PeT28(a)+-Cas-sf3391-JM23119-crRNA. PAM library plasmid transformation competent medium: BL21(DE3)-PeT28(a)+-Cas-sf3391-JM23119-crRNA, spread on LB plate containing kanamycin and chloramphenicol, collect bacteria after overnight culture at 37℃, adjust the bacterial concentration to OD60000.6-0.8, add IPTG 0.2mM, and induce at 37℃ for 4h. FastPure EndoFree Plasmid Maxi Kit (vazyme) was used for plasmid extraction to obtain the subtracted PAM library. Primers: PAM-F: GGTCTTCGGTTTCCGTGTT; PAM-R: TGGCGTTGACTCTCAGTCAT. The control group samples were obtained by PCR reaction using 30 ng / μL plasmid (PAM library) as template primers, and the experimental group samples were obtained by PCR reaction using 30 ng / μL plasmid (subtracted PAM library) as template. The control group samples and the experimental group samples were sent to the second generation sequencing for data analysis to obtain the PAM sequence. Using Weblogo to draw a map, it was found that the PAM structure was 5'-RHYN-3', where R = A / G; H = A / C / T; Y = C / T; N = A / T / C / G, such as Fig.18 shown.

[0475] Example 21. Application of Cas-sf3391 protein in double-stranded nucleic acid editing

[0476] This example detects the cis cleavage activity of double-stranded DNA of Cas-sf3391 in vitro. In this example, a gRNA that can pair with a target nucleic acid is used to guide the Cas-sf3391 protein to recognize and bind to the target nucleic acid, thereby cleaving the target nucleic acid in the system, and the cleaved target nucleic acid is detected by agarose electrophoresis.

[0477] In this example, the target nucleic acid is double-stranded DNA (plasmid), 5spacer1-PAM, and its sequence is: CATTAGATCTGTGTGGCCAANNN TCCCCTACGTGCTGCTGAAGTTGC Connect to the vector T-Vector-pEASY-Blunt SimpleCloning Vector; the italic part is the PAM sequence, N=A / T / C / G, and the underlined area is the targeting region.

[0478] gRNA:Cas-sf3391-5spacer1:

[0479] AUAGAAACCCCUACAAAUUGCGCUCUGAGGAGCGAC UCCCCUACGUGCUGCUGAAG (The underlined area is the targeted area)

[0480] The following reaction system was used: 20 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf3391 final concentration was 100 nM, gRNA final concentration was 200 nM, and double-stranded target nucleic acid final concentration was 5 ng / μL. Incubate at 37 °C for 1 h and 85 °C for 20 min. The cleavage products were subjected to agarose electrophoresis to detect the cleavage ability of Cas-sf3391. Cas-sf3391 protein, gRNA and target nucleic acid were added to the experimental group, and gRNA was not added to the control group (CK).

[0481] like Fig.19 As shown in A and 19B, compared with the control without gRNA, the PAM is 5'-AHYN-3'

[0482] (H=A / C / T; Y=C / T; N=A / T / C / G)( Fig.19 In the experimental group in which the three bases of each experimental group in A are the last three bases of 5'-AHYN-3', Cas-sf3391 can cut the double-stranded nucleic acid in the system, showing obvious cutting bands. Fig.19 As shown in B, compared with the control without gRNA, the PAM was 5'-GHYN-3' (H = A / C / T; Y = C / T;

[0483] In the experimental group with PAM 5'-RHYN-3' (R=A / G; H=A / C / T; Y=C / T; N=A / T / C / G), Cas-sf3391 was able to cut the double-stranded nucleic acid in the system, showing obvious cutting bands. This shows that Cas-sf3391 can be used for cutting and editing double-stranded target nucleic acids with PAM 5'-RHYN-3' (R=A / G; H=A / C / T; Y=C / T; N=A / T / C / G).

[0484] Example 22. Editing efficiency of Cas-sf3391 protein in animal cells

[0485] The gene editing activity of Cas-sf3391 protein was verified in animal cells, and the target was designed for the FUT8 gene of Chinese hamster ovary cells (CHO). The vector pcDNA3.3 was modified to carry EGFP fluorescent protein and PuroR resistance gene. The SV40 NLS-Cas-sf3391-NLS fusion protein was inserted through the restriction site BsmB1; the U6 promoter and gRNA sequence were inserted through the restriction site Mfe1. The CMV promoter promoted the expression of the fusion protein SV40 NLS-Cas-sf3391-NLS-GFP. The protein Cas-sf3391-NLS was connected to the protein GFP with the connecting peptide T2A. The promoter EF-1α promoted the expression of the puromycin resistance gene.

[0486] Plating: CHO cells were plated when the confluence reached 70-80%, and the number of cells seeded in a 12-well plate was 8*10^4 cells / well.

[0487] Transfection: 12-24 hours after plating, add 2ug plasmid to 100μL opti-MEM and mix well; add 4μL diluted plasmid EL Transfection Reagent (TRAN), incubate at room temperature for 15-20 minutes. Add the incubated mixture to the culture medium containing cells for transfection.

[0488] Puromycin screening: Add puromycin 24 hours after transfection, with a final concentration of 10 ng / ml. After 24 hours of puromycin treatment, change to normal medium and continue culturing for another 24 hours.

[0489] Extract DNA, PCR amplify the editing region, and send to hiTOM for sequencing: The cells were collected after trypsin digestion, and genomic DNA was extracted using a cell / tissue genomic DNA extraction kit (Biotek). The genomic DNA was amplified near the target site using primers PQ0410-hitom-f: GGAGTGAGTACGGTGTGCTTCTGTTAGGTGAAGTGAAG; PQ0106-FUT8-HiTom-R1: GAGTTGGATGCTGGATGGGCCAAGCTTCTTGGTGGTTTC. The PCR product was sequenced by hiTOM (http: / / 121.40.237.174 / HiTOM / Sample_acceptance_sanyang.php).

[0490] Sequencing data analysis was performed to count the types and proportions of sequences within 20 bp upstream and downstream of the target site -18, and to obtain the editing efficiency of the Cas-sf3391 protein at the target site.

[0491] CHO cell FUT8 gene target sequence: gR11-FUT8:

[0492] GTCC ATGGTGATCCTGCAGTGTGGTGGG , the italic part is the PAM sequence, and the underlined area is the targeting region. The gRNA sequence is

[0493] AUAGAAACCCCUACAAAUUGCGCUCUGAGGAGCGAC AUGGUGAUCCUGCAGUGUGGUGGG , the underlined area is the targeted area.

[0494] The analysis results showed that the editing efficiency of Cas-sf3391 in the target site gR11-FUT8 of CHO cells was 8.92%, and the editing type was InDel. The partial sequencing results of the edited target nucleic acid were as follows: Fig. 20 shown.

[0495] Example 23. Cleavage properties of Cas-sf3391 protein - NTS / TS cleavage efficiency

[0496] This embodiment detects the cutting efficiency of Cas-sf3391 on the complementary strand (TS) and non-complementary strand (NTS) of the target nucleotide double-stranded DNA in vitro. 5'6-FAM marks the non-complementary strand (NTS) and 5'ROX marks the complementary strand (TS). The gRNA guides the Cas-sf3391 protein to recognize and bind to the target nucleic acid, thereby cutting the target nucleic acid in the system, and the cut target nucleic acid is detected by capillary electrophoresis (ABI 3730xl genetic analyzer). The DNA fragments migrate from the cathode to the anode in the gel and are arranged according to the length of the fragments. When the scanning window of the laser scanner at the anode end is migrated, the fluorescent dye is excited and emits a certain wavelength of light, which is recorded according to the fluorescence intensity. The electrophoresis track of each DNA fragment with a fluorescent dye is recorded according to the actual time of each passing through the laser scanning window, and each fragment is represented by a fluorescence absorption peak. The higher the peak value, the more the amount of the fragment; the time when the peak appears is directly related to the size of the fragment. The smaller the fragment, the earlier the peak appears. In the FAM fluorescence channel, the size of the uncut NTS fragment by Cas-sf3391 is 380 nt, and the fragment after Cas-sf3391 cuts NTS is about 126 nt. In the ROX fluorescence channel, the size of the uncut TS fragment by Cas-sf3391 is 380 nt, and the fragment after Cas-sf3391 cuts TS is about 254 nt. The calculation formula of fragment cutting efficiency is: Cutting efficiency = cutting peak area / (cutting peak area + uncut peak area).

[0497] In this example, the target nucleic acid is selected as double-stranded DNA (PCR product), and the primers are:

[0498] XQ0001-5FAM:GTATGTTGTGTGGAATTGTG 5'6-FAM;

[0499] XQ0002-5ROX:GCTGCGCGTAACCACCACAC 5'ROX

[0500] The sequence of the amplified product is:

[0501] GTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA

[0502] TGATTACGCCAAGCTGCCCTTCATTAGATCTGTGTGGCCAATTC TCCCCTACGTGCTGC

[0503] TGAAG TTGCAAGGGCAGCTTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGG

[0504] CCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCT

[0505] TGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGC

[0506] CCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGC; the italic part is the PAM sequence, and the underlined region is the targeting region.

[0507] gRNA:Cas-sf3391-5spacer1:

[0508] AUAGAAACCCCUACAAAUUGCGCUCUGAGGAGCGAC UCCCCUACGUGCUGCUGAA G (The underlined area is the targeted area)

[0509] The following reaction system was used: 20 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf3391 50 nM, gRNA 100 nM, double-stranded target nucleic acid 1 μL (PCR product). Incubate at 37°C for 5 min, 15 min, 30 min, 60 min, and incubate at 85°C for 20 min. Capillary electrophoresis was used to detect the products in the FAM and ROX channels (ABI 3730xl Genetic Analyzer). The software Gene mapper 4.1 was used for data analysis and calculation of the cutting efficiency of NTS and TS.

[0510] The results are as follows Fig.21 As shown: Cas-sf3391 preferentially cuts NTS when cutting target nucleic acid.

[0511] Example 24. Cleavage properties of Cas-sf3391 protein - cleavage position

[0512] In this example, the cleavage position of the complementary and non-complementary strands of the double-stranded target nucleic acid by the Cas-sf3391 protein is determined by in vitro detection. In this example, gRNA is used to guide the Cas-sf3391 protein to recognize and bind to the double-stranded target nucleic acid; the Cas protein stimulates the cis cleavage activity of the double-stranded target nucleic acid, thereby cleaving the double-stranded target nucleic acid in the system. The double-stranded target nucleic acid after cleavage is flattened and A is added, and then the adapter with T is connected. The connection product is enriched by PCR and then Sanger sequencing is performed.

[0513] In this example, the target nucleic acid is double-stranded DNA (plasmid), sequence: CATTAGATCTGTGTGGCCAATTC TCCC CTACGTGCTGCTGAAG TTGC was connected to the vector T-Vector-pEASY-Blunt Simple Cloning Vector. The italic part is the PAM sequence, and the underlined area is the targeting region.

[0514] gRNA:Cas-sf3391-5spacer1:

[0515] AUAGAAACCCCUACAAAUUGCGCUCUGAGGAGCGAC UCCCCUACGUGCUGCUGAA G (The underlined area is the targeted area).

[0516] The following reaction system was used: 50 μL system, buffer: Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0, Cas-sf3391 100 nM, gRNA 250 nM, double-stranded target nucleic acid 10 ng / μL (plasmid). Cas protein and gRNA were incubated at 25°C for 10 min; double-stranded target nucleic acid was added, incubated at 37°C for 1 h, and incubated at 85°C for 5 min; 50uL 2X Taq DNA Polymerase Mix (Novozyme) (1:1) was added to the above system, and the reaction was carried out at 72°C for 30 min; the above reaction solution was liquid recovered; 2μL of annealed primers 2μM (TK-117: CGGCATTCCTGCTGAACCGCTCTTCCGATCT, TK-111: GATCGGAAGAGCGGTTCAGCAGGAATGCCG) were added to the recovered liquid, and T4 (NEB) ligase was incubated at 22°C for 1 h. 10μL of the ligation product was taken, and the primers S1-PAM-after: ACTCAGCGGCATTCCTGCTGAACCGC, PQ0275-F: CCGTATTACCGCCTTTGAG, and 2X TaqDNA Polymerase Mix (Novozyme) were used for PCR reaction. The PCR product was sequenced by Sanger sequencing. The results are as follows Fig. 22As shown, when Cas-sf3391 protein cuts the target nucleic acid, the cutting position is between 15-16nt, 18-19nt of NTS and between 20-23nt of TS. That is, the cutting site of Cas-sf3391 for the complementary chain of the target sequence is between 20nt and 23nt at the 5' end of the PAM complementary sequence, and the cutting site of Cas-sf3391 for the non-complementary chain of the target sequence is between 15nt and 16nt or between 18 and 19nt at the 3' end of the PAM sequence. The gRNA guides the Cas-sf3391 protein to recognize and bind to the above complementary chain, and the above non-complementary chain is the DNA chain paired with the complementary chain.

[0517] Example 25. Application of Cas-sf0153, Cas-sf4073, and Cas-sf0352 proteins in nucleic acid detection

[0518] This example verifies the trans-cleavage activity of Cas-sf0153, Cas-sf4073, and Cas-sf0352 through in vitro testing. In this example, gRNA that can be paired with the target nucleic acid is used to guide the Cas-sf0153, Cas-sf4073, and Cas-sf0352 proteins to recognize and bind to the target nucleic acid; subsequently, the Cas-sf0153, Cas-sf4073, and Cas-sf0352 proteins stimulate the trans-cleavage activity of any single-stranded nucleic acid, thereby cutting the single-stranded nucleic acid detector in the system; fluorescent groups and quenching groups are respectively set at both ends of the single-stranded nucleic acid detector, and if the single-stranded nucleic acid detector is cut, fluorescence will be stimulated; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be set as a label that can be detected by colloidal gold.

[0519] In this embodiment, the target nucleic acid is selected as single-stranded DNA, NB-i3g1-ssDNA: CGACATTCCGAAGAACGCTGAAGCGCTGGGGGCAAATTGTGCAATTTGCGGC;

[0520] The gRNA sequence is:

[0521] TTAGGCGTTCCGTCTCGACTATGCCGTACCACTAGACCGAGCCTACACGGCACGCGGTCATAGCGTTAACCAAGGCGTGGTGACAAGCCTCTTTCAGGCGTCGGACACTTAAGAGCGTTAGGCGGGCGGTCCCTAAGCCGCCCGCCCCCTTGAAAGTCGCAGGGGATCAAGAACGCTCTTAGGGAATGAAAG GCCCCCAGCGCTTCAGCGTT (Italics are direct repeat sequences, and the underlined region is the targeted region);

[0522] The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

[0523] The following reaction system was used: Cas-sf final concentration was 50 nM, gRNA final concentration was 50 nM, target nucleic acid final concentration was 50 nM, and single-stranded nucleic acid detector final concentration was 200 nM. Incubate at 37°C and read FAM fluorescence / 30 s. No target nucleic acid was added to the control group.

[0524] like Figure 23-25 As shown in the figure, compared with the control, in the presence of target nucleic acid and gRNA, the single-stranded nucleic acid detector in the Cas-sf0153, Cas-sf4073, and Cas-sf0352 cutting system quickly reports fluorescence. The above experiments reflect that Cas-sf0153, Cas-sf4073, and Cas-sf0352 can be used for the detection of target nucleic acids in conjunction with single-stranded nucleic acid detectors. Fig.23 In the figure, 1 is the experimental group to which Cas-sf0153 added target nucleic acid, and 2 is the control group to which Cas-sf0153 did not add target nucleic acid; Fig.24 In the figure, 3 is the experimental group to which Cas-sf4073 added the target nucleic acid, and 4 is the control group to which Cas-sf4073 did not add the target nucleic acid; Fig.25 5 is the experimental group in which Cas-sf0352 added target nucleic acid, and 6 is the control group in which Cas-sf0352 did not add target nucleic acid.

[0525] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

1. A Cas protein, characterized in that The amino acid sequence of the Cas protein is shown in SEQ ID No.

2.

2. A fusion protein, comprising the Cas protein according to claim 1 and other modified parts, wherein the modified parts are selected from epitope tags, reporter gene sequences or nuclear localization signal sequences, and the modified parts are connected to the Cas protein through a linker, or directly connected to the N-terminus and / or C-terminus of the Cas protein.

3. An isolated polynucleotide, characterized in that The polynucleotide is a polynucleotide sequence encoding the Cas protein according to claim 1, or a polynucleotide sequence encoding the fusion protein according to claim 2.

4. A carrier, characterized in that The vector comprises the polynucleotide according to claim 3 and a regulatory element operably linked thereto.

5. A CRISPR-Cas system, characterized in that: The system comprises the Cas protein of claim 1 and at least one gRNA, wherein the gRNA comprises a direct repeat sequence capable of binding to the Cas protein of claim 1 and a guide sequence capable of targeting a target sequence.

6. A vector system, characterized in that The vector system comprises one or more vectors, and the one or more vectors comprise: a) a first regulatory element, which is operably connected to a gRNA, wherein the gRNA comprises a direct repeat sequence capable of binding to the Cas protein of claim 1 and a guide sequence capable of targeting a target sequence, b) a second regulatory element, which is operably linked to the Cas protein of claim 1; Components (a) and (b) are located on the same or different carriers of the system.

7. A composition, characterized in that The composition comprises: (i) a protein component selected from: the Cas protein of claim 1 or the fusion protein of claim 2; (ii) a nucleic acid component selected from: gRNA, or a nucleic acid encoding a gRNA, or a precursor RNA of a gRNA, or a precursor RNA nucleic acid encoding a gRNA, wherein the gRNA comprises a direct repeat sequence capable of binding to the Cas protein of claim 1 and a guide sequence capable of targeting a target sequence; The protein component and the nucleic acid component are combined with each other to form a complex.

8. An engineered host cell, wherein the host cell is a non-animal or plant cell, characterized in that: The host cell comprises the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the vector system of claim 6, or the composition of claim 7.

9. Use of the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the vector system of claim 6, or the composition of claim 7, or the host cell of claim 8 in gene editing, gene targeting or gene cleavage, wherein the application is for non-disease diagnosis and treatment purposes, and the subject of the application does not include humans; or, use in the preparation of a reagent or kit for gene editing, gene targeting or gene cleavage.

10. Use of the Cas protein according to claim 1, or the fusion protein according to claim 2, or the polynucleotide according to claim 3, or the vector according to claim 4, or the CRISPR-Cas system according to claim 5, or the vector system according to claim 6, or the composition according to claim 7, or the host cell according to claim 8 in any one or more of the following, wherein the application is for non-disease diagnosis and treatment purposes, and the subject of the application does not include humans: Targeting and / or editing of target nucleic acids; non-specific cleavage and / or degradation of collateral nucleic acids; nucleic acid detection.

11. Use of the Cas protein according to claim 1, or the fusion protein according to claim 2, or the polynucleotide according to claim 3, or the vector according to claim 4, or the CRISPR-Cas system according to claim 5, or the vector system according to claim 6, or the composition according to claim 7, or the host cell according to claim 8 in any one or more of the following, wherein the application is for non-disease diagnosis and treatment purposes, and the subject of the application does not include humans: Cut double-stranded DNA, single-stranded DNA or single-stranded RNA; non-specifically cut single-stranded nucleic acids; specifically edit double-stranded nucleic acids; base edit double-stranded nucleic acids; base edit single-stranded nucleic acids.

12. A method for editing a target nucleic acid or targeting a target nucleic acid, the method being a method for non-disease diagnosis and treatment purposes, the application object of the method excluding humans, the method comprising contacting the target nucleic acid with the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the vector system of claim 6, or the composition of claim 7, or the host cell of claim 8.

13. A method for cutting a target nucleic acid, the method is a method for non-disease diagnosis and treatment purposes, the application object of the method does not include humans, the method comprises contacting the target nucleic acid with the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the vector system of claim 6, or the composition of claim 7, or the host cell of claim 8.

14. A method for cutting a single-stranded nucleic acid, the method is for non-disease diagnosis and treatment purposes, the application object of the method does not include humans, the method comprises contacting a nucleic acid population with the Cas protein and gRNA according to claim 1, the gRNA comprises a direct repeat sequence capable of binding to the Cas protein according to claim 1 and a guide sequence capable of targeting a target sequence, wherein the nucleic acid population comprises a target nucleic acid and at least one non-target single-stranded nucleic acid, the gRNA is capable of targeting the target nucleic acid, and the Cas protein cuts the non-target single-stranded nucleic acid.

15. A kit for gene editing, gene targeting or gene cleavage, the kit comprising the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the vector system of claim 6, or the composition of claim 7, or the host cell of claim 8.

16. A kit for detecting a target nucleic acid in a sample, the kit comprising: (a) the Cas protein of claim 1, or a nucleic acid encoding the Cas protein; (b) gRNA, or a nucleic acid encoding the gRNA, or a precursor RNA comprising the gRNA, or a nucleic acid encoding the precursor RNA, the gRNA comprising a direct repeat sequence capable of binding to the Cas protein of claim 1 and a guide sequence capable of targeting a target sequence; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize with the gRNA.

17. Use of the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the vector system of claim 6, or the composition of claim 7, or the host cell of claim 8 in the preparation of a preparation or a kit for: (i) gene or genome editing; (ii) target nucleic acid detection and / or diagnosis; (iii) Treatment of disease.

18. Use of the Cas protein according to claim 1, or the fusion protein according to claim 2, or the polynucleotide according to claim 3, or the vector according to claim 4, or the CRISPR-Cas system according to claim 5, or the vector system according to claim 6, or the composition according to claim 7, or the host cell according to claim 8 in preparing a preparation or a kit for: (i) editing a target sequence in a target locus to modify an organism; (ii) targeting target genes; (iii) Cutting the target gene.

19. A method for detecting a target nucleic acid in a sample, the method being a method for purposes other than disease diagnosis and treatment, the method being applicable to objects other than humans, the method comprising contacting the sample with the Cas protein, gRNA (guide RNA) and a single-stranded nucleic acid detector as described in claim 1, the gRNA comprising a region that binds to the Cas protein and a guide sequence that hybridizes with the target nucleic acid; detecting a detectable signal generated by the Cas protein cutting the single-stranded nucleic acid detector, thereby detecting the target nucleic acid; the single-stranded nucleic acid detector does not hybridize with the gRNA.

Images