A gene MsGRAS60 for regulating Miscanthus salt-alkali tolerance and its application

Abstract

The present invention discloses a gene MsGRAS60 for regulating Miscanthus salt-alkali tolerance, and the nucleotide sequence thereof is shown in SEQ ID No.1. The protein product expressed by MsGRAS60 is a Miscanthus GRAS transcription factor, and the amino acid sequence thereof is shown in SEQ ID No.2. The present invention transforms Arabidopsis thaliana to obtain transgenic Arabidopsis thaliana overexpressing the MsGRAS60 gene, and the germination rate and green seedling rate of the seeds thereof are significantly reduced under salt treatment, and the germination rate and fresh weight are significantly reduced under alkali treatment. At the same time, the overexpression of MsGRAS60 significantly reduces the sensitivity of the transgenic Arabidopsis thaliana to ABA. Under salt-alkali stress treatment, the transgenic Arabidopsis thaliana generally exhibits a typical salt-alkali sensitive phenotype of growth inhibition, indicating that the gene is an important key factor in regulating the salt-alkali tolerance of plants.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a gene GRAS60 regulating the salt-alkali tolerance of Miscanthus sinensis and an application thereof. Background Art

[0002] According to statistics, as of 2021, the global saline soil area has reached 424 million hectares, accounting for 3.9% of the land area. At the same time, the area of ​​saline soil has a tendency to increase further. According to relevant reports, the global saline-alkali land is increasing at a rate of 1-2 million hectares per year. In addition, due to environmental factors such as global warming and climate change, this number is expected to increase further in the next decade. At present, the management of saline-alkali land is mainly through some traditional physical methods, but they face various disadvantages such as high cost, time-consuming and labor-intensive, and environmentally unfriendly. Soil salinization has a great impact on agricultural production, thus seriously restricting economic development. Making full use of saline-alkali land through stress-resistant breeding is of great significance to increasing crop yields and solving the food crisis. How to improve the salt tolerance of saline-alkali crops, especially through various breeding technologies (such as molecular breeding) to improve the salt tolerance of plants has become a research hotspot in recent years.

[0003] Miscanthus sinensis is a perennial C4 plant with the advantages of high photosynthesis efficiency, high biomass, good stress tolerance and wide environmental adaptability. It has become one of the most promising bioenergy crops. Planting Miscanthus sinensis on saline soil is also of great significance in saline soil reclamation, emission reduction, carbon sequestration and carbon neutrality, and can provide sufficient raw materials for bioethanol production. However, the genetic improvement of Miscanthus sinensis lags far behind other crops, mainly due to its complex genetic background and the unclear molecular mechanism of salt stress tolerance. Discovering and functionally identifying key genes involved in plant salt stress response is a prerequisite for molecular breeding. Therefore, it is urgent to clarify the molecular mechanism of Miscanthus sinensis' high salt-alkali tolerance and provide effective theoretical guidance for obtaining transgenic plants with high salt-alkali tolerance.

[0004] GRAS is a plant-specific transcription factor named after the first three members GAI, RGA and SCR. The C-terminus of GRAS protein is highly conserved. Based on the conserved domain, GRAS family genes are divided into eight subfamilies, including SCL3, SHR, PAT1, LISCL, DELLA, SCR, LS and HAM. GRAS transcription factors play an important role in the development of plant rhizomes, the formation of meristems, gibberellin signal transduction, light signal transduction and other processes. At the same time, GRAS transcription factors are also involved in the regulation of plant abiotic stress responses, which has been confirmed in plants such as Arabidopsis, rice, tomato, poplar, rapeseed and soybean. Although GRAS genes play an important role in regulating plant development and abiotic stress tolerance, there are currently no reports on GRAS transcription factors in Miscanthus plants, especially in the study of Miscanthus GRAS salt tolerance. Therefore, cloning Miscanthus GRAS transcription factors and developing and utilizing new salt-tolerant genes will help to elucidate the molecular regulatory mechanism of halophytes' high salt-alkali tolerance, lay the foundation for the next step of breeding salt-tolerant Miscanthus varieties, and have important application value for the utilization of saline-alkali land and the improvement of agricultural comprehensive production capacity. Summary of the invention

[0005] Purpose of the invention: In view of the deficiencies in the prior art, the purpose of the present invention is to provide a Miscanthus gene MsGRAS60, which is a key gene for regulating Miscanthus's salt-alkali tolerance. The present invention discovered a GRAS gene MsGRAS60 whose expression was significantly upregulated under salt-alkali stress by transcriptome sequencing after salt stress, alkali stress, and mixed salt-alkali stress. After further quantitative PCR analysis, its expression level was significantly increased under salt-alkali stress. The cloning primers of MsGRAS60 were further designed, and the plant overexpression vector of MsGRAS60-OX was constructed. After transformation of Arabidopsis thaliana, hygromycin was used for screening. After breeding to obtain homozygotes, they were grown on 1 / 2 MS plates with different concentrations of salt (NaCl) or alkali (NaHCO3), and the salt-alkali tolerance phenotype was further observed. Another purpose of the present invention is to provide an application of the above-mentioned gene GRAS60 for regulating Miscanthus's salt-alkali tolerance.

[0006] Technical solution: In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention is as follows:

[0007] The present invention provides a Miscanthus salt-tolerance gene MsGRAS60, and the nucleotide sequence of the Miscanthus salt-tolerance gene MsGRAS60 is shown in SEQ ID NO.1.

[0008] The present invention also provides a method for obtaining the Miscanthus salt-tolerance gene MsGRAS60, the method comprising the following steps:

[0009] (1) Select young Miscanthus leaves to extract RNA;

[0010] (2) cDNA obtained by reverse transcription;

[0011] (3) Using the cDNA obtained by reverse transcription as a template, PCR amplification was performed using specific primers MsGRAS-F and MsGRAS-R, and the target fragment was recovered and purified. The sequences of the specific primers MsGRAS-F and MsGRAS-R are as follows:

[0012] MsGRAS60-F:5'-gtcgacacgtggatccATGGAGCCAGGCGCG-3'

[0013] MsGRAS60-R: 5'-cggccgcgccggatccGCGCCACGCGGAGGC-3'

[0014] (4) The purified PCR product was subjected to homologous recombination reaction with the pCAMBIA1301 vector fragment digested with BamH I. The correct single colonies after resistance screening and PCR verification were sequenced to construct the MsGRAS60 overexpression vector MsGRAS60-OX.

[0015] The present invention also provides the application of the Miscanthus salt-tolerance gene MsGRAS60 and the MsGRAS60 gene overexpression vector in the salt-alkali tolerance of Arabidopsis thaliana.

[0016] Compared with the prior art, the present invention has the following beneficial effects: the present invention uses transcriptome analysis combined with RT-qPCR technology to find that the MsGRAS60 gene, a member of the Miscanthus GRAS family, has significant changes in the salt stress response process ( Figure 1 ), the present invention cloned the Miscanthus MsGRAS60 gene, constructed the MsGRAS60 gene overexpression vector MsGRAS60-OX, and transformed Arabidopsis thaliana by Agrobacterium-mediated floral dipping method, thereby verifying the function of the Miscanthus salt-tolerance gene MsGRAS60. The results showed that the germination rate of Arabidopsis thaliana seeds overexpressing the MsGRAS60 gene was significantly reduced under saline-alkali treatment, that is, the salt-alkali tolerance of the plants overexpressing the MsGRAS60 gene was significantly reduced, indicating that the MsGRAS60 gene is a key regulatory factor for regulating plant salt-alkali tolerance. The present invention adopts the above technical solution to provide a system for the discovery and function verification of the Miscanthus salt-tolerance gene MsGRAS60, which will provide an important theoretical basis for the creation of salinity warning plants for saline-alkali land soils using genetic engineering technology, and for improving the salt tolerance of Miscanthus and the genetic improvement and innovation of germplasm.

[0017] Beneficial effect: Compared with the prior art, the advantages of the present application are: the present application discloses a gene MsGRAS60 for regulating the salt tolerance of Miscanthus, and the MsGRAS60 gene is transferred into Arabidopsis thaliana. The salt-alkali tolerance of Arabidopsis thaliana plants that overexpress the MsGRAS60 gene is significantly reduced, indicating that the MsGRAS60 gene is a key regulatory factor for regulating plant salt-alkali tolerance, and can be used for the breeding of soil salinity indicator plants, providing a theoretical research basis and gene sequence for the molecular mechanism of gene expression regulation of salt-alkali tolerance of Miscanthus, and has important application value in the field of salt-alkali tolerance breeding of energy plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Transcriptome and RT-qPCR techniques were used to analyze the expression of MsGRAS60 gene under saline-alkali stress (Control: control, Salt: salt stress, Alkali: alkaline stress, Salt+Alkali: salt-alkali mixed stress);

[0019] Figure 2 Seed germination of MsGRAS60-OX Arabidopsis and wild-type Arabidopsis under salt stress;

[0020] Figure 3 Green seedling rate of MsGRAS60-OX Arabidopsis and wild-type Arabidopsis seeds under salt stress;

[0021] Figure 4 Seed germination of MsGRAS60-OX Arabidopsis and wild-type Arabidopsis seeds under alkaline stress;

[0022] Figure 5 Comparison of fresh weight of seeds between MsGRAS60-OX Arabidopsis and wild-type Arabidopsis under alkaline stress;

[0023] Figure 6 The sensitivity of MsGRAS60-OX Arabidopsis and wild-type Arabidopsis seeds to ABA;

[0024] Figure 7 Green seedling rate of MsGRAS60-OX Arabidopsis and wild-type Arabidopsis seeds under ABA stress. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with specific examples. Molecular biology experimental methods not specifically described in the following examples can be performed with reference to the methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook or conventional methods in the art, or according to the kits and product instructions.

[0026] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0027] Example 1 Cloning of Miscanthus sinensis MsGRAS60 gene

[0028] 1. Extraction of Total RNA from Miscanthus sinensis

[0029] Young leaf tissues of Miscanthus sinensis were taken and ground in liquid nitrogen, and RNA was extracted using the Trizol method.

[0030] 2. Cloning of the MsGRAS60 gene

[0031] The extracted total RNA was used as a template to synthesize cDNA under the action of reverse transcriptase;

[0032] Based on the Miscanthus MsGRAS60 gene sequence searched in the Phytozome database, gene-specific primers MsGRAS60-F and MsGRAS60-R were designed. The gene encoding MsGRAS60 protein was amplified from cDNA by PCR and sequenced.

[0033] Further, the sequences of MsGRAS60-F and MsGRAS60-R are as follows:

[0034] MsGRAS60-F:5'- gtcgacacgtggatcc ATGGAGCCAGGCGCG-3'

[0035] MsGRAS60-R:5'- cggccgcgccggatcc GCGCCACGCGGAGGC-3'

[0036] Add vector homology arms (lowercase, underlined letters) to the 5' end of the primers

[0037] The sequencing results indicated that the MsGRAS60 gene was obtained, and its nucleotide sequence was shown in SEQ ID NO.1.

[0038] Example 2 Construction of the MsGRAS60 gene plant expression vector

[0039] The pCambia1301 vector was cut into linearized fragments by BamH I, and the MsGRAS60 gene obtained by PCR amplification was connected to the pCambia1301 linearized vector by homologous recombination technology to obtain the plant expression vector MsGRAS60-OX. The constitutive strong expression promoter 35S was assembled at the 5′ end of the MsGRAS60 gene, which can enable the MsGRAS60 gene to be efficiently expressed in Arabidopsis; the HYG gene expression cassette was assembled on the vector plasmid as a transgenic screening marker, and hygromycin can be used to screen transgenic plants. PCR detection and sequencing verification confirmed that the overexpression vector was successfully constructed and named MsGRAS60-OX. The MsGRAS60 gene is located after the promoter 35S. Driven by the promoter 35S, MsGRAS60 can be overexpressed in plants.

[0040] Furthermore, the PCR was used to verify whether the vector was successfully constructed. The primers were designed based on the 35S promoter region (forward primer) and the MsGRAS60 fragment sequence (reverse primer) upstream of the target gene. The primer sequences used were as follows:

[0041] MsGRAS60-35S-F:ATCCTTCGCAAGACCCTTCC

[0042] MsGRAS60-GRAS-R: TATCGTCTCCTCCCACTCGG.

[0043] Example 3 Obtaining Arabidopsis thaliana transgenic with MsGRAS60-OX

[0044] 1. Obtaining Agrobacterium tumefaciens containing MsGRAS60 overexpression vector

[0045] The plant expression vector MsGRAS60-OX obtained in Example 2 was transformed into Agrobacterium GV3101 competent cells by electroporation, and the cells were spread on LB resistance plates containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured in an incubator at 28°C and 220 rpm for 20 hours. The grown Agrobacterium single colonies were picked and identified by PCR (the primers used were MsGRAS60-35S-F and MsGRAS60-GRAS-R), and the positive single clones were selected for the next step.

[0046] 2. Agrobacterium-mediated transformation of MsGRAS60-OX gene into Arabidopsis

[0047] The positive Agrobacterium single colony was inoculated into a YEB resistance culture liquid containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured at 28°C and 220 rpm for 20 hours. 1 mL of the bacterial liquid was inoculated into 300 mL of LB resistance culture liquid containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured at 28°C and 220 rpm until OD = 0.7. After the culture was completed, the bacterial cells were collected by centrifugation at 5000 rpm for 15 minutes, and the liquid was dissolved in 300 mL of 1 / 2 MS infection liquid containing 5% sucrose, and the liquid was slowly shaken. The wild-type Arabidopsis thaliana that had been depodded was inverted in a beaker for infection to obtain transgenic Arabidopsis thaliana overexpressing the MsGRAS60 gene.

[0048] Example 4 PCR detection of regenerated transgenic Miscanthus plants

[0049] The MsGRAS60 transgenic Arabidopsis thaliana that had been screened for resistance was used to extract the transgenic Arabidopsis thaliana leaf DNA using the CTAB method. When the designed PCR specific primers MsGRAS60-35S-F and MsGRAS60-GRAS-R were used for amplification, specific DNA fragments were amplified, while no fragments were amplified when the non-transformed Arabidopsis thaliana genomic DNA was used as a template, indicating that positive Arabidopsis thaliana seedlings transformed with MsGRAS60-OX had been obtained.

[0050] Example 5 Analysis of salt tolerance phenotype of MsGRAS60-OX transgenic Arabidopsis

[0051] The homozygous positive Arabidopsis seeds obtained by screening were tested for germination rate and plant phenotype observation on 1 / 2 MS solid medium containing different concentrations of NaCl. The present invention compares the growth of transgenic Arabidopsis thaliana overexpressing MsGRAS60 and wild type on 1 / 2 MS solid medium containing 0mM, 100mM and 150mM NaCl. Figure 2 Figure 2 is for the 7-day growth period. Under salt stress, the growth of MsGRAS60-OX transgenic plants was significantly weaker, and the green seedling rate of MsGRAS60-OX transgenic plants was significantly lower than that of the control ( Figure 3 ).

[0052] Example 6 Analysis of the alkali-tolerance phenotype of MsGRAS60-OX transgenic Arabidopsis

[0053] The homozygous positive Arabidopsis seeds obtained by screening were tested for germination rate and plant phenotype observation on 1 / 2 MS solid medium containing different concentrations of NaHCO3. The present invention compares the growth of transgenic Arabidopsis thaliana overexpressing MsGRAS60 and wild type on 1 / 2MS solid medium containing 0mM, 8mM and 10mM NaHCO3. Figure 4Figure 2 is the result of 7-day growth. Under alkaline stress, the growth of MsGRAS60-OX transgenic plants was significantly weaker, and the fresh weight of MsGRAS60-OX transgenic plants was significantly lower than that of the control ( Figure 5 ).

[0054] Example 7 Analysis of sensitivity of MsGRAS60-OX-transgenic Arabidopsis to ABA

[0055] In order to verify whether the tolerance of MsGRAS60 transgenic lines to saline-alkali stress is related to changes in ABA sensitivity, the green seedling rates of wild type and two Arabidopsis MsGRAS60-OX overexpression lines under 0.5 and 1.0 μM ABA treatment were statistically analyzed. Under normal growth conditions, there was no significant difference in seed germination rate between the overexpression lines and the wild type. When treated with 0.5 and 1.0 μM ABA, the germination rate of the overexpression lines was significantly higher than that of the wild type ( Figure 6 The green seedling rates of wild type and two Arabidopsis MsGRAS60-OX overexpression lines under 0.5 and 1.0 μM ABA treatment were counted. Under normal growth conditions, there was no significant difference in the green seedling rate of cotyledons between the overexpression lines and the wild type. When treated with 0.5 and 1.0 μM ABA, the green seedling rate of cotyledons of the overexpression plants was significantly higher than that of the wild type ( Figure 7 ), indicating that MsGRAS60 overexpression reduced ABA sensitivity in transgenic Arabidopsis.

[0056] In summary, it can be clearly concluded from the embodiments of the present invention that overexpression of the MsGRAS60 gene causes a salt-alkali sensitive phenotype in Arabidopsis thaliana, and the salt-alkali tolerance of transgenic Arabidopsis thaliana is significantly reduced, indicating that the MsGRAS60 gene is a key factor in regulating plant salt-alkali tolerance, and MsGRAS60 and its overexpression technology can be used as an efficient molecular tool to accelerate the process of plant salt-alkali tolerance breeding.

[0057] The above description is only illustrative rather than restrictive of the present invention. Those skilled in the art will understand that many modifications, changes or equivalents may be made without departing from the spirit and scope defined by the appended claims, but all will fall within the scope of protection of the present invention.

Claims

1. Application of a vector for overexpressing and regulating the Miscanthus salt-alkali tolerance gene MsGRAS60 in reducing the salt tolerance of Arabidopsis thaliana, wherein the nucleotide sequence of the gene MsGRAS60 is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The amino acid sequence of the gene MsGRAS60 is shown in SEQ ID No.

2.

3. The use according to claim 1, characterized in that: The method for cloning the MsGRAS60 gene is to use the cDNA of young leaves of Miscanthus as a template, use primers MsGRAS60-F and MsGRAS60-R to perform PCR amplification to obtain the full-length fragment of MsGRAS60, construct a plant overexpression vector of MsGRAS60 driven by the 35S promoter, use it for genetic transformation of Arabidopsis thaliana, and analyze and identify the salt-alkali tolerance of transgenic Arabidopsis thaliana; The sequences of the primers MsGRAS60-F and MsGRAS60-R are as follows: MsGRAS60-F:5'-gtcgacacgtggatccATGGAGCCAGGCGCG-3' MsGRAS60-R: 5'-cggccgcgccggatccGCGCCACGCGAGGC-3'.

4. The use according to claim 1, characterized in that: The vector incorporates the promoter 35S at the 5' end of the MsGRAS60 gene.

5. Application of a vector for overexpressing and regulating the Miscanthus salt-alkali tolerance gene MsGRAS60 in reducing the alkali tolerance of Arabidopsis thaliana, characterized in that: The nucleotide sequence of the gene MsGRAS60 is shown in SEQ ID No.

1.

6. Application of the vector overexpressing the Miscanthus salt-alkali tolerance gene MsGRAS60 in reducing the sensitivity of transgenic Arabidopsis thaliana to ABA.

Images