A crude oil pollution degradation strain and its application

Abstract

The present invention relates to a crude oil pollution degradation strain and its application, the strain is classified and named as Acinetobacter ( Acinetobacter haemolyticus )JS‑1, with the accession number of CCTCC M 20221600. This strain has the characteristics of short growth cycle, large biomass, wide temperature tolerance range, high crude oil degradation efficiency, and high crude oil concentration tolerance. It has a significant degradation efficiency for normal alkanes, a component of crude oil, and can be used to degrade petroleum pollutants in water and soil. Strain JS‑1 can tolerate high-salinity environments and adapt to marine environments, and has good application prospects in marine oil pollution control.

Description

Technical Field

[0001] The invention belongs to the field of petroleum degradation, and specifically relates to a crude oil pollution degradation bacterial strain and application thereof. Background Art

[0002] Petroleum is an important industrial raw material and can be widely used in chemical, energy, materials and other fields. Accidental leakage of crude oil during mining and transportation can cause serious pollution to soil and water. In recent years, with the continuous increase in oil demand, oil leakage accidents have occurred frequently at home and abroad. Accidental leakage of oil will not only affect economic development, but also damage the ecological environment. Since the components of oil are complex and difficult to degrade, and are harmful to human health, environmental remediation of oil pollution needs to be urgently addressed. The remediation methods of oil pollution are divided into chemical remediation, physical remediation and biological remediation. Physical remediation refers to the use of soil replacement, extraction and elution techniques to remove or convert pollutants into harmless forms, but the remediation cost is high and pollutants cannot be effectively removed. Chemical remediation is the use of chemical methods such as chemical oxidation and photocatalytic degradation to decompose pollutants into non-toxic small molecular compounds, but the remediation process causes secondary pollution and destroys soil structure. Bioremediation refers to the use of microorganisms to remove or degrade petroleum hydrocarbons in soil and water to achieve the purpose of repairing oil-contaminated areas. Because of its high oil removal rate and environmental friendliness, it is the research focus of oil bioremediation.

[0003] There are more than 200 species of microorganisms in nature that can be used to degrade oil. Among them, bacteria have a better ability to degrade crude oil than fungi and actinomycetes. Common crude oil degrading bacteria include Pseudomonas ( Pseudomonas ), Bacillus ( Bacillus ), Arthrobacter spp. Arthrobacter ), Acinetobacter spp. Acinetobacter ) Flavobacterium Flavobacterium ), Corynebacterium ( Corynebacterium ), Achromobacterium ( Achromobacter ), Vibrio spp. Vibrio )、Sphingobacillus ( Sphingobacterium ), Serratia spp. Serratia) etc. Under normal circumstances, the temperature of the oil pollutant site is 10-45℃. In low temperature environment, oil pollutants will reduce cell viability, inhibit cell metabolism, and have poor bioremediation effect. It is necessary to obtain efficient low-temperature hydrocarbon degradation strains through screening, improvement, and cultivation to solve this problem. Acinetobacter bacteria are widely present in nature. They can not only grow and reproduce in low-temperature, humid or dry environments, but also grow in water bodies. They are dominant bacteria in soil and marine environments. For example, the crude oil degrading bacteria H9-3 isolated from crude oil contaminated soil in Northeast China can remove 36.8% of crude oil with an initial concentration of 10 g / L within 21 days. The calcium acetate Acinetobacter P1-1A screened by Moshtagh, B. et al. can effectively degrade 68.17% of crude oil. Marine crude oil degrading bacteria HB-1 can degrade 54.74% of crude oil within 6 days. However, the strains reported so far are mainly used to degrade low-concentration crude oil. The degradation effect on high-concentration crude oil is not very significant, and the degradation cycle is relatively long. Therefore, screening and obtaining strains that are resistant to low temperatures and can degrade high-concentration crude oil for the remediation of crude oil contaminated sites is the focus of current research. Summary of the invention

[0004] The first object of the present invention is to provide a crude oil pollution-degrading bacterial strain.

[0005] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0006] A crude oil pollution degradation strain is classified and named Acinetobacter haemolyticus JS-1, and the preservation number is CCTCC M 20221600.

[0007] As a preferred embodiment, the 16S rDNA sequence of the strain is shown as SEQ ID NO.1.

[0008] The strain has a good degradation effect (74.13%) on high-concentration crude oil (15 g / L) and can degrade n C12- n C31 normal alkanes, especially medium- and long-chain normal alkanes ( n C15- n C31) has a good degradation effect, and the strain has a wide range of environmental adaptability, can efficiently utilize inorganic nitrogen, is resistant to low temperature and high salt, and is suitable for applications in degrading petroleum pollution.

[0009] The strain can grow at temperatures of 15-40°C, pH 6-9, salinity of 0-40 g / L, and crude oil concentration of 1-20 g / L. The optimal growth conditions are 30°C, pH 7, salinity of 10 g / L, sodium nitrate as the nitrogen source, and crude oil concentration of 10 g / L.

[0010] The second object of the present invention is to provide the use of the above-mentioned strain in the degradation of crude oil pollution.

[0011] As a preferred embodiment, the seed liquid of the strain is inoculated into crude oil to form a crude oil degradation system for crude oil degradation.

[0012] As a preferred embodiment, the inoculation amount of the seed solution is 1-3% v / v.

[0013] As a preferred embodiment, the crude oil concentration is 5-20 g / L.

[0014] As a preferred embodiment, the temperature for crude oil degradation is 15-40°C.

[0015] As a preferred embodiment, the pH of crude oil degradation is 5-9.

[0016] As a preferred embodiment, sodium succinate, sodium citrate or sodium acetate is added to the crude oil degradation system as a cometabolism substrate.

[0017] As a preferred embodiment, the concentration of the co-metabolism substrate added is 3 g / L.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] (1) The Acinetobacter JS-1 in the present invention has a significant degradation effect on high-concentration crude oil. The degradation rates of 10 g / L and 15 g / L oil within 15 days are both higher than 74%. It is superior to other reported Acinetobacter strains in terms of tolerance to high crude oil concentrations and high crude oil degradation efficiency.

[0020] (2) The Acinetobacter JS-1 of the present invention can tolerate low temperature and high salt environment, and can be used to degrade high-concentration crude oil under artificial seawater conditions. When the initial crude oil concentration in artificial seawater is 10 g / L, the degradation effect of Acinetobacter JS-1 on crude oil is the best, and the average degradation rate on the 15th day is 80.2%. Within 15 days, Acinetobacter JS-1 also has a good degradation effect on 20 g / L high-concentration crude oil, and the degradation rate reaches 61.76%, which has important application potential for the efficient degradation of marine crude oil pollution.

[0021] (3) The addition of the co-metabolism substrates sodium succinate, sodium citrate, sodium acetate, and ethanol can significantly improve the degradation of petroleum by strain JS-1. The degradation rate of 10 g / L petroleum was higher than 75% within 9 days. Considering the cost of the co-metabolism substrate, cheap sodium acetate was preferred as the co-metabolism substrate for petroleum degradation. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1The colony morphology and transmission electron microscopy image of strain JS-1.

[0023] Figure 2 This is the phylogenetic tree of strain JS-1.

[0024] Figure 3 The effect of carbon source on the growth of strain JS-1.

[0025] Figure 4 The effect of nitrogen source on the growth of strain JS-1.

[0026] Figure 5 The effect of pH on the growth of strain JS-1.

[0027] Figure 6 The effect of temperature on the growth of strain JS-1.

[0028] Figure 7 This is the effect of NaCl concentration on the growth of strain JS-1.

[0029] Figure 8 The biomass of strain JS-1 and its degradation rate of crude oil at different concentrations.

[0030] Fig. 9 GC-MS chromatograms of the n-alkanes and aromatic hydrocarbons of crude oil (10 g / L) before and after degradation by strain JS-1.

[0031] Fig.10 The biomass of strain JS-1 in artificial seawater medium and its degradation rate of crude oil at different concentrations.

[0032] Fig.11 To investigate the effect of adding co-metabolism substrates on the degradation of crude oil by strain JS-1.

[0033] The biomaterial of the present invention is classified as Acinetobacter haemolyticus JS-1 was deposited in the China Center for Type Culture Collection (CCTCC) on October 19, 2022, with the accession number CCTCC M 20221600, and the deposit address is Wuhan, China. DETAILED DESCRIPTION

[0034] The reagents and culture medium formula used in the embodiment are as follows:

[0035] LB liquid medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L.

[0036] LB solid medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, agar 20 g / L.

[0037] BSM medium: (NH4)2SO42 g / L, NaCl 10 g / L, CaCl20.1 g / L, K2HPO42.8 g / L, KH2PO40.5 g / L, MgSO40.1 g / L, FeSO40.01 g / L, yeast powder 0.1 g / L.

[0038] Crude oil degradation culture medium: NaNO32 g / L, NaCl 10 g / L, CaCl20.1 g / L, K2HPO42.8 g / L, KH2PO40.5 g / L, MgSO40.1 g / L, FeSO40.01 g / L.

[0039] Artificial synthetic seawater culture medium: NaCl 24 g / L, KCl 0.7 g / L, MgSO4·7H2O 0.7 g / L, NH4NO3 1g / L, KH2PO4 2g / L, Na2HPO4·12H2O 3 g / L, trace element mixture 2% (v / v);

[0040] Trace element mixture: MgSO4·7 H2O 4 g / L, CuSO4·5 H2O 1 g / L, MnSO4·H2O 1 g / L, FeSO4·7H2O 1 g / L, CaCl21 g / L.

[0041] Example 1

[0042] This example illustrates the acquisition, isolation and purification of crude oil degrading strain JS-1.

[0043] (1) Strain source: Crude oil-degrading bacteria were isolated from crude oil-contaminated soil in Jiangsu Oilfield.

[0044] (2) Enrichment of strains: Weigh 0.05 g of oily soil and add it to 50 mL of BSM medium. Use 1 g / L crude oil as the sole carbon source and culture it at 30°C in a constant temperature shaker at 200 rpm for 5 days. Take 5 mL of the culture medium from the previous step and transfer it to sterile BSM medium containing 1 g / L crude oil. Culture it under the same conditions for 5 days. Repeat three times.

[0045] (3) Purification of strains: After the culture is completed, a certain amount of the enriched culture medium is taken out, diluted with sterile water to an appropriate multiple, and spread on LB solid culture medium. After culturing at 30°C for 20 h, a single colony is picked and inoculated into LB liquid culture medium. After culturing in a constant temperature shaker at 30°C and 200 rpm for 12 h, it is stored in a -80°C refrigerator with glycerol cryopreservative solution for later use.

[0046] Example 2

[0047] This example illustrates the morphology and 16S rDNA sequence identification of the crude oil degrading strain JS-1.

[0048] (1) Observation of strain morphology: The strain JS-1 was inoculated on LB solid medium and cultured in a 37°C constant temperature shaker for 12 h. The growth morphology of the colonies was observed and recorded (e.g. Figure 1 (As shown in (A)). Use a sterile toothpick to pick up a single JS-1 colony and place it in a sterile water drop. After the bacteria are free, place the copper mesh upside down on the sterile water drop to precipitate for 1 min. After absorbing the floating liquid with filter paper, add 10 μL of 50-fold diluted phosphotungstic acid (PTA) to the copper mesh to precipitate for 1 min, and absorb the floating liquid with filter paper. Use JEOL JEM-1400Plus transmission electron microscope at 4.80 kV to observe the morphology of single colonies (as shown in Figure 1 As shown in (B). Figure 1 As shown in (A), strain JS-1 appears as round, light yellow, opaque, smooth colonies on LB solid agar plates. Transmission electron microscopy showed that strain JS-1 was short rod-shaped, about 0.125×0.99 μm in size, and had flagella.

[0049] (2) Identification of strain 16S rDNA sequence: The whole genome of strain JS-1 was extracted using a bacterial genome extraction kit (Biotech Biotechnology), and the genome of JS-1 was amplified by PCR using bacterial universal 16S rDNA universal primers (upstream primer (P1, 27F): 5'AGAGTTTGATCCTGGCTCAG3' downstream primer (P2, 1492R): 5'TACGGCTACCTTGTTACGACTT3' sequence).

[0050] The reaction conditions were as follows: PCR reaction system: ddH2O 20 µL, high-fidelity enzyme mixture 25 µL, primer P1 2 µL, primer P2 2 µL, DNA template 2 µL. PCR program: 95°C pre-denaturation, 5 min; 30 cycles of reaction: 94°C denaturation 45 s, 56°C annealing 30 s, 72°C extension 60 s, 72°C incubation 10 min, and finally 4°C storage.

[0051] The PCR product was purified by the kit and sent to Anhui General Biological Company for sequencing. The sequencing result is shown in SEQ ID NO.1. The sequence of SEQ ID NO.1 was submitted to the NCBI database for sequence similarity comparison and found to be similar to hemolytic globulin. Acinetobacterhaemolyticus ATCC 17906 (GenBank accession number: NR_117622.1) had a sequence similarity of 98%, and the phylogenetic tree of strain JS-1 was constructed using MEGA software, as shown in Figure 2Therefore, the strain JS-1 was identified as belonging to the genus Acinetobacter and was named Acinetobacter JS-1 ( Acinetobacter haemolyticus JS-1).

[0052] Note: ATCC 17906 was selected as the comparison standard based on the recognition of the reputation of ATCC strain identification and its availability. Although other strains have homology as high as 99%, the strain availability is not strong and the accuracy of the strain identification itself is difficult to guarantee.

[0053] Example 3

[0054] This example illustrates the effects of carbon and nitrogen sources and environmental factors on the growth characteristics of Acinetobacter JS-1.

[0055] (1) Carbon source utilization by Acinetobacter JS-1

[0056] Pick a single colony of JS-1 and inoculate it into LB liquid medium, and culture it at 30℃ and 200 rpm for 12 h to obtain seed liquid. Take 1 mL of seed liquid and inoculate it into 50 mL of BSM medium, add 5 g / L of sucrose, xylose, fructose, glucose, glycerol, ethanol, edible oil, n-hexane, n-octane, n-decane, dodecane, tetradecane, hexadecane, octadecane, docosane, and hexadecane as carbon sources, place it in a constant temperature shaker at 30℃ and culture it at 200 rpm, and take samples every 24 h to measure the strain OD 600 The experimental results are as follows Figure 3 As shown, when soybean oil is used as a carbon source, the OD value of strain JS-1 is the highest, about 4.5. Strain JS-1 cannot grow using hydrophilic carbon sources such as sugars, such as sucrose, xylose, fructose, glucose and glycerol. Strain JS-1 can grow using hydrophobic alkanes as a carbon source, and prefers medium- and long-chain alkanes, such as dodecane, tetradecane, hexadecane, octadecane, etc.

[0057] (2) Nitrogen source utilization by Acinetobacter JS-1

[0058] Pick a single colony of JS-1 and inoculate it into LB liquid medium. Cultivate it at 30℃ and 200 rpm for 12 h to obtain seed solution. Take 1 mL of seed solution and inoculate it into 50 mL of BSM medium containing 5 g / L hexadecane as carbon source. Add 2 g / L of ammonium chloride, sodium nitrate, urea, and peptone as nitrogen source. Place it in a constant temperature shaker at 30℃ and culture at 200 rpm. Take samples every 12 h to measure the strain OD. 600 The experimental results are as follows Figure 4 As shown, strain JS-1 was able to grow using ammonium chloride, sodium nitrate, urea, and peptone as nitrogen sources, among which sodium nitrate was the best nitrogen source.

[0059] (3) Growth of Acinetobacter JS-1 under different initial pH conditions

[0060] 1 mL of seed solution was inoculated into 50 mL of BSM medium containing 5 g / L hexadecane as a carbon source and 2 g / L sodium nitrate as a nitrogen source. The initial pH value of the medium was adjusted to 5-9 using NaOH and hydrochloric acid, respectively. The medium was placed in a constant temperature shaker at 30°C and cultured at 200 rpm. Samples were taken every 24 h to measure the strain OD. 600 The experimental results are as follows Figure 5 As shown in the figure, strain JS-1 can grow under the initial pH conditions of 5-9. When pH=8-9, the growth of strain JS-1 is almost unaffected. Under weakly acidic conditions such as pH 5, the OD value of the strain decreases slightly, but can still reach about 4 after 3 days. Therefore, strain JS-1 can grow under a wide range of pH values ​​(5-9) using hexadecane as a carbon source, and alkaline conditions have little effect on the growth metabolism of the strain.

[0061] (4) Growth of Acinetobacter JS-1 under different temperature conditions

[0062] 1 mL of seed solution was inoculated into 50 mL of BSM medium (pH = 7) containing 5 g / L hexadecane and 2 g / L sodium nitrate, and cultured in a constant temperature shaker at 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, and 45°C, respectively. Samples were taken every 24 h to measure the strain OD 600 The experimental results are as follows Figure 6 As shown in the figure, strain JS-1 can use n-hexadecane as a carbon source to grow at 15-40°C, and its OD value can reach above 3. When the temperature reaches 45°C, the growth of the strain is significantly inhibited. Therefore, strain JS-1 has a wide range of temperature adaptability, can metabolize n-hexadecane at 15-40°C, and has a wide range of applications.

[0063] (5) Growth of Acinetobacter JS-1 at different salt concentrations

[0064] 1 mL of seed solution was inoculated into 50 mL of BSM medium (pH = 7) containing 5 g / L hexadecane and 2 g / L sodium nitrate. The NaCl concentration of the medium was adjusted to 0-50 g / L, respectively. The medium was placed in a constant temperature shaker at 30°C and cultured at 200 rpm. Samples were taken every 24 h to measure the strain OD 600 The experimental results are as follows Figure 7 As shown in Figure 2, when the salt concentration was less than 40 g / L, the growth of strain JS-1 was almost unaffected, and the OD 600 When the salt concentration reached 50 g / L, the growth of the strain was significantly inhibited.

[0065] Example 4

[0066] This example illustrates the degradation characteristics of crude oil by Acinetobacter JS-1.

[0067] (1) Degradation of crude oil at different concentrations by Acinetobacter JS-1

[0068] The crude oil components contain approximately 37.47% saturated hydrocarbons, 30.08% aromatic hydrocarbons, 23.35% colloids, and 2.46% asphaltenes.

[0069] Pick a single colony of JS-1 and inoculate it into LB liquid medium. Culture it at 30℃ and 200 rpm for 12 h to obtain seed liquid. Take 1 mL of seed liquid and inoculate it into 50 mL of crude oil degradation medium. Add different concentrations of crude oil (1, 3, 5, 10, 15, 20 g / L) as carbon source. Carry out crude oil degradation experiment at 30℃, pH 7, 10 g / L NaCl concentration. Take samples and measure strain biomass after 15 days of degradation. Analysis of crude oil degradation rate: The culture solution was extracted twice with an equal volume of petroleum ether (boiling range of 60-90℃). After extraction, the organic phases were combined, 1 mL was taken and diluted appropriately, and the absorbance was measured at 225 nm. The uninoculated sample was used as a blank control. The crude oil degradation rate was calculated according to the following formula:

[0070]

[0071] Among them, A0 is the absorbance value of the control group at 225 nm; A1 is the absorbance value of the sample after crude oil degradation at 225 nm.

[0072] The results are as follows Figure 8 As shown in the figure, strain JS-1 can degrade crude oil. With the increase of crude oil concentration, the growth amount and crude oil degradation rate of strain JS-1 are significantly improved. When the crude oil concentration is 10-20g / L, the crude oil degradation rate of strain JS-1 can reach 70-80% within 15 days. Among them, strain JS-1 can degrade about 74.1% of crude oil (15 g / L) within 15 days, which has a clear advantage among the currently reported Acinetobacter that can degrade crude oil.

[0073] (2) Degradation of different components of crude oil by Acinetobacter JS-1

[0074] According to the petroleum and natural gas industry standard SY / T 5119-2008 of the People's Republic of China, crude oil samples before and after degradation were separated. The saturated hydrocarbons and aromatic hydrocarbon components in the crude oil were eluted out in turn through a silica alumina chromatography column using solvents of different polarities. After the solvent was evaporated, the saturated hydrocarbons and aromatic hydrocarbon components were determined using a 6890-5975C gas chromatography-mass spectrometer (GC-MS). The GC-MS conditions were set according to the Chinese standard GB / T 18606-2001, with squalane and deuterated dibenzothiophene as internal standards, and the chromatographic conditions were as follows:

[0075] n-Alkanes: The chromatographic column was an HP-5 MS silica capillary column (60 m×0.25 mm×0.25 μm), the carrier gas was He; the flow rate was 1 mL / L; the injection port temperature was 290°C; the injection volume was 1 μL; the temperature program was: 50°C for 1 min, then increased to 120°C at 20°C / min, then increased to 250°C at 4°C / min, then increased to 310°C at 3°C / min, and maintained for 30 min.

[0076] PAHs: The chromatographic column was an HP-5 MS silica capillary column (60 m×0.25 mm×0.25 μm), the carrier gas was He; the flow rate was 1 mL / L; the injection port temperature was 290°C; the injection volume was 1 μL; the heating program was: 50°C for 1 min, then increased to 120°C at 15°C / min, then increased to 300°C at 3°C / min, and maintained for 30 min.

[0077] Degradation profile Fig. 9 After 15 days of degradation experiment, compared with the control group ( Fig. 9 Compared with (A), the saturated alkane components were significantly reduced after degradation. The strain JS-1 degraded almost all the saturated alkane components, indicating that the strain JS-1 has obvious advantages in the degradation of saturated alkanes in crude oil. Fig. 9 As can be seen from (B) and (D), strain JS-1 can also degrade some aromatic components, and also significantly degrades homologues of naphthalene and anthracene. These results indicate that strain JS-1 can preferentially degrade saturated alkanes and aromatic hydrocarbons in crude oil components.

[0078] Example 5

[0079] This example illustrates the degradation characteristics of Acinetobacter JS-1 on petroleum of different concentrations in artificial seawater culture medium.

[0080] In view of the good salt resistance, low temperature resistance and excellent crude oil degradation ability of strain JS-1, it may be used in marine crude oil bioremediation; therefore, the seawater environment was artificially simulated to examine the ability of strain JS-1 to degrade crude oil in seawater.

[0081] A single colony of JS-1 was selected and inoculated into LB liquid medium, and cultured at 30°C and 200 rpm for 12 h to obtain seed solution. 1 mL of seed solution was inoculated into 50 mL of artificial synthetic seawater medium, and different concentrations of crude oil (5, 10, 20 g / L) were added as carbon sources. Crude oil degradation experiments were carried out at 30°C and pH 7.4. Sampling was performed at different times to measure strain biomass and oil degradation rate. The experimental results are shown in Figure 2. Fig.10 As shown, Acinetobacter JS-1 can efficiently degrade crude oil in artificial seawater culture medium, with the highest degradation rate for 10 g / L crude oil, and the degradation rate can reach 80% after 12 days of degradation, which has obvious advantages among the Acinetobacter that have been reported to be able to degrade crude oil.

[0082] Example 6

[0083] This example illustrates that the addition of co-metabolism substrates can promote the degradation of petroleum by Acinetobacter JS-1.

[0084] A single colony of JS-1 was picked and inoculated into LB liquid medium, and cultured at 30°C and 200 rpm for 12 h to obtain seed solution. 1 mL of seed solution was inoculated into 50 mL of crude oil degradation medium containing 10 g / L crude oil, and 3 g / L of sodium succinate, sodium citrate, sodium acetate, and ethanol were added as co-metabolism carbon sources. Crude oil degradation experiments were carried out at 30°C, pH 7, and 10 g / L NaCl concentration. Samples were taken at different times to measure the oil degradation rate. The experimental results are shown in Figure 2. Fig.11 As shown in the figure, the addition of sodium succinate, sodium citrate, sodium acetate and ethanol as co-metabolism substrates can promote the degradation of crude oil by strain JS-1. After 9 days of degradation, the crude oil degradation rate can reach more than 75%, among which the effect of adding sodium citrate is the most obvious, and the crude oil degradation rate reaches 90.6%. Considering the cost factor of co-metabolism substrate, cheap sodium acetate is preferred as the co-metabolism substrate; after adding 3g / L sodium acetate, the degradation rate of crude oil by Acinetobacter JS-1 can be increased by more than 40%, and the crude oil degradation rate reaches 82.7% after 9 days of degradation.

Claims

1. A crude oil pollution degradation strain, characterized in that: Its classification name is Acinetobacter Acinetobacter haemolyticus ) JS-1, the accession number is CCTCC M 20221600.

2. The strain according to claim 1, characterized in that Its 16S rDNA sequence is shown in SEQ ID NO.

1.

3. Use of the strain according to claim 1 in the degradation of crude oil pollution.

4. The use according to claim 3, characterized in that: The seed liquid of the strain is inoculated into crude oil to form a crude oil degradation system for crude oil degradation.

5. The use according to claim 3 or 4, characterized in that: The inoculum concentration of the seed solution is 1-3% v / v.

6. The use according to claim 3 or 4, characterized in that: The crude oil concentration is 5-20g / L.

7. The use according to claim 3 or 4, characterized in that: The temperature at which crude oil degrades is 15-40°C.

8. The use according to claim 3 or 4, characterized in that: The pH for crude oil degradation is 5-9.

9. The use according to claim 4, characterized in that: Sodium succinate, sodium citrate or sodium acetate is added into the crude oil degradation system as a cometabolism substrate.

10. The use according to claim 9, characterized in that: The concentration of co-metabolism substrate added was 3 g / L.

Images