A method for constructing an engineered bacterium and its application

Abstract

The present application discloses a method for constructing an engineered bacterium and its application. The construction method comprises the following steps: introducing DNA fragment I into a host strain to obtain the engineered bacterium; the DNA fragment I comprises, from upstream to bottom, a promoter, a fusion gene, and a terminator; the fusion gene comprises, from upstream to bottom, a TPS gene, a gene encoding a connecting peptide I, and a LPPS gene; the host strain is selected from any one of Saccharomyces cerevisiae. The construction method optimizes the sclareol synthase of the host strain, which is beneficial to improving the yield of sclareol.

Description

Technical Field

[0001] The invention belongs to the field of microbial metabolic engineering and industrial biotechnology, and relates to a method for constructing engineering bacteria and application thereof. Background Art

[0002] Sclareol, also known as sclareol, is a tertiary alcohol of the hemiaran type diterpenoid. It was originally extracted from the labiata spice plant Salvia sclarea of ​​the genus Salvia and got its name from it. Sclareol is the most common raw material for the synthesis of ambergris, a substitute for ambergris. Ambergris is a waxy substance secreted by sperm whales. Since ancient times, it has been used as a fixed component of high-end perfumes because of its musk and sweet earthy smell. However, the endangered status of sperm whales has made ambergris precious and non-renewable. Therefore, the synthesis of ambergris using sclareol has become the main method for the perfume industry to produce natural ambergris substitutes. Sclareol also has important biological activity in medicine and pesticides. For example, sclareol has strong antibacterial activity and plays a role in fungal growth regulation and plant growth inhibition. It is also cytotoxic to human leukemia cells (Dimas et al., Leuk Res, 1999, 23: 217-234), tumor cell lines (Mahaira et al., Eur J Pharmacol, 2011, 666: 173-182), colon cancer cells and xenografts (Dimas et al., Apoptosis, 2007, 12: 685-694; Mahaira et al., Eur J Pharmacol, 2011, 666: 173-182). Recently, a study used sclareol and sclareol lactone as raw materials, combined biocatalysis with free radical reactions, and successfully synthesized eight oxidized mixed-source terpene natural products and one analogue, indicating that sclareol is also crucial for the synthesis of mixed-source terpene natural products (Li et al., Nat. Chem., 2020, 12: 173-179).

[0003] At present, the production of sclareol is mostly based on sclareol extract extracted from the inflorescence and stems and leaves of the plant sclareol. According to the AFNOR directive (NFT75-255) and industrial level, the essential oil obtained from 1000kg of dry plants contains 20-260g of sclareol, that is, the sclareol yield is 0.002%-0.026%. The growth cycle of the plant sclareol is long, and it is limited by the influence of land, environment and climate factors, and cannot fully meet the needs of industrial production. Microorganisms are a very ideal "cell factory" with advantages such as short growth cycle, high-density culture, and no interference from the external environment. In 2009, Schalk of Firmenich Ltd. in Geneva, Switzerland, cloned two key genes for the synthesis of sclareol in the plant sclareol. One is labdenediol diphosphate (LPP) synthase (SsLpps, type II terpene synthase), which catalyzes the conversion of diterpenoid precursor GGPP to LPP; the other is sclareol synthase (SsTps, type I terpene synthase), which catalyzes LPP to sclareol (US patent 9267155). The two enzymes were expressed in Escherichia coli, and the isoprene (MEP) pathway was optimized. The yield of sclareol in fed-batch fermentation reached 1.5 g / L (Schalk et al., J. Am. Chem. Soc., 2012, 134 (46): 18900-18903). In 2013, Yang Wei et al. expressed the lysine pyrophosphate (LPP) synthase gene SsLPPS and the sclareol synthase gene SsTPS in Saccharomyces cerevisiae, and overexpressed the truncated hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG1 and fused the GGPP synthase gene and the farnesene synthase gene BTS1-ERG20, resulting in a sclareol production of 9 mg / L (Yang Wei et al., Journal of Biotechnology, 2013(08):152-159). In 2015, Ignea et al. expressed the 8-hydroxypropyl diphosphate (8OH-CPP) synthase gene CcCLS from Cistus sclarea and the sclareol synthase gene SsTPS from Clary Sclarea in the Saccharomyces cerevisiae chassis cell AM205 and site-directed mutation of ERG20 to ERG20. F96C, which increased the sclareol production to 403 mg / L (Ignea et al., Metabolic Engineering, 2015: 65-75). In the same year, Trikka et al. used carotenoid colorimetry to screen six knockout targets in Saccharomyces cerevisiae, including ROX1, DOS2, VBA5, YER134c, YNR063w and YGR259c. After knocking them out in chassis cells AM238, the sclareol production reached 750 mg / L in a shake flask (Trikka et al., Microb. Cell Fact., 2015, 14 (1): 60-79). The production of the currently constructed engineered strains is still relatively low and difficult to meet market demand.

[0004] The present invention constructs a yeast cell factory from global metabolism to achieve efficient synthesis of sclareol. First, the sclareol synthase gene is optimized to improve its biosynthesis efficiency; and the primary metabolism of the cell and the sclareol biosynthesis pathway are integrated and divided into three modules: 1) the primary metabolism module provides the precursor acetyl coenzyme A and the cofactor NADPH; 2) the mevalonate biosynthesis module; 3) the transcription factor regulation module. The three modules are optimized separately, and the synergistic cooperation between the modules is achieved, so that the sclareol yield in Saccharomyces cerevisiae reaches 1.1g / L in a shake flask and 11.4g / L in a batch fed-batch fermentation. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the problems of low activity of terpene biosynthetic enzymes and metabolic mismatch in current yeast engineering bacteria, increase the biosynthesis efficiency of diterpenes such as sclareol from the optimization of terpene synthases and global metabolic modules, and provide a yeast genetic engineering bacterium producing sclareol and its application.

[0006] According to one aspect of the present application, a method for constructing an engineered bacterium is provided, wherein the construction method optimizes the sclareol synthase of the host strain, which is beneficial to improving the yield of sclareol.

[0007] A method for constructing an engineered bacterium, the method comprising the following steps:

[0008] Introducing DNA fragment I into the host strain to obtain the engineered bacteria;

[0009] The DNA fragment I includes, from upstream to bottom, a promoter, a fusion gene, and a terminator;

[0010] The fusion gene includes, from upstream to downstream, a TPS gene, a connecting peptide I gene, and a LPPS gene;

[0011] The host strain is selected from any one of Saccharomyces cerevisiae.

[0012] Optionally, the fusion gene includes, from upstream to downstream:

[0013] MBP gene, connecting peptide II gene, TPS gene, connecting peptide I gene, LPPS gene;

[0014] or

[0015] The fusion gene includes, from upstream to downstream:

[0016] TPS gene, gene encoding connecting peptide I, LPPS gene, gene encoding connecting peptide II, and MBP gene.

[0017] Optionally, the nucleotide sequence of the LPPS gene is shown in SEQ ID NO: 1;

[0018] The nucleotide sequence of the TPS gene is shown in SEQ ID NO: 2;

[0019] The nucleotide sequence of the MBP gene is shown in SEQ ID NO: 3;

[0020] The nucleotide sequence of the gene encoding the connecting peptide I is shown in SEQ ID NO: 6;

[0021] The nucleotide sequence of the gene encoding the connecting peptide II is shown in SEQ ID NO: 7;

[0022] The promoter is selected from P eTDH3 , P GAL7 Any of the following:

[0023] The terminator is selected from T PYX212 , T ADH1 Any one of .

[0024] Optionally, the introduction of DNA fragment I into the host strain is to integrate DNA fragment I into the XI-3 gene site of the host.

[0025] Optionally, the construction method further comprises optimizing the synthesis pathway of MVA, including at least one of (a) to (h):

[0026] (a) knocking out the gene encoding GAL80 of the host strain;

[0027] (b) introducing the tHMG1 gene into the host strain;

[0028] (c) introducing the SpHMGR gene into a host strain;

[0029] (d) Mutate the ERG20 gene in the host strain genome to ERG20 F96C Gene;

[0030] (e) HMG2 K6R gene and ERG10 gene were introduced into the host strain;

[0031] (f) will contain 2 copies of HMG2 K6R The DNA fragment of the gene is introduced into the host strain;

[0032] (g) Replace the promoter of the ERG9 gene in the host strain with P HXT1 ;

[0033] (h) introducing a DNA fragment containing BTS1 and PaGGPPS genes into a host strain;

[0034] The above (a) to (h) are not in any particular order.

[0035] Optionally, at least one of (a) to (h) is included:

[0036] (a) Knockout of the GAL80 gene in the host strain;

[0037] (b) The AHD1 -P THD3 -The DNA fragment of tHMG1 is integrated into the FAA4 gene site of the host strain;

[0038] (c) POX1-T TDH2 -P tHXT7 -The DNA fragment of SpHMGR is integrated into the POX1 gene site of the host strain;

[0039] (d) Mutate the ERG20 gene in the host strain genome to ERG20 F96C Gene;

[0040] (e) The ENO2 -HMG2 K6R -P GAL10-1 -ERG10-T PYK1 The DNA fragment is integrated into the XII-2 gene site of the host strain;

[0041] (f) The PDC1 -HMG2 K6R -P GAL10-1 -HMG2 K6R -T ENO2 The DNA fragment is integrated into the XII-3 gene site of the host strain;

[0042] (g) Replace the promoter of the ERG9 gene in the host strain with P HXT1 ;

[0043] (h) GAL7-BTS1-PaGGPPS-T TDH2 The DNA fragment is integrated into the XI-2 gene locus of the host strain;

[0044] The above (a) to (h) are not in any particular order.

[0045] Optionally, the construction method further comprises optimizing a central metabolic pathway, including at least one of (A) to (N):

[0046] (A) Introducing the MmACL gene into the host strain;

[0047] (B) Introducing the RtME gene into the host strain;

[0048] (C) Introducing the 'MDH3 gene into the host strain;

[0049] (D) Introducing the CTP1 gene into the host strain;

[0050] (E) The PYC1 gene promoter of the host strain P PYC1 Replaced with promoter P TEF1 ;

[0051] (F) Introducing the MPC1 gene into the host strain;

[0052] (G) Introducing the MPC3 gene into the host strain;

[0053] (H) introducing the AnACLa gene and the AnACLb gene into the host strain;

[0054] (I) introducing the RtCIT1 gene into the host strain;

[0055] (J) Introducing the IDP2 gene into the host strain;

[0056] (K) Introducing the YHM2 gene into the host strain;

[0057] (L) Replace the promoter of the PGI1 gene of the host strain with promoter P COX9 ;

[0058] (M) introducing the GND1 gene, TKL1 gene, TAL1 gene, and ZWF1 gene into the host strain;

[0059] (N) Replace the promoter of the IDH2 gene of the host strain with promoter P GSY1 ;

[0060] The above (A) to (N) are in no particular order.

[0061] Optionally, the construction method further comprises optimizing a central metabolic pathway, including at least one of (A) to (G):

[0062] (A) HIS3-P TPI1 -MmACL-T FBA1 -P TDH3 -RtME-T CYC1 -P tHXT7 -'MDH3-T TDH2 -P PGK1 -CTP1-T ADH1 The DNA fragment is integrated into the HIS3 gene site of the host strain;

[0063] (B) The promoter P of the PYC1 gene of the host strain PYC1 Replaced with promoter P TEF1 ;

[0064] (C) tHXT7 -MPC3-T DIT1 -T MPC1 -MPC1-P TPI1 The DNA fragment is integrated into the XI-4 site of the host strain;

[0065] (D) will contain T CYC1 -AnACLa-P GAL1 -P GAL10 -AnACLb-T ADH1 The DNA fragment is integrated into the X2 site of the host strain;

[0066] (E) TPI1 -RtCIT1-T FBA1 -T CYC1 -IDP2-P THD3 -P TEF1 -The DNA fragment of YHM2 is integrated into the GAL1, GAL7, and GAL10 sites of the host strain;

[0067] (F) will contain P COX9 -T CYC1 -GND1-P THD3 -P tHXT7 -TKL1-T TDH2 -T ADH1 -TAL1-P PGK1 -P TEF1 -ZWF1-T ZWF1 The DNA fragment is integrated into the PGI1 site of the host strain;

[0068] (G) Replace the promoter of the IDH2 gene of the host strain with promoter P GSY1 ;

[0069] The above (A) to (G) are not in any particular order.

[0070] Optionally, the construction method further includes target regulation, including:

[0071] Knock out at least one of the ROX1 gene, DOS2 gene, VBA5 gene, YER134c gene, YNR063w gene, and YGR259c gene of the host strain.

[0072] Optionally, the construction method further includes at least one of the following:

[0073] (I) introducing at least one of the ANB1 gene, DAN1 gene, HUG1 gene, PYK1 gene, LAC1 gene, CYB5 gene, YCL021W-A gene, YCL074W gene, OYE3 gene, OYE2 gene, HSP31 gene, and BLI1 gene into the host strain;

[0074] and / or

[0075] (II) knocking out at least one of the SPS4 gene, YOR314W gene, SUL1 gene, CDA2 gene, ERV15 gene, ZRT1 gene, DSE1 gene, and ANB1 gene of the host strain.

[0076] Optionally, the construction method is constructed by adopting CRISPR / Cas9 technology.

[0077] Optionally, the construction method further comprises cell fusion to form diploids.

[0078] According to another aspect of the present application, an engineered bacterium constructed according to any of the construction methods described above is provided.

[0079] According to another aspect of the present application, provided is an engineered bacterium constructed according to any one of the construction methods described above, or use of at least one of the engineered bacteria described above in the preparation of sclareol.

[0080] As an embodiment, the present application provides a genetically engineered yeast strain of Saccharomyces cerevisiae that produces sclareol, optimizes sclareol synthase, expresses two enzymes that catalyze sclareol synthesis in series, and fuses maltose binding protein MBP at the N-terminus.

[0081] Optionally, the central metabolic module, isoprene biosynthetic pathway module, and regulatory module are optimized and constructed in yeast;

[0082] Optionally, the isoprene biosynthesis pathway rate-limiting enzyme genes are enhanced, including the truncated hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG1, the mutant HMG2 K6R, derived from Silicibacter pomeroyi NADH-dependent SpHMGR, acetoacetyl-CoA thiolase gene ERG10, endogenous GGPP synthase and GGPP synthase fusion protein gene BTS1-PaGGPPS from Phomopsis amygdali, and mutated the FPP synthase gene in the genome to ERG20 F96C And adopt P HXT1 Replace the ERG9 promoter to dynamically regulate ERG9 expression;

[0083] Alternatively, the central metabolic pathway was enhanced to increase the supply of the precursor acetyl-CoA and the cofactor NADPH, including the expression of the ATP-dependent citrate lyase gene MmACL from Mus musculus, NADP from Rhodospuridium toruloides + , ATP-dependent citrate lyase a and b genes from Aspergillus nidulans AnACLa and AnACLb, NADP-specific isocitrate dehydrogenase 2 gene IDP2, citrate, α-ketoglutarate transporter gene YHM2, glucose phosphate dehydrogenase isomer 1 gene GND1, transketolase gene TKL1, transaldolase gene TAL1, glucose 6-phosphate dehydrogenase gene ZWF1, mitochondrial NAD + Dependent on the isocitrate dehydrogenase gene IDH2 and using P GSY1 Replace the PGI1 promoter to weaken PGI1 expression;

[0084] Optionally, regulatory factor genes including ROX1, DOS2, VBA5, YER134c, YNR063w, and YGR259c were knocked out;

[0085] Optionally, a diploid strain is constructed, the constructed α strain is converted to an a-type strain, and then the two are fused to obtain a diploid strain.

[0086] As an embodiment, the present application provides a genetically engineered yeast of cerevisiae, and the construction method of the genetically engineered yeast of cerevisiae includes: fusing the TPS gene shown in SEQ ID NO: 2 with the LPPS gene shown in SEQ ID NO: 1, with the connecting peptide being GGGS, to obtain fusion gene 1; fusing the N-terminus of fusion gene 1 with the maltose binding protein encoding gene shown in SEQ ID NO: 3, to obtain fusion gene 2; and transferring fusion gene 2 together with plasmid pgRNA-XI-3 into a starting strain to obtain a genetically engineered yeast of cerevisiae that produces sclareol.

[0087] Optionally, the targeted genomic site of the plasmid pgRNA-XI-3 is XI-3.

[0088] As an embodiment, the present application provides a fusion gene, wherein the sequence of the fusion gene contains the LPPS gene sequence shown in SEQ ID NO: 1 and the TPS gene sequence shown in SEQ ID NO: 2;

[0089] Optionally, the sequence of the fusion gene contains any one of the following fragments:

[0090] Fusion gene 1: The TPS gene shown in SEQ ID NO: 2 is fused with the LPPS gene shown in SEQ ID NO: 1 via a connecting peptide GGGS, and the arrangement is TPS gene-connecting peptide GGGGS-LPPS gene to obtain fusion gene 1;

[0091] Fusion gene 2: the LPPS gene shown in SEQ ID NO: 1 is fused with the TPS gene shown in SEQ ID NO: 2 via a connecting peptide GGGS to obtain fusion gene 2;

[0092] Fusion gene 3: The LPPS gene shown in SEQ ID NO: 1 and the terminator T PYK1 Fused into fragment 1, promoter P eTDH3 , TPS gene shown in SEQ ID NO: 2 and terminator T PRM9 Fuse into long fragment 2, fuse long fragment 1 and long fragment 2 to obtain fusion gene 3;

[0093] Optionally, the nucleotide sequence of the connecting peptide GGGS is shown in SEQ ID NO: 6;

[0094] Optionally, the fusion gene further contains a maltose binding protein encoding gene sequence as shown in SEQ ID NO: 3;

[0095] Optionally, the sequence of the fusion gene contains the following fragments:

[0096] The TPS gene shown in SEQ ID NO: 2 is fused with the LPPS gene shown in SEQ ID NO: 1, and the connecting peptide is GGGS, to obtain a fusion gene 1; the N-terminus of the fusion gene 1 is fused with the maltose binding protein encoding gene MBP shown in SEQ ID NO: 3, and the connecting peptide is Gly6;

[0097] Optionally, the nucleotide sequence of Gly6 is shown in SEQ ID NO:7.

[0098] Optionally, the genetically engineered yeast Saccharomyces cerevisiae is obtained by replacing the XI-3 gene in the starting strain with a fragment containing a fusion gene.

[0099] As an embodiment, the present application provides a genetically engineered yeast of cerevisiae, and the construction method of the genetically engineered yeast of cerevisiae includes: fusing the TPS gene shown in SEQ ID NO: 2 with the LPPS gene shown in SEQ ID NO: 1, with the connecting peptide being GGGS, to obtain fusion gene 1; fusing the N-terminus of fusion gene 1 with the maltose binding protein encoding gene shown in SEQ ID NO: 3, to obtain fusion gene 2; transferring fusion gene 2 together with plasmid pgRNA-XI-3 into the starting strain, seamlessly knocking out the GAL80 gene, and obtaining a genetically engineered yeast of cerevisiae that produces sclareol.

[0100] As an embodiment, the present application provides a genetically engineered yeast of Saccharomyces cerevisiae, which is obtained by enhancing the expression of the rate-limiting enzyme gene of the isoprene biosynthesis pathway in the starting strain, including the truncated hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG1, the mutant HMG2 K6R , from Silicibacter pomeroyi NADH-dependent SpHMGR, acetoacetyl-CoA thiolase genes ERG10, HMG2 K6R The endogenous GGPP synthase was fused with the GGPP synthase gene from Phomopsis amygdali, BTS1-PaGGPPS, and the FPP synthase gene in the genome was mutated to ERG20. F96C And adopt P HXT1 Replacing the ERG9 promoter dynamically regulates at least one of the ERG9 expression.

[0101] Optionally, including truncated hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG1, mutant HMG2 K6R , from Silicibacter pomeroyi NADH-dependent SpHMGR, acetoacetyl-CoA thiolase genes ERG10, HMG2 K6RThe endogenous GGPP synthase was fused with the GGPP synthase gene from Phomopsis amygdali, BTS1-PaGGPPS (with a connecting peptide of GGGS), and the FPP synthase gene in the genome was mutated to ERG20. F96C And adopt P HXT1 Replace the ERG9 promoter to dynamically regulate ERG9 expression.

[0102] Optionally, the starting strain is the genetically engineered Saccharomyces cerevisiae strain CXM01*.

[0103] Optionally, the nucleotide sequence of SpHMGR is shown in SEQ ID NO:5.

[0104] Optionally, the nucleotide sequence of the PaGGPPS is shown in SEQ ID NO:4.

[0105] As an embodiment, the present application provides a genetically engineered yeast of Saccharomyces cerevisiae, which is obtained by strengthening the central metabolic pathway in the starting strain, including increasing the supply of precursor acetyl-CoA and cofactor NADPH, including expressing the ATP-dependent citrate lyase gene MmACL from Mus musculus, the NADP from Rhodospuridium toruloides + The ATP-dependent malate synthase gene RtME and citrate synthase 1 gene RtCIT1, the malate dehydrogenase gene without peroxisomal signal peptide 'MDH3, the citrate transporter gene CTP1, the pyruvate carboxylase 1 gene PYC1, the pyruvate transporter 1 and 3 genes MPC1 and MPC3, the ATP-dependent citrate lyase a and b genes from Aspergillus nidulans AnACLa and AnACLb, the NADP-specific isocitrate dehydrogenase 2 gene IDP2, the citrate, α-ketoglutarate transporter gene YHM2, the phosphate glucose dehydrogenase isomer 1 gene GND1, the transketolase gene TKL1, the transaldolase gene TAL1, the 6-phosphate glucose dehydrogenase gene ZWF1, the mitochondrial NAD+-dependent isocitrate dehydrogenase gene IDH2 and P GSY1 Replacing the PGI1 promoter at least one of attenuating PGI1 expression.

[0106] Optionally, the supply of precursor acetyl-CoA and cofactor NADPH is increased, including expression of the ATP-dependent citrate lyase gene MmACL from Mus musculus, NADP from Rhodospuridium toruloides +The ATP-dependent malate synthase gene RtME and citrate synthase 1 gene RtCIT1, the malate dehydrogenase gene without peroxisomal signal peptide 'MDH3, the citrate transporter gene CTP1, the pyruvate carboxylase 1 gene PYC1, the pyruvate transporter 1 and 3 genes MPC1 and MPC3, the ATP-dependent citrate lyase a and b genes from Aspergillus nidulans AnACLa and AnACLb, the NADP-specific isocitrate dehydrogenase 2 gene IDP2, the citrate, α-ketoglutarate transporter gene YHM2, the phosphate glucose dehydrogenase isomer 1 gene GND1, the transketolase gene TKL1, the transaldolase gene TAL1, the 6-phosphate glucose dehydrogenase gene ZWF1, the mitochondrial NAD+-dependent isocitrate dehydrogenase gene IDH2 and P GSY1 Replacement of the PGI1 promoter weakens PGI1 expression.

[0107] As an embodiment, the present application provides a genetically engineered yeast of Saccharomyces cerevisiae, wherein a regulatory factor gene is knocked out in a starting strain, wherein the regulatory factor gene includes at least one of ROX1, DOS2, VBA5, YER134c, YNR063w, and YGR259c;

[0108] Optionally, the regulatory factor genes include ROX1, DOS2, VBA5, YER134c, YNR063w, and YGR259c;

[0109] Optionally, the starting strain is the genetically engineered yeast Saccharomyces cerevisiae SCX38.

[0110] As an embodiment, the present application provides a diploid strain of Saccharomyces cerevisiae, wherein the genetically engineered strain of Saccharomyces cerevisiae SCX42 producing sclareol is converted from MATa to MATα to obtain SCX42-α, and SCX42 is converted from defective ura3 - 、his3 - Convert to ura3 - , met3 to obtain SCX42*, and then co-culture SCX42* with SCX42-α to obtain a diploid strain.

[0111] As an embodiment, the present application provides a genetically engineered yeast of Saccharomyces cerevisiae, wherein the genetically engineered yeast of Saccharomyces cerevisiae is overexpressed in a starting strain: at least one of ANB1, DAN1, HUG1, PYK1, LAC1, CYB5, YCL021W-A, YCL074W, OYE3, OYE2, HSP31, and BLI1;

[0112] or knockout: at least one of SPS4, YOR314W, SUL1, CDA2, ERV15, ZRT1, DSE1, ANB1;

[0113] Optionally, the starting strain is selected from any one of CXM01*, CXM17, CXM18, SCX38 and SCX42;

[0114] Optionally, the CXM18 is obtained by knocking out the transcription factors ROX1, DOS2, VBA5, YER134c, YNR063w, and YGR259c from CXM17;

[0115] Optionally, the genetically engineered yeast Saccharomyces cerevisiae is obtained by overexpressing ANB1, DAN1, HUG1, PYK1, LAC1, CYB5, YCL021W-A, YCL074W, OYE3, OYE2, HSP31, BLI1, and knocking out SPS4, YOR314W, SUL1, CDA2, ERV15, ZRT1, DSE1, ANB1 in the starting strain.

[0116] As an embodiment, there is provided a use of the genetically engineered yeast of Saccharomyces cerevisiae described in any one of the above or the diploid strain of Saccharomyces cerevisiae described in any one of the above in synthesizing sclareol;

[0117] Optionally, the method for preparing sclareol comprises using a basic component culture medium for the engineered yeast Saccharomyces cerevisiae described in any of the above items, adding 20-25 g / L glucose, and an initial pH of 5-6, and culturing at room temperature with shaking; transferring the culture medium to a container containing a fermentation medium, and fermenting the culture at room temperature with shaking for 96-120 hours, and the fermentation broth contains sclareol.

[0118] The beneficial effects of this application include:

[0119] (1) The construction method of the engineered bacteria provided in the present application optimizes the sclareol synthase of the host strain, which is beneficial to improving the yield of sclareol.

[0120] (2) The method for constructing the engineered bacteria provided in the present application increases the production of clarysol by strengthening the MVA pathway of Saccharomyces cerevisiae, strengthening central metabolism, and regulating transcription factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0121] Figure 1 A schematic diagram showing the metabolic engineering strategy to promote the synthesis of clarysol in Saccharomyces cerevisiae.

[0122] Figure 2 The sclareol production when the sclareol synthase was optimized is shown.

[0123] Figure 3The results show that strengthening the MVA pathway of Saccharomyces cerevisiae, strengthening central metabolism, and regulating transcription factors can increase the production of clarysol.

[0124] Figure 4 The results show the yield of sclareol by target modification screened out by transcriptome sequencing, where A is the yield of sclareol by overexpressing the target gene; and B is the yield of sclareol by knocking out the target gene.

[0125] Figure 5 The yield of sclareol in shake flask batch fed-batch fermentation is shown, wherein A is the feeding time; B is the growth condition; and C is the yield of sclareol.

[0126] Figure 6 The figure shows the production of sclareol in batch fed-batch fermentation in a fermenter; A is the production of sclareol; and B is the growth condition.

[0127] Figure 7 A gas chromatogram of sclareol synthesis by Saccharomyces cerevisiae is shown. DETAILED DESCRIPTION

[0128] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0129] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0130] In the examples of the present application, the CEN.PK113-11C strain (MATa MAL2-8c SUC2 his3Δ1ura3-52) of Euroscarf (Oberursel, Germany) was used for transformation. The genetic modification of the present application was completed with the help of the CRISPR / Cas9 system (see Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van denBroek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. CRISPR / Cas9: amolecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Res. 2015 Mar; 15 (2): fov004.)

[0131] The schematic diagram of the metabolic engineering transformation strategy of the present application to promote the synthesis of sclareol in Saccharomyces cerevisiae is shown in the figure.

[0132] Table 1. Gene-related information involved in optimizing the MVA synthesis pathway in the examples of this application

[0133]

[0134] Table 2. Gene-related information involved in strengthening the central metabolic pathway in this application example

[0135]

[0136] Table 3. Some site targeting sequences involved in the examples of this application

[0137]

[0138] Table 4. Composition of components in the culture medium in the present application example

[0139]

[0140]

[0141] As an embodiment, the present application provides a method for constructing a sclareol-producing Saccharomyces cerevisiae strain, which can significantly increase the yield of sclareol.

[0142] The construction method includes: optimization of sclareol synthase, strengthening of mevalonate pathway (MVA), optimization of central metabolic pathway, global regulation and diploid optimization.

[0143] In a specific embodiment, plasmids pYX312-L+T, pYX312-LT and pYX312-TL were constructed respectively. The pYX312 plasmid was constructed by our laboratory and the pYX212 plasmid was cloned into pYX312-LT. TPI The promoter was replaced with the enhancer P eTDH3 The promoter was obtained, where P eTDH3 The promoter was obtained by amplification and fusion according to the reference (Blazeck et al. Biotechnol Bioeng, 2012, 109(11): 2884-2895). In order to construct pYX312-L+T, the LPPS gene and TPS gene were obtained by full gene synthesis after codon optimization. eTDH3 Amplified using pYX312 as template. Terminator T PYK1 and T PRM9 The LPPS gene and T PYK1 The OE-PCR method (for the construction process of the fusion fragment, refer to Zhou et al. J Am Chem Soc 2012, 134: 3234-3241) was used to fuse the long fragment 1, and PeTDH3 , TPS and T PRM9 The OE-PCR method was used to fuse the long fragment 2; in order to construct pYX312-LT, the LPPS gene and the TPS gene were fused into the LT gene by the OE-PCR method. In order to construct pYX312-TL, the TPS gene and the LPPS gene were fused into the TL gene by the OE-PCR method. pYX312 (EcoRI / HindIII) was connected with the long fragments 1 and 2, the LT fusion gene, and the TL fusion gene by seamless cloning, and transformed into Escherichia coli competent cells. The plasmids verified by colony PCR and sequenced correctly were named pYX312-L+T, pYX312-LT, and pYX312-TL.

[0144] Further, the plasmids PYX312-L+T, PYX312-LT and PYX312-TL were transformed into the engineered bacteria XC07, genotype (MATa; MAL2-8c; SUC2; his3Δ1; ura3-52; XI-5::P TEF1 -Cas9-T CYC1 ;XI-3::P GAL7 -MBP-TL-T ADH1 ;gal80Δ;X4::P TDH3 -SpHMGR-T PRM9； X2::P TPI1 -BTS1-ERG20-T FBA1 ;P ERG9 ::P HXT1 ), after fermentation and extraction of sclareol and testing, it was concluded that the TPS-LPPS fusion method was most conducive to the synthesis of sclareol ( Figure 2 ).

[0145] Furthermore, on the basis of the TL fusion gene, the maltose binding protein encoding gene MBP is fused. The specific implementation is as follows: the MBP gene is fused to the N-terminus and C-terminus of the TL gene respectively to obtain the fusion genes MBP-TL and TL-MBP. TL, the fusion genes MBP-TL and TL-MBP are respectively fused to the promoter P GAL7 and terminator T ADH1 The donor DNA is obtained by fusing the upstream and downstream homology arms of the XI-3 site.

[0146] Furthermore, with the help of CRISPR / Cas9 system, the fusion genes MBP-TL, TL-MBP and TL were integrated into the engineered bacteria SCX22 (genotype: MATa; MAL2-8c; SUC2; ura3Δ; hfd1Δ; gal80Δ; gal1Δ; gal7Δ; his3Δ::(P TPI -MmACL-T FBA1)+(P TDH3 -RtME-T CYC1 )+(P tHXT7 -'MDH3-T TDH2 )+(P PGK1 -CTP1-T HIS3 );X1-5::P TEF1 -Cas9-T CYC1 ;pyc1::P TEF1 -PYC1;X1-4::(P TPI1 -MPC1)+(P PGK1 -MPC3-T DIT1 );X1-2::(P GAL1 -AnACLa-T CYC1 )+(P GAL10 -AnACLb-T ADH1 gal10Δ::(P TPI1 -RtCIT1 -T FBA1 )+(P TDH3 -IDP2-T CYC1 )+(P TEF1 -YHM2-T GAL1 ); pgi1Δ::(P COX9 -PGI1)+(P TDH3 -GND1-T CYC1 )+(P tHXT7 -TKL1-T TDH2 )+(P PGK1 -TAL1-T ADH1 )+(P TE F1 -ZWF1); idh2Δ::P GSY1 -IDH2;ERG20::P TDH3 -ERG20(F96C);FAA4::FAA4+P TDH3 -tHMG1-T FAA4 ;POX1::POX1+P tHXT7 -SpHMGR-T POX1 ;'tesAΔ;Rtf as1Δ;Rtfas2Δ;P ACC1 -ACC1) genome. The specific steps of constructing the CRISPR / Cas9 system are: using the fusion PCR method to obtain a complete homologous recombination fragment containing the upstream and downstream sequences of the integration site, the promoter P TEF1 , terminator T CYC1 The Cas9 gene and the resistance KanMX gene were screened, and 500 ng of the homologous recombination fragment was transformed into the Saccharomyces cerevisiae starting strain CENPK113-11C to obtain a Saccharomyces cerevisiae strain carrying the Cas9 protein.

[0147] Furthermore, an sgRNA expression vector targeting the chromosomal integration site XI-3 was constructed; subsequently, the sgRNA expression vector and donor DNA (500 ng each) were transformed into SCX22 by chemical transformation, spread on screening plates and cultured at 30°C for 3 days. The transformants were cultured in liquid SD medium, verified correct by colony PCR, and spread on plates containing 5-fluoroorotic acid for plasmid loss. The strains after plasmid loss were named engineered bacteria SCX23, SCX24 and SCX25, respectively.

[0148] Furthermore, fermentation to extract sclareol and testing confirmed that the MBP-TL fusion mode (SCX23) was most conducive to the synthesis of sclareol ( Figure 2 ).

[0149] Furthermore, the MBP-TL fusion gene was integrated into the starting strain CENPK113-11C and the GAL80 gene was knocked out to obtain the engineered strain CXM01*.

[0150] Further, the MVA synthesis pathway was optimized. With the help of the CRISPR / Cas9 system, the mevalonate-related rate-limiting genes were constructed with different promoters and terminators to construct expression cassettes and integrated into different sites of the genome (site selection reference Mikkelsen et al., Metab. Eng. 2012, 14: 104-111), and the MVA pathway optimized engineered bacteria CXM17 were obtained. Its main genes and sites (not limited to) are shown in Table 1.

[0151] Furthermore, the specific steps of constructing the gene expression cassette related to the MVA pathway and integrating the genome are as follows: first, construct the sgRNA expression vector and gene expression cassette targeting the chromosome integration site; then, amplify the 300bp sequence upstream and downstream of the integration site, the gene reading frame, the promoter and the terminator respectively, and obtain the complete donor DNA fragment by the fusion PCR method (refer to J Am Chem Soc 2012, 134: 3234-3241 for the construction process of the fusion fragment); then, transform the sgRNA expression vector and the gene expression cassette (500ng each) into Saccharomyces cerevisiae by chemical transformation, spread on the screening plate and culture at 30°C for 3 days. After the transformants are cultured in liquid SD medium, they are verified by colony PCR and spread on a plate containing 5-fluoroorotic acid for plasmid loss. The strains after plasmid loss are stored for future use. Other genome editing work of Saccharomyces cerevisiae follows a similar process below. To integrate HMG2 K6R and ERG10 genes to chromosome XII-2 site as an example: construct an sgRNA expression vector targeting chromosome XII-2 site; at the same time, construct HMG2 K6Rand ERG10 gene expression cassette, respectively amplifying 300 bp sequences upstream and downstream of gene XII-2 site, gene HMG2 K6R , ERG10, bidirectional promoter P GAL10-1 , terminator T PYK1 and terminator T ENO2 , the complete donor DNA fragment was obtained by fusion PCR method; then the correct transformant was obtained by transformation and verification by the above method.

[0152] Furthermore, after fermentation, extraction and detection, the OD of sclareol unit of engineered bacteria CXM17 was 600 The yield reached 13.37mg / L / OD 600 ( Figure 3 ).

[0153] Furthermore, the central metabolic pathway was strengthened, and with the help of the CRISPR / Cas9 system, the rate-limiting genes related to central metabolism were constructed into expression cassettes using different promoters and terminators (Table 2), and integrated into different sites of the genome to obtain the engineered bacteria SCX38 with optimized MVA pathway and central metabolic pathway.

[0154] Furthermore, after fermentation, extraction and testing, the production of sclareol from the engineered bacteria SCX38 reached 26.29 mg / L / OD. 600 ( Figure 3 ).

[0155] Furthermore, the transcription factors ROX1, DOS2, VBA5, YER134c, YNR063w, and YGR259c that affect terpene synthesis were knocked out to obtain the engineered bacterium SCX42.

[0156] Further, the specific implementation method takes the ROX1 gene as an example: first, construct an sgRNA expression vector targeting the ORF frame of the ROX1 gene; then, amplify the 300bp sequence of the upstream and downstream of the ROX1 gene respectively and obtain the complete donor DNA fragment by the fusion PCR method; then, transform the gRNA expression vector and the gene expression cassette (500ng each) into Saccharomyces cerevisiae by chemical transformation, spread on the screening plate and culture at 30℃ for 3 days, and the transformants are cultured in liquid SD medium, verified by colony PCR, and spread on a plate containing 5-fluoroorotic acid for plasmid loss. The strain after plasmid loss is stored for standby use. The knockout of the other five transcription factor targets follows the above process to achieve seamless knockout.

[0157] Furthermore, after fermentation, extraction and testing, the production of sclareol from the engineered bacteria SCX42 reached 75.38 mg / L / OD. 600 ( Figure 3 ).

[0158] The second aspect of the present invention is to construct a diploid strain capable of efficiently biosynthesizing sclareol.

[0159] The construction method comprises: converting the engineering bacteria mate type from MATa to MATα, and achieving diploid mating of MATa and MATα.

[0160] In a specific embodiment, the engineered bacterium SCX42 is converted from MATa to MATα. With the help of the CRISPR / Cas9 system, first, an sgRNA expression vector targeting the MATa region is constructed; then, the MATα genome is used as a template to amplify the genome matching region; subsequently, the gRNA expression vector and donor DNA (500 ng each) are transformed into Saccharomyces cerevisiae by chemical transformation, spread on a screening plate and cultured at 30°C for 3 days. After the transformants are cultured in liquid SD medium, the transformants with the matching type α are amplified by colony PCR and sent for sequencing, and spread on a plate containing 5-fluoroorotic acid for plasmid loss. The strain after plasmid loss is named SCX42-α.

[0161] Furthermore, SCX42 was transformed from defective ura3 - 、his3 - Convert to ura3 - 、met3 - The specific implementation plan is to construct an sgRNA expression vector targeting the MET3 gene region, then amplify 300 bp upstream and downstream of the MET3 gene and the HIS3 gene ORF frame, and obtain the donor DNA by fusion PCR. Subsequently, the gRNA expression vector and the gene expression cassette (500 ng each) were transformed into Saccharomyces cerevisiae by chemical transformation, spread on the screening plate and cultured at 30°C for 3 days. After the transformants were cultured in liquid SD medium, they were verified by colony PCR and spread on a plate containing 5-fluoroorotic acid for plasmid loss. The strain after plasmid loss was named SCX42*.

[0162] Furthermore, the engineered bacteria SCX42-α and SCX42* were cultured separately in YPD medium, and then 0.5 mL of bacterial solution was taken from each culture medium and mixed and inoculated into 20 mL YPD medium for 48 h. The fermentation broth was centrifuged, washed twice with water, appropriately diluted and spread on SD-URA3 solid medium, and the single colony grown was the diploid.

[0163] In a third aspect of the present invention, transcriptome sequencing analysis is performed on the engineered bacteria to obtain gene targets that can further increase the yield of sclareol.

[0164] The method comprises: performing transcriptome sequencing on engineered bacteria CXM01*, CXM17, CXM18 (obtained by knocking out transcription factors ROX1, DOS2, VBA5, YER134c, YNR063w, YGR259c from engineered bacteria CXM17), SCX38 and SCX42, and analyzing to obtain modified targets that may be beneficial to the synthesis of sclareol, and finding targets that can further improve the synthesis of sclareol by overexpression or knockout.

[0165] In a specific embodiment, after fermentation and cultivation of engineered bacteria CXM01*, CXM17, CXM18, SCX38 and SCX42, the residual glucose in the fermentation broth was 6-10 g / L and the bacteria in the ethanol utilization period were respectively taken for transcriptome sequencing, and the overexpression and knockout modification targets were obtained by comparing the gene expression differences of the above five strains.

[0166] Furthermore, the above targets are subjected to overexpression or knockout analysis. The specific implementation scheme is: using the CRISPR / Cas9 system, the gene overexpression target is respectively linked to the promoter P GAL7 and terminator T ENO2 Fusion and integration into the XI-6 site of the engineered bacteria. For gene knockout targets, seamless gene knockout is performed.

[0167] Furthermore, the production of clarysol produced by the engineered bacteria was detected through fermentation extraction. Figure 4 As shown, overexpression of target genes DAN1, HUG1, LAC1, OYE3 and OYE2 and knockout of target genes SUL1, CDA2, ERV15, ZRT1, DSE1 and ANB1 can promote the synthesis of sclareol, with the highest yield being 1.1 g / L.

[0168] In the specific examples of the present application, the chromosome integration site sequences XI-3, XI-1, XII-2, XII-3, and XI-2 are obtained from reference (Mikkelsen et al., Metab. Eng. 2012, 14: 104-111). The chromosome integration site targeting sequence is referenced to Table 3. The culture medium formula is referenced to Table 4.

[0169] Example 1 Optimization of Sclareol Synthase Gene

[0170] Plasmids pYX312-L+T, pYX312-LT and pYX312-TL were constructed respectively. The pYX312 plasmid was constructed by our laboratory and the pYX212 plasmid (purchased from Addgene) was cloned into P TPI The promoter was replaced with the enhancer P eTDH3 The promoter was obtained, where P eTDH3The promoter was obtained by amplification and fusion according to the reference (Blazeck et al. Biotechnol Bioeng, 2012, 109(11): 2884-2895). In order to construct pYX312-L+T, the LPPS gene and TPS gene were synthesized after codon optimization. The nucleotide sequence of the LPPS gene after optimization is shown in SEQ ID NO: 1, and the nucleotide sequence of the TPS gene after optimization is shown in SEQ ID NO: 2. eTDH3 Amplified using PYX312 as template. Terminator T PYK1 and T PRM9 The LPPS gene and T PYK1 The OE-PCR method (the construction process of the fusion fragment is referred to J Am Chem Soc 2012, 134: 3234-3241) was used to fuse the long fragment 1, and P eTDH3 , TPS and T PRM9 The long fragment 2 was fused by OE-PCR. In order to construct pYX312-LT, the LPPS gene and the TPS gene were fused into the LT gene by OE-PCR (the connecting peptide was GGGS, and the nucleotide sequence of the encoding gene was shown in SEQ ID NO: 6); in order to construct pYX312-TL, the TPS gene and the LPPS gene were fused into the TL gene by OE-PCR (the connecting peptide was GGGS). pYX312 (EcoRI / HindIII) was connected with the long fragments 1 and 2, the LT fusion gene, and the TL fusion gene by seamless cloning, and transformed into competent E. coli. The plasmids verified by colony PCR and sequenced correctly were named pYX312-L+T, pYX312-LT, and pYX312-TL, respectively.

[0171] Plasmids pYX312-L+T, pYX312-LT and pYX312-TL were transferred into engineered bacteria XC07, which was modified on the basis of CEN.PK-113-11C and had a genotype of (MATa; MAL2-8c; SUC2; his3Δ1; ura3-52; XI-5::P TEF1 -Cas9-T CYC1 ;XI-3::P GAL7 -MBP-TL-T ADH1 ;gal80Δ;X4::P TDH3 -SpHMGR-T PRM9； X2::P TPI1 -BTS1-ERG20-T FBA1 ;P ERG9 ::P HXT1), after fermentation to extract sclareol and testing to confirm that the TPS-LPPS fusion mode is most conducive to the synthesis of sclareol ( Figure 2 ), Fermentation conditions: The activated strain was cultured in the culture medium at 30°C and 220 rpm for 24 h, then transferred to 15 mL Delft-D fermentation medium / 100 mL shake flask, and the initial OD 600 =0.1, 30°C, 220 rpm, and fermented for 96 h, and the biomass and sclareol yield were determined.

[0172] On the basis of TL fusion gene, maltose binding protein encoding gene MBP is fused. The specific implementation method is as follows: MBP gene is fused with 5' end and 3' end of TL gene respectively (connecting peptide is Gly6, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO: 7), and fusion gene MBP-TL and TL-MBP are obtained. TL, fusion gene MBP-TL and TL-MBP are fused with P GAL7 and terminator T ADH1 The donor DNA was obtained by fusing the upstream and downstream homology arms of the XI-3 locus. Referring to the CRISPR / Cas9 system (Mans R, et al. FEMS Yeast Res. 2015Mar; 15(2): fov004.), the fusion gene was integrated into the genome of the engineered bacterium SCX22, which was transformed on the basis of CEN.PK-113-11C, with the genotype: MATa; MAL2-8c; SUC2; ura3Δ; hfd1Δ; gal80Δ; gal1Δ; gal7Δ; his3Δ::(P TPI -MmACL-T FBA1 )+(P TDH3 -RtME-T CYC1 )+(P tHXT7 -'MDH3- T TDH2 )+(P PGK1 -CTP1-T HIS3 );X1-5::P TEF1 -Cas9-T CYC1 ;pyc1::P TEF1 -PYC1;X1-4::(P TPI1 -MPC1)+(P PGK1 -MPC3-T DIT1 );X1-2::(P GAL1 -AnACLa-T CYC1 ) +(P GAL10 -AnACLb-T ADH1 gal10Δ::(P TPI1 -RtCIT1-T FBA1 )+(PTDH3 -IDP2-T CYC1 )+(P TEF1 -YHM2-T GAL1 ); pgi1Δ::(P COX9 -PGI1)+(P TDH3 -GND1-T CYC1 )+( P tHXT7 -TKL1-T TDH2 )+(P PGK1 -TAL1-T ADH1 )+(P TEF1 -ZWF1); idh2Δ::P GSY1 -IDH2;Erg20::P TDH3 -Erg20(F96C);FAA4::FAA4+P TDH3 -tHMG1-T FAA4 ;POX1::POX1+P tHXT7 -SpHMGR-T POX1 ;'tesAΔ;Rtfas1Δ;Rtfas2Δ;P ACC1 -ACC1. The integration method is as follows: construct an sgRNA expression vector targeting the chromosome integration site XI-3; then, the sgRNA expression vector and donor DNA (XI-3up-P GAL7 -MBP-TL-T ADH1 -XI-3dw;XI-3up-P GAL7 -TL-MBP-T ADH1 -XI-3dw; XI-3up-P GAL7 -TL-T ADH1 -XI-3dw) were transformed into Saccharomyces cerevisiae by chemical transformation, spread on screening plates and cultured at 30°C for 3 days. The transformants were cultured in liquid SD medium and verified by colony PCR. They were spread on plates containing 5-fluoroorotic acid for plasmid loss. The strains after plasmid loss were stored for future use. The strains after plasmid loss were named engineered bacteria SCX23, SCX24 and SCX25. After fermentation, sclareol was extracted and tested to confirm that the MBP-TL fusion mode (SCX23) was most conducive to the synthesis of sclareol ( Figure 2 ).

[0173] Example 2 Effect of MVA pathway supply on the synthesis of sclareol by Saccharomyces cerevisiae

[0174] Using CEN.PK113-11C as the starting bacterium, the MBP-TL fusion gene was integrated at the XI-3 site (the integration method was the same as in Example 1), and the GAL80 gene was knocked out to obtain the engineered bacterium CXM01*. In the engineered bacterium CXM01*, the truncated tHMG1 gene was overexpressed at the FAA4 site (the donor DNA was FAA4up-FAA4-T AHD1 -kanMX-P THD3 -tHMG1-FAA4dw); overexpression of SpHMGR gene (nucleotide sequence as shown in SEQ ID NO: 5) at the POX1 locus (donor DNA is POX1up-POX1-T TDH2 -kanMX-P tHXT7 -SpHMGR-POX1dw). The ERG20 gene on the genome was mutated to ERG20 F96C The base TTC is mutated to TGT. K6R and ERG10 gene integrated into the XII-2 locus (donor DNA is XII-2up-T ENO2 -HMG2 K6R -P GAL10-1 -ERG10-T PYK1 -XII-2dw); two copies of HMG2 were integrated at the XII-3 locus K6R (Donor DNA is XII-3up-T PDC1 -HMG2 K6R -P GAL10-1 -HMG2 K6R -T ENO2 -XII-3dw); replace the ERG9 gene promoter with P HXT1 ; BTS1 and PaGGPPS (nucleotide sequence as shown in SEQ ID NO: 4) genes were connected and integrated into the XI-2 site (donor DNA is XI-2up-P GAL7 -BTS1-PaGGPPS-T TDH2 -XI-2dw) to obtain the engineered bacteria CXM17.

[0175] The specific steps of constructing the MVA pathway-related gene expression cassette and integrating it into the genome are as follows: taking the integration of tHMG1 into the FAA4 locus as an example, firstly, FAA4up-FAA4, T AHD1 , kanMX,P THD3 , tHMG1, T FAA4 The complete donor DNA fragment FAA4up-FAA4-T was obtained by fusion PCR. AHD1 -kanMX-P THD3 -tHMG1-T FAA4; Subsequently, 500 ng of the donor DNA fragment was transformed into Saccharomyces cerevisiae by chemical transformation, spread on the screening plate and cultured at 30°C for 3 days. The transformants were cultured in liquid YPD+G418 medium and verified by colony PCR. AHD1 -P THD3 The resistance gene was selected by losing KanMX. The verified correct transformants were spread on plates containing 5-fluoroorotic acid for plasmid loss, and the strains after plasmid loss were preserved for future use. The other genome editing work of Saccharomyces cerevisiae in the following text followed a similar process. K6R The gene was amplified using primers (F: ATGTCACTTCCCTTAAGAACGATAGTACATTTG; R: TAATAATGCTGAGGTTTTACAGGGGGG) and CEN.PK113-11C as template.

[0176] The engineered bacteria fermentation process used 15 mL Delft-D fermentation medium / 100 mL shake flask, with an initial pH of 5.6. Initial OD 600 = 0.1, 30°C, 220rpm conditions for 96h fermentation, and the biomass and sclareol yield were determined. Figure 3 As shown, CXM17 was obtained by the enhanced MVA route, unit OD 600 The yield of sclareol reached 13.4 mg / L / OD 600 .

[0177] Example 3 Strengthening central metabolism to improve sclareol synthesis efficiency

[0178] Based on the MVA optimized strain CXM17, the central metabolic pathway of Saccharomyces cerevisiae was optimized to strengthen the supply of precursor acetyl-CoA and cofactor NADPH, and the engineered strain SCX38 was obtained. The detailed process is as follows. The ATP-dependent citrate lyase MmACL gene, malate synthase RtME gene, signal peptide-removed malate dehydrogenase 'MDH3 gene and citrate transporter encoding gene CTP1 were integrated into the HIS3 gene locus (donor DNA is HIS3up-HIS3-P TPI1 -MmACL-T FBA1 -P TDH3 -RtME-T CYC1 -P tHXT7 -'MDH3-T TDH2 -P PGK1 -CTP1-T ADH1 -P TEF1 -'tesA-T HIS3 ); Pyruvate carboxylase gene promoter P PYC1 Replaced with promoter PTEF1 ; Overexpression of pyruvate transporter encoding genes MPC1 and MPC3 at the XI-4 locus (donor DNA is XI-4up-P tHXT7 -MPC3-T DIT1 -T MPC1 -MPC1-P TPI1 -XI-4dw); AnACL genes (AnACLa and AnACLb) were integrated into the X2 locus (donor DNA was X2up-T CYC1 -AnACLa-P GAL1 -P GAL10 -AnACLb-T ADH1 -X2dw); the citrate synthase gene RtCIT1, isocitrate dehydrogenase gene IDP2 and the citrate, oxaloacetate and α-ketoglutarate transporter encoding gene YHM2 were integrated into the GAL1, GAL7 and GAL10 loci (donor DNA was T GAL7 -P TPI1 -RtCIT1-T FBA1 -T CYC1 -IDP2-P THD3 -P TEF1 -YHM2-T GAL1 ), that is, the three genes GAL1, GAL7, and GAL10 were knocked out while integrating the DNA fragment; the promoter of the 6-phosphoglucose isomerase PGI1 gene was replaced by the promoter P COX9 The pentose phosphate pathway genes GND1, TKL1, TAL1, and ZWF1 were overexpressed, and the donor DNA was PGI1-P COX9 -T CYC1 -GND1-P THD3 -P tHXT7 -TKL1-T TDH2 -T ADH1 -TAL1-P PGK1 -P TEF1 -ZWF1-T ZWF1 -PGI1up; the isocitrate dehydrogenase IDH2 gene promoter P IDH2 Replaced with promoter P GSY1 .

[0179] The specific transformation methods of the engineering bacteria in this example can be obtained by referring to the literature (Yu et al., Cell, 2018: 174: 1549-1558e1514.). The engineering bacteria fermentation process uses 15mL Delft-D fermentation medium / 100mL shake flask, the initial pH is 5.6, and the initial OD 600=0.1, 30°C, 220rpm conditions for 96h fermentation, and the biomass and sclareol yield were determined. Sclareol was extracted with n-hexane and detected by GC-MS with sclareolide as the internal standard. Figure 3 As shown in Figure 2, the yield of sclareol was significantly increased to 26.2 mg / L / OD 600 .

[0180] Example 4 Effect of target regulation on the synthesis of sclareol by Saccharomyces cerevisiae

[0181] The engineered bacteria SCX38 knocked out genes ROX1, DOS2, VBA5, YER134c, YNR063w, and YGR259c to obtain the engineered bacteria SCX42. The specific implementation method takes the ROX1 gene as an example: first, construct an sgRNA expression vector targeting the ORF frame of the ROX1 gene; then, amplify the 300bp sequence upstream and downstream of the ROX1 gene respectively and obtain the complete donor DNA fragment by fusion PCR; then, the gRNA expression vector and the gene expression cassette (500ng each) are transformed into Saccharomyces cerevisiae by chemical transformation, spread on the screening plate and cultured at 30°C for 3 days. After the transformants are cultured in liquid SD medium, they are verified by colony PCR and spread on a plate containing 5-fluoroorotic acid for plasmid loss. The strains after plasmid loss are stored for future use. The knockout of the other five transcription factor targets all follow the above process to achieve seamless knockout.

[0182] The fermentation process of the engineered bacteria was carried out using 15 mL Delft-D fermentation medium / 100 mL shake flask, with an initial pH of 5.6 and an initial OD 600 =0.1, 30°C, 220rpm, fermentation for 96h, and determination of biomass and sclareol yield. Sclareol was extracted with n-hexane and detected by GC-MS with sclareolide as internal standard. Figure 3 As shown in the figure, by further knocking out the relevant target genes, the sclareol production reached 934 mg / L, unit OD 600 The yield is 75.4 mg / L / OD 600 , which is the highest yield so far, proving the great potential of Saccharomyces cerevisiae as a cell factory for producing sclareol. Figure 7 shown.

[0183] Example 5 Construction of a diploid yeast strain for the synthesis of sclareol

[0184] The engineered bacteria SCX42 was converted from MATa to MATα. With the help of CRISPR / Cas9 system, first, an sgRNA expression vector targeting the MATa region was constructed; then, the MATα genome was used as a template to amplify the genome mating region; subsequently, the gRNA-HMRa expression vector and donor DNA (500 ng each) were transformed into Saccharomyces cerevisiae by chemical transformation, spread on a screening plate and cultured at 30°C for 3 days. After the transformants were cultured in liquid SD medium, the transformants with α-type mating were amplified by colony PCR and sent for sequencing. The transformants were spread on a plate containing 5-fluoroorotic acid for plasmid loss. The strain after plasmid loss was named SCX42-α. The mating type conversion transformation method can be obtained by referring to the patent (Tianjin University. A method for converting yeast mating type: CN201610102424.8[P].2016-04-13.).

[0185] SCX42 is transformed into ura3 - 、his3 - Convert to ura3 - 、met3 - The specific implementation plan is to construct an sgRNA expression vector targeting the MET3 gene region, then amplify 300 bp upstream and downstream of the MET3 gene and the HIS3 gene ORF frame, and obtain the donor DNA by fusion PCR. Subsequently, the gRNA expression vector and the gene expression cassette (500 ng each) were transformed into Saccharomyces cerevisiae by chemical transformation, spread on the screening plate and cultured at 30°C for 3 days. After the transformants were cultured in liquid SD medium, they were verified by colony PCR and spread on a plate containing 5-fluoroorotic acid for plasmid loss. The strain after plasmid loss was named SCX42*.

[0186] The engineered bacteria SCX42-α and SCX42* were cultured separately in YPD medium, and then 0.5 mL of bacterial solution was mixed and inoculated into 20 mL YPD medium for 48 hours. The fermentation broth was centrifuged, washed twice with water, and then appropriately diluted and spread on SD-URA3 solid medium. The single colony grown was the diploid.

[0187] Example 6

[0188] Transcriptome sequencing analysis of engineered bacteria and transformation to obtain overexpression or knockout targets

[0189] The engineered bacteria CXM01*, CXM17, CXM18 (CXM18 was obtained by knocking out the transcription factors ROX1, DOS2, VBA5, YER134c, YNR063w, and YGR259c from the engineered bacteria CXM17), SCX38, and SCX42 were fermented in a basal medium (glucose concentration of 20 g / L was added to Delft-D), and the cells were taken for transcriptome sequencing at the time point when the residual glucose concentration was 10 g / L and when the glucose was consumed and ethanol was utilized, respectively, to analyze and obtain the modified targets that may be beneficial to the synthesis of sclareol, including overexpression targets: ANB1, DAN1, HUG1, PYK1, LAC1, CYB5, YCL021W-A, YCL074W, OYE3, OYE2, HSP31, and BLI1; knockout targets: SPS4, YOR314W, SUL1, CDA2, ERV15, ZRT1, DSE1, ANB1. All transformation targets can be found in the Saccharomyces Genome Database (https: / / www.yeastgenome.org / ).

[0190] With the help of CRISPR / Cas9 system, the gene overexpression target was linked to the promoter P GAL7 and terminator T ENO2 Fusion and integration into the engineered bacteria XI-6 site. For gene knockout targets, ORF seamless knockout was performed.

[0191] The fermentation process of the engineered bacteria was carried out using 15 mL Delft-D fermentation medium / 100 mL shake flask, with an initial pH of 5.6 and an initial OD 600 =0.1, 30°C, 220rpm conditions for 96h fermentation, and determination of biomass and sclareol yield. Sclareol was extracted with n-hexane and detected by GC-MS with sclareolide as internal standard.

[0192] like Figure 4 As shown in Figure 2, in SCX42, overexpression of target genes DNA1, HUG1, LAC1, OYE3 and OYE2 and knockout of target genes SUL1, CDA2, ERV15, ZRT1, DSE1 and ANB1 can promote the synthesis of sclareol. Among them, overexpression of LAC1 gene leads to the highest yield of sclareol, 1.1g / L ( Figure 4 ).

[0193] Example 7

[0194] Fed-batch fermentation of sclareol

[0195] (1) Feed-batch fermentation of engineered bacteria in shake flasks

[0196] The shake flask batch fermentation used a 50 mL fermentation broth / 250 mL conical flask culture system, and the engineered bacteria SCX42 and diploid were selected. The basic component culture medium (Delft-A and Delft-D) was used for batch fermentation, with a volume of 50 mL and an inoculation OD 600 =0.2, pH 5.6. 3ⅹDelft-A medium (500 g / L glucose added to Delft-A medium) or 3ⅹDelft-D medium (500 g / L glucose added to Delft-D medium) was used for fed-batch culture. When glucose was consumed in the batch test fermentation, 1 mL of 3ⅹDelft-A medium or 2 mL of 3ⅹDelft-D medium was added, and 4 M potassium hydroxide was used to adjust the pH to 5.6 every 24 h. The feeding time point (i.e., the corresponding sugar feeding time point in the figure) was as follows Figure 5 As shown in A, the diploid was fed at the time points indicated by the black and gray dots, while the other engineered bacteria were only fed at the time points indicated by the black dots. The biomass and sclareol production were determined at 30°C and 220 rpm for 8 days. Sclareol was extracted with n-hexane and detected by GC-MS with sclareolide as the internal standard. Figure 5 As shown in Figures B and 5C, the growth of engineered bacteria SCX42 was slightly better than that of Delft-A medium when supplemented with Delft-D, and the sclareol content was significantly better than that of Delft-A (2.2 g / L), reaching 4.5 g / L; under the same condition of supplementing with Delft-A, SCX42 grew faster than diploids, but the sclareol content of diploids was slightly higher than that of engineered bacteria SCX42, at 2.4 g / L. The above results show that Delft-D medium is more suitable for engineered bacteria to produce sclareol by fermentation than Delft-A medium.

[0197] (2) Parallel batch fermentation of engineered bacteria in bioreactors

[0198] In order to obtain a higher yield of engineered bacteria, we overexpressed LAC1 and OYE2 genes in the engineered bacteria SCX42 to obtain the engineered bacteria SCX42-LAC1-OYE2. The batch fermentation used a 1L DasGip parallel bioreactor system, and the batch fermentation volume was 0.4L. The batch fermentation used a basic component medium (Delft-D with glucose added at a concentration of 20g / L), with a volume of 0.4L and an inoculation OD of 600 =0.4, pH 5.6. 4×D medium (500 g / L glucose was added to Delft-D) was used as feed medium. Exponential feeding was used as feeding method, μ=0.05. When glucose was consumed in batch fermentation, exponential feeding was started. During the fermentation process, sclareol particles and bacteria adhered to the walls of the fermentation tank, electrodes, etc. The final sclareol production required all adhered particles to be suspended in the fermentation liquid for quantification.

[0199] like Figure 6 As shown, the highest yield of the engineered bacteria SCX42-LAC1-OYE2 was 11.4 g / L.

[0200] The above are only a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application is disclosed as above with preferred embodiments, it is not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. A method for constructing an engineered bacterium, characterized in that: The construction method comprises the following steps: Introducing DNA fragment I into the host strain to obtain the engineered bacteria; The DNA fragment I includes, from upstream to bottom, a promoter, a fusion gene, and a terminator; The host strain is CEN.PK113-11C strain; The fusion gene includes, from upstream to bottom: MBP Gene, gene encoding connecting peptide II, TPS Gene, gene encoding connecting peptide I, LPPS Gene; Said LPPS The nucleotide sequence of the gene is shown in SEQ ID NO: 1; Said TPS The nucleotide sequence of the gene is shown in SEQ ID NO: 2; Said MBP The nucleotide sequence of the gene is shown in SEQ ID NO: 3; The nucleotide sequence of the gene encoding the connecting peptide I is shown in SEQ ID NO: 6; The nucleotide sequence of the gene encoding the connecting peptide II is shown in SEQ ID NO: 7; The promoter is selected from P eTDH3 , P GAL7 Any of the following: The terminator is selected from T PYX212 , T ADH1 Any of the following: The introduction of DNA fragment I into the host strain is to integrate DNA fragment I into the host XI-3 Gene loci; The construction method also includes optimizing the synthesis pathway of MVA, including (a) to (h): (a) Knockout of host strain GAL80 Gene; (b) containing FAA4 -T AHD1 - P THD3 - tHMG1 The DNA fragment is integrated into the host strain FAA4 Gene loci; (c) containing POX1 -T TDH2 - P tHXT7 - SpHMGR The DNA fragment is integrated into the host strain POX1 Gene loci; SpHMGR Derived from Silicibacter pomeroyi NADH-dependent SpHMGR; (d) Add the host strain genome ERG20 Gene mutation ERG20 F96C Gene; (e) The ENO2 - HMG2 K6R -P GAL10-1 - ERG10 -T PYK1 The DNA fragment is integrated into the host strain XII-2 Gene loci; (f) Containing T PDC1 - HMG2 K6R -P GAL10-1 - HMG2 K6R -T ENO2 The DNA fragment is integrated into the host strain XII-3 Gene loci; (g) Injection of host strain ERG9 The promoter of the gene was replaced by P HXT1 ; (h) will contain P GAL7 - BTS1 - PsA -T TDH2 The DNA fragment is integrated into the host strain XI-2 Gene loci; BTS1 - PsA The GGPP synthase fusion protein gene BTS1-PaGGPPS from Phomopsis amygdali; The steps (a) to (h) are performed in no particular order to obtain the engineered bacterium CXM17; In (a) to (h), the gene sources are as follows: Said SpHMGR The nucleotide sequence of the gene is shown in SEQ ID NO: 5; Said BTS1-PaGGPPS The nucleotide sequence of the gene is shown in SEQ ID NO: 4; The construction method also includes optimizing the central metabolic pathway based on the engineered bacteria CXM17, including (A) to (N): (A) will contain HIS3 -P TPI1 - MmACL -T FBA1 -P TDH3 - R -T CYC1 - P tHXT7 - 'MDH3-T TDH2 -P PGK1 - CTP1 -T ADH1 The DNA fragment was integrated into the engineered bacteria CXM17 HIS3 Gene loci; (B) The engineered bacteria CXM17 PYC1 Gene promoter P PYC1 Replaced with promoter P TEF1 ; (C) will contain P tHXT7 - MPC3 -T DIT1 - T MPC1 -MPC1- P TPI1 The DNA fragment was integrated into the engineered bacteria CXM17 XI-4 Site; (D) will contain T CYC1 - AnACLa -P GAL1 -P GAL10 -AnACLb- T ADH1 The DNA fragment was integrated into the engineered bacteria CXM17 X2 Site; (E) will contain P TPI1 - RtCIT1 -T FBA1 - T CYC1 -IDP2- P THD3 - P TEF1 -YHM2 The DNA fragment was integrated into the engineered bacteria CXM17 GAL1, GAL7, GAL10 Site; (F) will contain P COX9 -T CYC1 - GND1 -P THD3 - P tHXT7 - TKL1 -T TDH2 - T ADH1 -TAL1- P PGK1 - P TEF1 -ZWF1- T ZWF1 The DNA fragment was integrated into the engineered bacteria CXM17 PGI1 Site; (G) The engineered bacteria CXM17 IDH2 The promoter of the gene is replaced by promoter P GSY1 ; The steps (A) to (G) are performed in no particular order to obtain the engineered bacterium SCX38; In (A) to (G), the gene sources are as follows:

2. The construction method according to claim 1, characterized in that: The construction method also includes target regulation based on the engineered bacteria SCX38: knocking out the ROX1 gene, DOS2 gene, VBA5 gene, YER134c gene, YNR063w gene and YGR259c gene of the engineered bacteria SCX38 to obtain the engineered bacteria SCX42.

3. The construction method according to claim 2, characterized in that: In the engineered bacteria SCX42, the target genes DNA1, HUG1, LAC1, OYE3 or OYE2 were overexpressed.

4. The construction method according to claim 2, characterized in that: Knockout of target genes SUL1, CDA2, ERV15, ZRT1, DSE1 or ANB1.

5. The construction method according to claim 1, characterized in that: The construction method is constructed by adopting CRISPR / Cas9 technology.

6. The construction method according to claim 1, characterized in that: The construction method also includes cell fusion to form diploids.

7. Use of the engineered bacteria constructed according to the construction method according to any one of claims 1 to 6 in the preparation of sclareol.

Images