Sugar transporter protein, gene and application of wheat stripe rust

Abstract

The present invention discloses a sugar transporter Pst25662 of stripe rust, and the amino acid sequence is shown in SEQ ID NO.2. The nucleotide sequence of the sugar transporter expression gene Pst25662 is shown in SEQ ID NO.1. The sugar transporter has the ability to transport sucrose and multiple hexoses, and the gene Pst25662 is upregulated under the induction of stripe rust. The present invention uses Agrobacterium-mediated genetic transformation to obtain transgenic plants with silenced gene Pst25662, and verifies that the transgenic interference plants show resistance to stripe rust. The present invention enriches the new cognition of those skilled in the art on the acquisition of carbon sources for wheat stripe rust, provides ideas for subsequent research on wheat stripe rust-resistant varieties and sustainable regulation, and has substantial reference significance for the design of drug targets for biological control.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering technology, relates to the breeding of plant disease-resistant materials and biological control drug targets in agricultural biotechnology, and specifically relates to a wheat stripe rust sugar transporter, a coding gene and an application thereof. Background Art

[0002] Wheat is the world's largest and most widely planted crop, and about one-third of the world's population relies on wheat as their staple food. Among all the biological and abiotic factors that may cause serious reductions in wheat production, wheat stripe rust is one of the most serious threats to wheat yield losses, with the characteristics of wide occurrence, rapid spread, and large damage and losses. In 2002, wheat stripe rust was listed in the national first-class pest and disease list. Therefore, improving wheat stripe rust prevention and control measures and ensuring food safety production have become urgent needs that need to be urgently addressed in agricultural production.

[0003] Chemical control is the main way to prevent and control wheat stripe rust today. However, long-term and unreasonable use of large amounts of drugs will not only aggravate environmental pollution and increase the burden on farmers, but will also lead to many problems such as chemical residues and increased resistance of pests and diseases, destroying the natural balance of the agricultural ecosystem. Breeding disease-resistant varieties is one of the most economical, effective and environmentally friendly measures to prevent and control wheat stripe rust. However, due to the frequent mutation of stripe rust species themselves, new toxic species continue to emerge and gradually become popular, and the resistance of the main cultivated wheat disease-resistant varieties is usually overcome within 3-5 years. Therefore, thoroughly understanding the pathogenic mechanism of stripe rust and creating broad-spectrum and long-lasting disease-resistant materials are considered to be the most efficient and direct solution.

[0004] Stripe rust is a kind of living trophic parasitic fungus, and its survival and reproduction are highly dependent on nutrients absorbed from the host. Carbohydrates are important basic nutrients necessary for the growth and development of wheat stripe rust. Controlling the absorption of carbohydrates by stripe rust can effectively limit its material and energy supply, thereby limiting the growth, development and reproduction of stripe rust, and further weakening its damage to wheat. However, the research on the sugar absorption mechanism of stripe rust during the interaction between wheat and stripe rust is relatively small and still unclear. The sugar transporter of wheat stripe rust is relatively conservative in genetic evolution, and carbohydrates are the main form of carbon source for pathogens. Therefore, clarifying the key way for pathogens to obtain carbohydrates provides new ideas and breeding materials for creating wheat disease-resistant materials using pathogenic factors, which is of great significance for achieving broad-spectrum and lasting disease resistance in wheat breeding. Summary of the invention

[0005] Sugar substances are the main form of carbon source for pathogens and are the main nutrients indispensable for the growth and development of stripe rust. The present invention aims to enrich the new understanding of those skilled in the art on the acquisition of carbon sources for wheat stripe rust. Specifically, the present invention provides a wheat stripe rust sugar transporter gene Pst25662 and its encoded protein Pst25662.

[0006] The present invention aims to provide a sugar transporter protein Pst25662 of wheat stripe rust fungus and a gene Pst25662 encoding the sugar transporter protein Pst25662. The present invention also provides the application of the sugar transporter protein Pst25662 and its encoding gene in the breeding of wheat stripe rust resistant varieties.

[0007] To achieve the above-mentioned purpose, the technical solution adopted by the present invention is: a wheat stripe rust sugar transporter Pst25662, the sugar transporter Pst25662 plays a sugar transport function in the interaction between stripe rust and wheat, the amino acid sequence of the sugar transporter Pst25662 is shown in SEQ ID NO.2, and the nucleotide sequence of the gene Pst25662 encoding the sugar transporter Pst25662 is shown in SEQ ID NO.1.

[0008] Furthermore, the wheat stripe rust sugar transporter gene Pst25662 and the sugar transporter protein encoded by it play a sugar transport function in the interaction between stripe rust and wheat. Silencing the specific fragment of the gene Pst25662 (nucleotide sequence as shown in SEQ ID NO.3) can improve wheat resistance to stripe rust pathogens.

[0009] The invention also provides the application of the sugar transport protein Pst25662 and the encoding gene thereof in the breeding of wheat stripe rust-resistant varieties.

[0010] The present invention further provides a method for breeding disease-resistant wheat, which comprises: constructing an expression vector comprising a silencing fragment of a sugar transporter gene Pst25662 of wheat stripe rust; transferring the fragment into a wheat material by Agrobacterium-mediated transformation; obtaining transgenic wheat in which the sugar transporter gene Pst25662 is silenced; and the expression vector comprises the silencing fragment of the Pst25662 gene.

[0011] In order to fully and unambiguously understand the technical solution of the present invention, it is necessary to supplement that the wheat stripe rust sugar transporter gene of the present invention is represented by an italic font "Pst25662", and the wheat stripe rust sugar transporter is represented by a non-italic font "Pst25662". Of course, those of ordinary skill in the art can clearly and completely understand the meaning and expression of the relevant genes and their encoded proteins based on the description of the present invention.

[0012] Compared with the prior art, the present invention has the following beneficial effects or advantages:

[0013] (1) The sugar transporter Pst25662 of wheat stripe rust provided by the present invention is a protein with sugar transport function reported for the first time in wheat stripe rust, and can transport multiple monosaccharides at the same time. By using host wheat to create a plant with silenced sugar transporter Pst25662 of wheat stripe rust, the expression of the sugar transporter is inhibited when wheat is infected by wheat stripe rust, and inoculation with different physiological races of wheat stripe rust will lead to a significant decrease in the spore production of the silenced plant and an increase in immune necrotic cells.

[0014] (2) Pst25662 transgenic plants showed resistance to wheat stripe rust. Therefore, the sugar transporter Pst25662 can be used to create rust-resistant wheat lines, providing excellent material for the breeding of wheat stripe rust-resistant varieties.

[0015] (3) The sugar transporter gene provided by the present invention is relatively conservative in different races, laying the foundation for creating persistent and broad-spectrum disease-resistant wheat varieties. At the same time, it has important reference significance for the target research of new biological control drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a graph showing the expression level of the sugar transporter gene Pst25662 of stripe rust provided in an embodiment of the present invention at different times after the stripe rust race CYR31 infects wheat. Figure 1 The data are the mean ± SEM of three biological replicates.

[0017] Figure 2 The fluorescence localization status diagram of the sugar transporter gene Pst25662 of stripe rust provided in the embodiment of the present invention, Figure 2 Free GFP represents GFP protein, and Pst25662-GFP represents the fusion protein of Pst25662 and GFP.

[0018] Figure 3 This is a diagram of the colony growth of the sugar transport function identification test of the sugar transport protein gene Pst25662 for different carbon sources; wherein, Control represents the empty plasmid of pDR195, Pst25662 represents the fusion plasmid of pDR195 and Pst25662, Maltose represents the carbon source is maltose, Glucose represents the carbon source is glucose, Sucrose represents the carbon source is sucrose, Fructose represents the carbon source is fructose, Mannose represents the carbon source is mannose, Mannitol represents the carbon source is mannitol, Galactose represents the carbon source is galactose, Xylose represents the carbon source is xylose, and Arabinose represents the carbon source is arabinose.

[0019] Figure 4 The figure shows the DNA detection results of transgenic plants containing the Pst25662-specific silencing fragment; wherein, M represents DNA Marker, H2O represents water template, WT represents wild type, PC represents plasmid, and L19 and L43 represent RNAi plant lines 19 and 43.

[0020] Figure 5 The phenotypes of transgenic silenced plants inoculated with different stripe rust races CYR32, CYR33, and CYR34; among them, Fielder is the wild-type control, and L19 and L43 represent the two transgenic lines 19 and 43 of the T3 generation. DETAILED DESCRIPTION

[0021] The technical solution of the present invention is described below in conjunction with embodiments; however, the present invention is not limited to the following embodiments.

[0022] The experimental methods and detection methods in the following embodiments are all conventional methods unless otherwise specified; the agents and materials described are all commercially available unless otherwise specified; the indicator data described are all conventional measurement methods unless otherwise specified.

[0023] Example 1

[0024] This example provides an analysis experiment on the expression level of the sugar transporter gene Pst25662 of stripe rust at different times after the stripe rust race CYR31 infects wheat.

[0025] 1. Acquisition of Stripe Rust Real-time Fluorescence Quantitative PCR Samples

[0026] Wheat seeds (water source 11) were planted in a 10 cm diameter flower pot and placed in a 16 / 8 h light / dark cycle and a temperature of 16 ° C. When the wheat seedlings grew to the one-leaf-one-heart period, the fresh wheat stripe rust summer spores were diluted with electronic fluoride liquid, and 10 μL of the diluted spore liquid was evenly smeared and inoculated on the wheat leaves with a pipette. The inoculated wheat seedlings were kept moisturized in the dark at 15 ° C for 36 hours and then continued to be cultured under normal light conditions. After the wheat leaves were inoculated, they were sampled at 6h, 12h, 18h, 24h, 48h, 72h, and 120h as real-time fluorescence quantitative PCR samples. Each group of samples selected leaves from at least three different wheat seedlings, and mainly collected the middle area of ​​the inoculated leaves. After sampling, they were immediately stored at -80 ° C for standby use.

[0027] 2. Preparation of Stripe Rust Template

[0028] The collected samples were used to prepare cDNA templates for real-time fluorescence quantitative detection of stripe rust using RNA extraction kit and vazyme reverse transcription kit (Beijing Huayueyang Biotechnology Co., Ltd.) according to the operating instructions.

[0029] 3. Real-time fluorescence quantitative PCR detection

[0030] The wheat stripe rust elongation factor gene PstEF was used as an internal reference gene and the gene expression was analyzed by relative quantitative method.

[0031] The sequences of the internal reference gene primers are:

[0032] PstEF-F: TTCGCCGTCCGTGATATGAACAA;

[0033] PstEF-R: ATGCGTATCATGGTGGTGGAGTGA.

[0034] The Pst25662-specific primers were designed using Primer Premier 5.0 software. The Pst25662-specific primer sequences are:

[0035] DL-25662-F:CGTCATTGGCTTAACCGTTCTG;

[0036] DL-25662-R:GTCGCCACCACGTTAACTACATT.

[0037] UltraSYBR One Step RT-qPCRKit fluorescent quantitative PCR kit (Kangwei Century Biotechnology Co., Ltd.) was used according to the operating instructions, and the relevant detection was completed using Bio-Rad iQ5 real-time fluorescent quantitative PCR instrument. The relative expression of different genes was based on 2 -ΔΔCt The expression level of PstEF was used as a reference for calculation.

[0038] The results are as follows Figure 1 As shown in the figure, when the stripe rust fungus CYR31 infects wheat for 12 hours, the cavity below the wheat stomata forms a substomatal capsule, the stripe rust fungus begins to produce a large number of primary hyphae, and the sugar transporter gene Pst25662 is expressed in large quantities, making full preparations for the absorption of sugar substances. At 18 hours, the expression of the sugar transporter gene Pst25662 is the highest, at which time the stripe rust fungus is transporting a large amount of sugar substances from the host to itself. After that, the protein has been expressed at a high level, indicating that it has been responsible for obtaining sugar substances from wheat tissues and has been playing an important role.

[0039] Example 2

[0040] This example provides a localization test of the sugar transporter Pst25662 in cells.

[0041] 1. Amplification of the full-length sugar transporter gene Pst25662 of Puccinia striiformis

[0042] Primer Premier 5.0 software was used to design full-length amplification primers Pst25662-F and Pst25662-R. The primer sequences are:

[0043] Pst25662-F: ATGCCTGCCGTAGCCG;

[0044] Pst25662-R:TCAAATGTGCTCCAGCTTCTCT.

[0045] Using wheat stripe rust cDNA as template, 2×TaqMasterMix PCR mixture (Kangwei Century Biotechnology Co., Ltd.) and full-length gene primers were used for PCR amplification. The reaction system is:

[0046]

[0047] The PCR instrument program was: 95°C for 5 min pre-denaturation, 95°C for 15 s denaturation, 58°C for 30 s annealing, 72°C for 1 min extension, 40 cycles in total, and 72°C for 10 min additional extension. After the PCR program was completed, the PCR product was tested by agarose gel recovery gel, and the bands that matched the size of the target gene were recovered using the omega gel recovery kit, and the operation was performed according to the instructions (Omega Bio-Tek).

[0048] The Pst25662 gene fragment recovered from the gel was connected to the vector pMD19-T Simple and transformed into the competent E. coli DH5α (Shanghai Weidi Biotechnology Co., Ltd.) to screen the positive clones. The positive clones were then sent to Beijing Qingke Biotechnology Co., Ltd. for plasmid sequencing, and the plasmid with the correct sequencing results was retained for the next experiment. The plasmid was labeled: T-Pst25662.

[0049] 2. Yeast subcellular localization plasmid construction

[0050] According to the sequence characteristics of the multiple cloning site of pDR195, GFP primers containing BamHI homology arm sequences were designed. The primer sequences used were:

[0051] 195-GFP-F:CGGCCGCGCGGATCCATGGTGAGCAAGGGCG;

[0052] 195-GFP-R:TCCAAAGCTGGATCCTTACTTGTACAGCTCGTC.

[0053] The high-fidelity enzyme Primer STAR Max Premix (2×) produced by TAKARA was used, and the primer pairs 195-GFP-F and 195-GFP-R were used to amplify the GFP sequence containing the homology arm of the BamHI site of the pDR195 vector, and the bands of the same size were recovered by gel. The pDR195 plasmid was digested with BamHI, and then the linearized pDR195 plasmid and the amplified GFP gel product were cloned in one step using the ClonExpressII One Step Cloning Kit (Nanjing Novogene Biotech Co., Ltd.) to construct the pDR195-GFP plasmid, screen the positives, and send the plasmid with the correct sequence for retention. At this time, the pDR195 plasmid already contains the GFP sequence.

[0054] According to the sequence characteristics of the multiple cloning site of the pDR195 vector, the Pst25662 primer containing the XhoI homology arm sequence was designed. The primer sequence is:

[0055] 195-25662GFP-F: ATATACCCCAGCCTCGAGATGCCTGCCGTAGCCG;

[0056] 195-25662GFP-R:

[0057] CACCATGGATCCCTCGAGAATGTGCTCCAGCTTC.

[0058] Use high-fidelity enzyme Primer STAR Max Premix (2×), primer pair 195-25662GFP-F, 195-25662GFP-R, T-Pst25662 plasmid as template to amplify the Pst25662 sequence containing the homology arm of the XhoI site of the pDR195 vector, and recover the band of the appropriate size by gel. Use ClonExpress II One Step Cloning Kit for one-step cloning as above, and the following operation is the same as the construction of pDR195-GFP plasmid to obtain the correct pDR195-25662GFP plasmid.

[0059] 3. Yeast Subcellular Localization

[0060] A single colony of YSL2-1 yeast was inoculated with YPD (with 2% maltose) liquid medium and cultured at 30°C and 250 rpm for 48 h. The yeast mother solution was transferred to the above YPD medium with 2% maltose at a ratio of 1:100 and the bacteria were shaken until the final concentration reached OD 6000.6-0.8; collect 2mL bacterial solution, centrifuge at 4500rpm for 5min at room temperature, and discard the supernatant; resuspend with 2mL ddH2O, centrifuge at 4500rpm for 5min, and discard the supernatant; add 100μL LiAc transformation solution (Shaanxi Puint Biological Co., Ltd.) and gently resuspend, let stand for 10min; add 50μL ssDNA, 3-5μg of target plasmid pDR195-GFP or pDR195-25662GFP, 400μL LiAc transformation solution in sequence, mix well, place in a 30℃ shaker, and recover at 200rpm for 30min. Heat shock at 42℃ for 15min, gently invert and mix 7-8 times every 7.5min, centrifuge at 4500rpm for 5min, and discard the supernatant. The bacteria were resuspended in 500 μL ddH2O, centrifuged at 4500 rpm for 5 min, and the supernatant was discarded; 100 μL ddH2O was added for resuspending, and the transformed yeast strain was spread on the solid screening medium of SD-Ura, and cultured for 3 days to obtain positive clones.

[0061] The positive transformed strains with pDR195-GFP and pDR195-25662GFP were inoculated into SD-Ura screening medium with 2% maltose as the carbon source, and cultured at 30°C and 220 rpm for 48 h. Then, they were transferred to a new screening medium at a weight ratio of 1:100 and continued to be cultured until the bacterial liquid OD reached 0. 600 The value is between 0.5-0.7, collect 2mL of bacterial solution and centrifuge at 8000rpm for 1min at room temperature, discard the supernatant, add 1mL ddH2O to resuspend, take an appropriate amount of yeast solution to make a slide, use ultra-high resolution laser confocal microscope LSM880 for positioning observation and photography. Among them, pDR195-GFP only expresses GFP protein, and pDR195-25662GFP expresses Pst25662 and GFP fusion protein.

[0062] The results are as follows Figure 2 As shown, green fluorescence was observed to be expressed throughout the yeast cells when only GFP protein was expressed. When the sugar transporter Pst25662 was fused with GFP protein, green fluorescence was only observed on the yeast cell membrane. The localization results showed that the sugar transporter Pst25662 was localized in the cell membrane, which was consistent with the membrane localization and transmembrane transport mode of sugar transporters.

[0063] Example 3

[0064] This example provides a test to verify the sugar transport function of protein Pst25662.

[0065] According to the sequence characteristics of the pDR195 multiple cloning site, the Pst25662 primer containing the BamHI homology arm sequence was designed. The same operation as in Example 2 was performed to construct the pDR195-Pst25662 vector. The primer sequence is:

[0066] 195-25662-F: CGGCCGCGCGGATCCATGCCTGCCGTAGCCG;

[0067] 195-25662-R: TCCAAAGCTGGATCCTCAAATGTGCTCCAGC.

[0068] The constructed pDR195-Pst25662 and the empty vector pDR195 were respectively transformed into the yeast sugar transporter deletion mutant YSL2-1 strain, in which the sucrose and hexose transporters were knocked out, by heat shock transformation method to obtain positive transformants, and the operation was the same as in Example 2.

[0069] The positive transformed strain was inoculated into SD-Ura liquid screening medium with 2% maltose as carbon source, and cultured at 30°C and 220 rpm until the bacterial liquid OD 600 The value is between 0.5 and 0.7. Collect 2 mL of bacterial solution, centrifuge at 8000 rpm for 1 min at room temperature, and discard the supernatant. Resuspend the bacteria with sterile ddH2O, centrifuge at 8000 rpm for 1 min, and repeat the washing twice. Dilute the bacterial suspension with sterile ddH2O to the same concentration OD 600 =0.6, and continue to shake at 30°C and 220rpm for 5 hours of starvation treatment. After the end, the suspension was diluted in 10-fold gradients to different concentrations, and a total of 5 concentrations were diluted. 5 μL of these bacterial suspensions were taken in turn and inoculated onto SD-Ura solid screening medium containing different sugars as carbon sources (maltose, sucrose, glucose, fructose, galactose, mannose, xylose, arabinose, mannitol), and the sugar concentration was 2% (w / v). After inverted culture at 30°C for 3 days, the growth of the colonies was photographed and recorded.

[0070] The results are as follows Figure 3 As shown, control represents the empty plasmid of pDR195, which is the control group; Pst25662 represents the fusion plasmid of pDR195 and Pst25662, which is the experimental group. Different carbon sources were added to the SD-Ura solid screening medium to verify the transport function. The maltose carbon source group showed that the yeast state was normal. Other experimental groups showed that the sugar transport protein Pst25662 has the ability to transport multiple sugars such as sucrose, glucose, fructose, galactose, mannose, and mannitol.

[0071] Example 4

[0072] This example provides a verification test of the conservativeness of transgenic plants with silenced Pst25662 gene to wheat stripe rust.

[0073] 1. Construction of transgenic vector

[0074] The ORF region of the Pst25662 gene sequence of the sugar transporter of stripe rust was compared with the homologous genes of wheat and wheat stripe rust, and the Pst25662 specific fragment sequence was selected for the construction of the transgenic vector, and the nucleotide sequence of the Pst25662 gene silencing fragment was (as shown in SEQ ID NO: 3). The selected target fragments were respectively inserted into two positions of the PC336 vector by homologous recombination (one fragment was inserted forward and the other was inserted in reverse complementation, so as to form a hairpin structure), and the PC336-25662 plasmid was obtained.

[0075] The primer sequence containing the attB site is:

[0076] attB-25662-F:

[0077] GGGGACAAGTTTGTACAAAAAAGCAGGCTTGGCTACATTGCGG GAGT;

[0078] attB-25662-R:

[0079] GGGGACCACTTTGTACAAGAAAGCTGGGTCCGATGGGATAAGC TAAAAGGGC.

[0080] 2. Transformation of Agrobacterium

[0081] Take the EHA105 competent cells stored at -80℃ and melt them on ice, add the correctly sequenced PC336-25662 plasmid, ice bath for 30 minutes, liquid nitrogen for 2 minutes, 37℃ water bath for 3 minutes, ice bath for 5 minutes, add appropriate amount of liquid LB medium, and shake culture for 3 hours; take 150μL of the transformation bacterial solution and spread it on a solid plate (rifampicin and Kana antibiotics), invert and culture in the dark until positive transformants grow.

[0082] Using Agrobacterium-mediated wheat transformation technology, the recombinant silencing vector PC336-25662 was transferred into the wheat variety Fielder material to obtain RNAi silenced plants. DNA testing was performed on the obtained plants, and positive plants were retained for subsequent verification.

[0083] The results are as follows Figure 4 It showed that all the plants used for transgenic identification were positive plants and had been successfully transferred with the silencing vector.

[0084] 3. Phenotypic Identification of Transgenic Plants

[0085] Two T3 transgenic homozygous strains were selected for disease resistance testing and inoculated with wheat stripe rust fungi: CYR32, CYR33, and CYR34, respectively, using the same inoculation method as in Example 1. Phenotypic identification was performed after sporulation of wheat leaves, and photographs were taken for record.

[0086] The results are as follows Figure 5 As shown, the spore production of stripe rust species in the silenced plants inoculated with wheat stripe rust CYR32, CYR33, and CYR34 was significantly reduced, indicating that the sugar transporter Pst25662 proposed in the present invention is highly conserved among different stripe rust species and plays a role as a key sugar transporter.

[0087] In summary, the sugar transporter Pst25662 of stripe rust proposed in the present invention plays a key role in the process of stripe rust infection of wheat, which is mainly reflected in its ability to transport a variety of sugar substances and maintain high expression throughout the infection stage. By constructing transgenic RNAi plants to silence the expression of this gene, a significant disease resistance response is produced to a variety of wheat stripe rusts. This gene is highly conserved in stripe rusts, which has a reference significance for the creation of broad-spectrum disease-resistant materials.

[0088] As described above, the present invention can be well implemented. The above embodiments are only descriptions of the preferred implementation modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various changes and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the protection scope determined by the present invention.

Claims

1. Silencing the sugar transporter gene of stripe rust Pst25662 The application of the method in the cultivation of wheat resistant to stripe rust is characterized in that: The sugar transporter gene Pst25662 The nucleotide sequence is shown in SEQ ID NO.1; The amino acid sequence of sugar transporter Pst25662 is shown in SEQ ID NO.2; The sugar transport protein Pst25662 plays a sugar transport function during the interaction between stripe rust and host plants.

Images