Application of miR-143-3p in the preparation of drugs or materials for the treatment of peripheral nerve injury

Abstract

The present invention discloses the application of miR‑143‑3p in the preparation of peripheral nerve injury repair drugs or materials. The research results of the present invention show that overexpression of miR‑143‑3p can significantly promote axon regeneration after nerve injury. The present invention uses a microfluidic device to culture motor neurons in vitro, and transfection of miR‑143‑3p mimic can significantly promote the growth and regeneration of axons of primary cultured motor neurons. In vivo experimental results show that miR‑143‑3p mimic promotes axon regeneration after peripheral nerve injury. miR‑143‑3p can participate in peripheral nerve injury repair by regulating the growth of motor neuron axons, which helps to better understand the important role of miRNA in the process of nerve injury repair and provide new targets for treatment after nerve injury.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of miR-143-3p in the preparation of drugs or materials for treating peripheral nerve injury. Background Art

[0002] The repair of peripheral nerve injury has always been a research focus and difficulty in the field of neuroscience. In clinical practice, due to the limited regeneration rate after nerve injury, the patient's muscles have already experienced irreversible muscle atrophy before denervation and reinnervation, which eventually leads to limb dysfunction. Therefore, promoting rapid axon regeneration after nerve injury and completing nerve reinnervation before irreversible damage to the target organ due to denervation is a key factor in repair.

[0003] MicroRNA (miRNA) is a type of endogenous non-coding small RNA with a length of about 20-24 nucleotides. It works by completely or incompletely binding to the untranslated region at the 3' end of the target gene, inhibiting the translation of the target gene or directly degrading the target gene. In the peripheral nervous system, miRNA can not only promote the regeneration of neuronal axons and inhibit neuronal apoptosis, but also promote peripheral nerve regeneration by regulating the proliferation and migration of Schwann cells and the phenotype of macrophages.

[0004] miR-143-3p is a highly conserved member of the miRNA family. Studies have reported that miR-143-3p is abnormally expressed in lung cancer, oral squamous cell carcinoma, liver cancer, gastric cancer, thyroid cancer, and colorectal cancer, and is involved in the malignant progression of tumor cells. In addition, miR-143-3p is a neuron-specific miRNA. Existing technical studies have shown that miR-143-3p can also be expressed in brain tissue and is closely related to the occurrence and development of neurological diseases such as Alzheimer's disease and schizophrenia. In vitro experiments have confirmed that interfering with miR-143-3p expression can alleviate glucose deprivation, hypoxic injury and apoptosis of cerebral vascular endothelial cells (Chen Boyong, Gao Qingchun, Wang Yuzhou, et al. Protective effect and mechanism of MicroRNA-143-3p on glucose-deprived and hypoxic rat brain microvascular endothelial cells [J. Stroke and Neurological Diseases, 2020, 27(5): 561-566.). Sun et al. found that inhibiting miR-143-3p expression can promote neuronal regeneration in Alzheimer's disease (Sun C, Jia N, Li R, et al. miR-143-3p inhibition promotes neuronal survival in an Alzheimer's disease cell model by targeting neuregulin-1[J]. Folia Neuropathol, 2020, 58(1): 10-21.).

[0005] Currently, there is no research on miR-143-3p in the field of peripheral nerve injury and repair. Summary of the invention

[0006] The present invention clarifies for the first time the regulatory effect of miR-143-3p on motor neurons during the repair of peripheral nerve injury.

[0007] The specific technical solutions of the present invention are as follows:

[0008] Application of miR-143-3p in the preparation of drugs or materials for treating peripheral nerve injury.

[0009] miR-143-3p is highly conserved in humans and mice. The nucleotide sequences of human and mouse miR-143-3p are completely consistent, NCBI Gene ID: 406935 (human), 387161 (mouse), and rat miR-143-3p NCBI Gene ID: 100314035.

[0010] The peripheral nerves are sciatic nerve, brachial plexus, radial nerve, axillary nerve, musculocutaneous nerve, median nerve, ulnar nerve, femoral nerve and common peroneal nerve.

[0011] Specifically, the application targets miR-143-3p, designs or screens active substances that promote the expression of miR-143-3p, overexpresses miR-143-3p, or exogenously administers miR-143-3p or its expression vector.

[0012] In a specific example of the present invention, the active substance is miR-143-3p mimics.

[0013] In the application described in the present invention, the material is a tissue engineering nerve material.

[0014] Another object of the present invention is to provide a peripheral nerve injury repair medicine or material, which contains an active substance that promotes the expression of miR-143-3p, or miR-143-3p or its expression vector.

[0015] Advantages of the present invention:

[0016] The present invention uses miR-143-3p as a molecular intervention target, and overexpression of miR-143-3p can significantly promote axon regeneration after nerve injury. The present invention uses a microfluidic device to culture motor neurons in vitro, and transfection of miR-143-3p mimic can significantly promote the growth and regeneration of axons of primary cultured motor neurons. In vivo experimental results show that miR-143-3p mimic promotes axon regeneration after peripheral nerve injury. The miR-143-3p described in the present invention can participate in the repair of peripheral nerve injury by regulating the growth of motor neuron axons, which helps to better understand the important role of miRNA in the process of nerve injury repair and provide new targets for treatment after nerve injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 These are the light microscopy and immunocytochemical staining images of motor neurons in Example 1. A: light microscopy image of motor neurons (Bar = 50 μm); B: immunocytochemical staining image of motor neurons (Bar = 25 μm); E: statistical graph of purity identification.

[0018] Figure 2 In Example 1, in vitro overexpression of miR-143-3p significantly promoted the growth of motor neurons. A: ICC results showed that transfection of miR-143-3p promoted the growth of motor neuron processes (Bar = 100 μm), and β-Tublin III marked neuronal processes; B: Statistical graph of the length of motor neuron processes promoted by miR-143-3p ( ** P <0.01 vs. Control, One-wayANOVA).

[0019] Figure 3 Transfection of miR-143-3p promotes the regeneration of motor neuron axons after axotomy in Example 2. A: ICC results show that transfection of miR-143-3p promotes the regeneration of motor neuron axons after axotomy (Bar = 75 μm), and β-Tublin III marks the regenerated axons of neurons; B: Statistical graph of the length of motor neuron axon regeneration promoted by miR-143-3p (** P <0.01 vs. Control, One-way ANOVA).

[0020] Figure 4 The tissue-engineered nerve constructed by miR-143-3p in Example 3 promotes regeneration of sciatic nerve after injury. A: Immunohistochemistry results show the regenerated axons in different groups. The right column is a partial enlargement of the white box area in the left image (Bar = 500μm, 25 μm); A: NF200 marks the regenerated axons; B: Statistical chart of the length of the regenerated axons ( **P <0.01 vs PBS group, ## P <0.01 vs NC agomir, One-way ANOVA). DETAILED DESCRIPTION

[0021] The specific steps of the present invention are described below by way of examples, but are not limited to the examples.

[0022] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art.

[0023] The present invention will be further described in detail below in conjunction with specific examples and with reference to data. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0024] In the following examples, various processes and methods not exhaustively described are conventional methods well known in the art.

[0025] The present invention is further described below in conjunction with specific embodiments.

[0026] Example 1 Overexpression of miR-143-3p in vitro promotes motor neuron axon growth.

[0027] 1. Culture of motor neurons: 13.5-day-old SD rats were killed by cervical dislocation, and the fetuses were removed. The spinal canal was opened under a dissecting microscope, and the dorsal root ganglia and capsule were removed. The ventral spinal cord of the fetus was isolated and placed in a culture dish containing ice-cold dissection fluid. Microscissors were used to cut the fetus into 0.5 cm 3 After the tissue pieces are sized, transfer them to a 15 mL centrifuge tube, add 1 ml of 0.125% trypsin to disperse the tissue, incubate at 37°C for 30 min, add DMEM + 10% FBS to terminate digestion, centrifuge at 1000 r / min for 5 min, and discard the supernatant. The cell precipitate is dispersed with L15 and filtered through a 400-mesh screen. Slowly add the filtered cells to 5 ml of gradient centrifugation solution to separate them into layers, and centrifuge at 2000 rpm for 20 min. Add 5 mL of 9% Optiprep gradient separation solution, centrifuge at 2000 rpm for 20 min, and the liquid in the centrifuge tube is divided into 3 layers, of which the middle layer contains spinal motor neurons. Carefully aspirate the middle layer, add 3 mL of culture medium, centrifuge at 1000 r / min for 5 min, and discard the supernatant to remove cell debris. After resuspending in DMEM+10% FBS, cells were inoculated. After 4 h, cell adhesion and viability were observed. Pre-warmed neuronal culture medium (97% Neurobasal+2% B27+1% GluMAX) was replaced. Half of the medium was replaced every 3 days. β-Tubulin The purity of motor neurons labeled with acetylcholine transferase (ChAT) was determined by Figure 1 .

[0028] 2. Neuronal cell mimics transfection

[0029] After the motor neurons were seeded on the microfluidic device and allowed to adhere to the wall, Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific, Catalog No.: 13778075) was diluted with Opti-MEM reduced serum medium (Gibco, Catalog No.: 31985070) to obtain the transfection solution. The transfection solution was then diluted with PS-free motor neuron medium (ratio of 1440µl + 160µl transfection solution) and then transfected with miR-143-3p mimics (rno-miR-143-3p MIMIC sequence: sense chain (5'->3'): UGAGAUGAAGCACUGUAGCUCA, antisense chain (5'->3'): UGAGCUACAGUGCUUCAUCUCA) and negative control (final concentration 100 nM, Guangzhou Ruibo Biotechnology Co., Ltd.), and the medium was changed to motor neuron medium after 8 hours.

[0030] 3. Immunofluorescence staining of cells and measurement of axonal growth length

[0031] 4 days after transfection of motor neuron cells, the cell culture medium was discarded, the cells were rinsed with pre-warmed PBS, 4% paraformaldehyde was added, and the cells were fixed at room temperature for 20 min. After discarding the paraformaldehyde, the cells were washed three times with PBS, each time for 5 min. Immunohistochemistry blocking solution was added and the cells were blocked at room temperature for 1 h. The primary antibody mouse anti-β-Tublin Ⅲ antibody (1:400, abcam) was added and incubated overnight at 4 ℃. The primary antibody was discarded, and the cells were washed three times with PBS, each time for 5 min. The fluorescent secondary antibody Donkey anti-mouse 488 (1:400, Sigma) was added and incubated at room temperature in the dark for 2 h. The secondary antibody was discarded, and the cells were washed three times with PBS, each time for 5 min. An appropriate amount of PBS was added, and the cells were observed under a ZEISS upright fluorescence microscope and photographed. The 15 longest neurites were selected in each field of view, and the length was measured and counted using Image J software. The results showed that overexpression of miR-143-3p (miR-143-3p mimics) could significantly promote the growth of motor neuron axons ( Figure 2 ).

[0032] Example 2 Overexpression of miR-143-3p in vitro promotes motor neuron axon regeneration.

[0033] 1. Culture of motor neurons: 13.5-day-old SD rats were killed by cervical dislocation, and the fetuses were removed. The spinal canal was opened under a dissecting microscope, and the dorsal root ganglia and capsule were removed. The ventral spinal cord of the fetus was isolated and placed in a culture dish containing ice-cold dissection fluid. Microscissors were used to cut the fetus into 0.5 cm 3 After the tissue pieces are sized, transfer them to a 15 mL centrifuge tube, add 1 ml of 0.125% trypsin to disperse the tissue, incubate at 37°C for 30 minutes, add DMEM + 10% FBS to terminate digestion, centrifuge at 1 000 r / min for 5 minutes, and discard the supernatant. The cell precipitate is dispersed with L15 and filtered through a 400-mesh screen. Slowly add the filtered cells to 5 ml of gradient centrifugation solution to separate them, and centrifuge at 2000 rpm for 20 minutes. Add 5 mL of 9% Optiprep gradient separation solution, centrifuge at 2000 rpm for 20 minutes, and the liquid in the centrifuge tube is divided into 3 layers, of which the middle layer contains spinal motor neurons. Carefully aspirate the middle layer, add 3 mL of culture medium, centrifuge at 1000 r / min for 5 minutes, and discard the supernatant to remove cell debris. After resuspending in DMEM+10% FBS, inoculate the cells. After 4 hours, observe the cell adhesion and viability, and replace with pre-warmed neuronal culture medium (97% Neurobasal+2% B27+1% GluMAX). Then change half the volume of the medium every 3 days.

[0034] 2. Neuronal cell mimics transfection

[0035] After the motor neurons were inoculated into the microfluidic device and allowed to adhere to the wall, Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific, Catalog No.: 13778075) was diluted with Opti-MEM reduced serum medium (Gibco, Catalog No.: 31985070) to obtain the transfection solution. The transfection solution was then diluted with PS-free motor neuron medium (ratio of 1440ul + 160ul transfection solution) and transfected with miR-143-3pmimics and negative control (final concentration 100 nM, Guangzhou Ruibo Biotechnology Co., Ltd.). After 8 hours, the medium was replaced with motor neuron medium.

[0036] 3. Immunofluorescence staining of cells and measurement of regenerated axon length

[0037] Four days after transfection of motor neuron cells, axonal axotomy was performed using a vacuum pump. The suction pressure was set to greater than 0.06 MPa and suction was performed for 15-30 s before adding the corresponding culture medium. After culturing for 24 h, the cell culture medium was discarded, the cells were rinsed once with pre-warmed PBS, 4% paraformaldehyde was added, and the cells were fixed at room temperature for 20 min. After discarding the paraformaldehyde, the cells were washed three times with PBS, each for 5 min. Immunohistochemistry blocking solution was added and blocked for 1 h at room temperature. The primary antibody mouse anti-β-Tublin Ⅲ antibody (1:400, abcam) was added and incubated overnight at 4°C. The primary antibody was discarded, and the cells were washed three times with PBS, each for 5 min. The fluorescent secondary antibody Donkey anti-mouse 488 (1:400, Sigma) was added and incubated at room temperature for 2 h in the dark. The secondary antibody was discarded, and the cells were washed three times with PBS, each for 5 min. An appropriate amount of PBS was added, and the cells were observed and photographed under a ZEISS upright fluorescence microscope. The longest 15 neurites were selected from each field of view, and the length was measured and counted using Image J software. The results showed that overexpression of miR-143-3p (miR-143-3p mimics) can significantly promote the regeneration of motor neuron axons ( Figure 3 ).

[0038] Example 3 Application of tissue-engineered nerve constructed by miR-143-3p described in the present invention in repairing nerve defects

[0039] 1. Preparation of miR-143-3p tissue engineering nerves: First, sterilize the silicone tube and place it in a sterile culture dish. Cut a 7 mm long silicone tube (inner diameter 2 mm, outer diameter 3 mm) according to the experimental requirements, and mix PBS, miR-143-3p agomir or NC agomir with thermosensitive Matrigel matrix gel at a volume ratio of 1:1. All operations were performed on ice. Inject about 18 µl of the uniformly mixed PBS, miR-143-3p agomir or NC agomir and Matrigel matrix gel mixture into the silicone catheter, place the catheter at 37 ° C for 5 min, and then remove it. The mixture solidifies into a gel and can be used to repair peripheral nerve defects.

[0040] 2. A 5 mm sciatic nerve defect bridging model was established in vivo in rats to observe the effect of miR-143-3p on sciatic nerve regeneration. SD rats were randomly divided into three groups: PBS group, miR-143-3p agomir group, and NC agomir group. After deep anesthesia, the skin of the right thigh was prepared and disinfected, and the skin was incised. The muscles were bluntly separated to expose the sciatic nerve. The sciatic nerve was transected and 3 mm was resected. After retraction on both sides, a 5 mm defect was formed and photographed. An 8-0 suture needle with thread was used. One end of the nerve stump was connected and fixed with a surgical knot, and the other end was connected to the pre-made tissue engineering nerve. The nerve stump was fixed to the inner wall of the silicone tube, the outer skin was sutured, and the rat was placed on a warm table mat to wait for awakening. Rats were fed routinely after surgery. Perfusion sampling, sectioning, and immunohistochemical staining were performed 10 days after surgery. NF-200 was used to mark the regenerated axons, and the length of the regenerated axons was counted. The immunohistochemical results showed that compared with the PBS and NC agomir groups, the miR-143-3p agomir group could significantly increase the length of regenerated axons, indicating that miR-143-3p can promote axon regeneration after sciatic nerve injury ( Figure 4 ).

Claims

1. The use of miR-143-3p mimics in the preparation of drugs for treating peripheral nerve injury or tissue engineering neural materials, characterized in that: The sequence of the miR-143-3p mimic is: sense strand 5'-UGAGAUGAAGCACUGUAGCUCA-3', antisense strand 5'-UGAGCUACAGUGCUUCAUCUCA-3'; the peripheral nerve is the sciatic nerve.

Images